CN104419705B - Snp marker and application thereof - Google Patents
Snp marker and application thereof Download PDFInfo
- Publication number
- CN104419705B CN104419705B CN201310411231.7A CN201310411231A CN104419705B CN 104419705 B CN104419705 B CN 104419705B CN 201310411231 A CN201310411231 A CN 201310411231A CN 104419705 B CN104419705 B CN 104419705B
- Authority
- CN
- China
- Prior art keywords
- epinephelus coioide
- snp marker
- total length
- measured
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 239000003550 marker Substances 0.000 title claims abstract description 71
- 241000357444 Epinephelus coioides Species 0.000 claims abstract description 109
- 239000002773 nucleotide Substances 0.000 claims abstract description 10
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 10
- 238000000034 method Methods 0.000 claims description 17
- 238000012360 testing method Methods 0.000 claims description 16
- 238000012408 PCR amplification Methods 0.000 claims description 15
- 238000001514 detection method Methods 0.000 claims description 13
- 238000012163 sequencing technique Methods 0.000 claims description 7
- 108020004414 DNA Proteins 0.000 description 18
- 238000009395 breeding Methods 0.000 description 16
- 230000001488 breeding effect Effects 0.000 description 14
- 241000321428 Epinephelus guttatus Species 0.000 description 12
- 239000000047 product Substances 0.000 description 9
- 241000251468 Actinopterygii Species 0.000 description 5
- 239000012634 fragment Substances 0.000 description 5
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- 230000003321 amplification Effects 0.000 description 4
- 238000012098 association analyses Methods 0.000 description 4
- 230000008901 benefit Effects 0.000 description 4
- 238000006243 chemical reaction Methods 0.000 description 4
- 238000011161 development Methods 0.000 description 4
- 230000018109 developmental process Effects 0.000 description 4
- 238000005516 engineering process Methods 0.000 description 4
- 239000000463 material Substances 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 230000000694 effects Effects 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- 238000001556 precipitation Methods 0.000 description 3
- ISWSIDIOOBJBQZ-UHFFFAOYSA-N Phenol Chemical compound OC1=CC=CC=C1 ISWSIDIOOBJBQZ-UHFFFAOYSA-N 0.000 description 2
- 239000008346 aqueous phase Substances 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 230000004087 circulation Effects 0.000 description 2
- 239000012153 distilled water Substances 0.000 description 2
- 239000003147 molecular marker Substances 0.000 description 2
- 238000002205 phenol-chloroform extraction Methods 0.000 description 2
- 238000003752 polymerase chain reaction Methods 0.000 description 2
- 238000004321 preservation Methods 0.000 description 2
- 239000011535 reaction buffer Substances 0.000 description 2
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 description 2
- 238000011144 upstream manufacturing Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 241000581364 Clinitrachus argentatus Species 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 102000035195 Peptidases Human genes 0.000 description 1
- 108091005804 Peptidases Proteins 0.000 description 1
- 241001417495 Serranidae Species 0.000 description 1
- 108010006785 Taq Polymerase Proteins 0.000 description 1
- 241000218636 Thuja Species 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000010165 autogamy Effects 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- YTRQFSDWAXHJCC-UHFFFAOYSA-N chloroform;phenol Chemical compound ClC(Cl)Cl.OC1=CC=CC=C1 YTRQFSDWAXHJCC-UHFFFAOYSA-N 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 238000013016 damping Methods 0.000 description 1
- 229960000935 dehydrated alcohol Drugs 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 230000008034 disappearance Effects 0.000 description 1
- 229960004756 ethanol Drugs 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 230000004907 flux Effects 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- 230000012447 hatching Effects 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- PHTQWCKDNZKARW-UHFFFAOYSA-N isoamylol Chemical compound CC(C)CCO PHTQWCKDNZKARW-UHFFFAOYSA-N 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 238000001819 mass spectrum Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000012074 organic phase Substances 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
- 239000003643 water by type Substances 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses SNP marker and application thereof.Wherein, does is this SNP marker SEQ? ID? nucleotide sequence shown in NO:1 is the 251st bit base T or C from 5 ' end.The total length proterties of SNP marker of the present invention and Epinephelus coioide is closely related, and can be effective to the molecular mark of Epinephelus coioide.
Description
Technical field
The present invention relates to SNP marker and application thereof.Particularly, the present invention relates to the SNP marker that Epinephelus coioide total length proterties is relevant, for detecting primer pair and the test kit of aforementioned SNP marker, aforementioned SNP marker, primer pair, the test kit purposes in Epinephelus coioide seed selection, and the method detecting Epinephelus coioide total length proterties.
Background technology
Cabrilla is famous and precious marine fish.Closely during the last ten years, cabrilla artificial breeding technology relative maturity, the cultivation scale of cabrilla also expands gradually, developing rapidly of cabrilla industry, for promotion fisherman's increased income, meets national fishery products demand, optimizes culture fishery structure significant.But plant matter and degenerate, improved seeds shortage is the Main Bottleneck of cabrilla industry Sustainable Healthy Development.Therefore, the key that cabrilla improved Varieties has become China's cabrilla industry development is cultivated.
Traditional fish breeding method places one's entire reliance upon phenotype, there is the cycle long and efficiency obstacle that cannot go beyond such as low.Molecular breeding, i.e. molecular marker assisted selection breeding, refers to and utilizes DNA molecular marker to select breeding material, the important economical trait of comprehensive improvement seed selection species, is the breeding method that traditional genetic breeding and modern molecular biology organically combine.Molecular breeding is that fish breeding opens up a new way, and along with the development of modern biotechnology, the effect of molecule marker in fish breeding will become increasingly conspicuous.In the breeding of cabrilla, people wish by closely related for growth traits, and with the selection of the closely linked DNA marker of quantitative character, to realize early stage seed selection and to improve the target of breeding accuracy, thus obtain larger genetic progress.
But the molecule marker that the growth traits that present stage can be effective to cabrilla breeding is correlated with still has to be excavated.
Summary of the invention
The present invention is intended at least to solve one of technical problem existed in prior art.For this reason, it is relevant to cabrilla growth traits that one object of the present invention is to propose one, can be effective to the SNP marker of cabrilla seed selection.
Wherein, it should be noted that, SNP(singlenucleotidepolymorphism, SNP, i.e. single nucleotide polymorphism) be the molecule genetic marker proposed by the human genome research centre scholar Lander of Massachusetts Institute Technology for 1996, mainly refer to the DNA sequence polymorphism caused by the variation of single core thuja acid in genomic level.The polymorphism that SNP shows only relates to the variation of single base, and performance has conversion, transversion, insertion and disappearance etc.
According to an aspect of the present invention, the invention provides the SNP marker that a kind of Epinephelus coioide total length proterties is relevant.According to embodiments of the invention, this SNP marker is the 251st bit base T or C from 5 ' end of nucleotide sequence shown in SEQIDNO:1.According to embodiments of the invention, shown in SEQIDNO:1, nucleotide sequence is as follows: AGGTCCTTCACAAAGCCGTCACCGTCCACTGACACCACATACGTCACTGGAGCTGT TGCATTCTTGGAGCAGAGATGAGGCATCCCAACACCGTGCTCCACATCTACGCAAA CCCAGGATGAAGTTTTCTCCAAATACACCTCCAACCACTCGTCCGCCCCAGGCCCC TCCTTCTTTTTCCCACCCCGCTTTGTTGTGTTACTTGTTGTTACTTCTTCCTCATC ATCTTCCTCTTGCTCTTCGCCCTCCTYGTCTTTCAACTGTTTCTTCCCTCCACTGC TCCTCCTCTTCGAAGCTGCAGTGTTCTTGCTCGTCCCTTTCCCCTTCTTCCCCTTT GTGGATTTAGCCCCTCCCTCTGAATCCTCACTGTCCTCGTCGCTTGTTGCCTGAAA CTCCTCATCACTAAGCCCCTCCTCCTCCTGTTCCCCTTCGCTGTTACTTTCTTCCT TGTAGCTGACTTTTGAGGCGATGCTGCGACG (SEQIDNO:1).
Contriver finds, the site genotype of this SNP marker is isozygoty that to be significantly higher than genotype be herein the Epinephelus coioide of CC or heterozygosis TC of isozygotying for the total length of Epinephelus coioide of TT.And then, according to embodiments of the invention, by detecting the above-mentioned SNP of Epinephelus coioide, effectively can determine its total length proterties, particularly, as previously mentioned, this SNP site is isozygoty that to be significantly higher than genotype be herein the Epinephelus coioide of CC or heterozygosis TC of isozygotying for the total length of Epinephelus coioide of TT, such as, when the genotype of this SNP site is TT, then can determine the individuality belonging to fast growth of Epinephelus coioide to be measured.Thus, contriver determines, the total length proterties of SNP marker of the present invention and Epinephelus coioide is closely related, and can be effective to the molecular mark of Epinephelus coioide.And then Seedling selection can be carried out according to actual breeding demand growth selection speed epinephelus coioides breeding material, effectively can improve efficiency and the accuracy of breeding further, improve the genetic level of Epinephelus coioide reproductive population, thus Epinephelus coioide improved seeds can be selected accurately and efficiently.In addition, according to some embodiments of the present invention, utilize SNP marker of the present invention to carry out Epinephelus coioide molecular mark, there is early screening, save time, the advantage that with low cost, accuracy is high.
According to a further aspect in the invention, present invention also offers a kind of primer pair for detecting foregoing SNP marker of the present invention.According to embodiments of the invention, described primer pair has the nucleotide sequence shown in SEQIDNO:2-3.Particularly, the sequence of primer pair of the present invention is as follows:
Upstream primer: AGGTCCTTCACAAAGCCGTCAC (SEQIDNO:2);
Downstream primer: CGTCGCAGCATCGCCTCAAA (SEQIDNO:3).
According to embodiments of the invention, the fragment utilizing primer pair of the present invention effectively can treat above-mentioned relevant to the total length proterties SNP marker place surveying Epinephelus coioide carries out pcr amplification, and then by the detection that can effectively realize this SNP marker of checking order, determine the genotype in this SNP marker site of Epinephelus coioide to be measured, and then effectively can determine the total length proterties of Epinephelus coioide to be measured.Particularly, this SNP marker site genotype is isozygoty that to be significantly higher than genotype be herein the Epinephelus coioide of CC or heterozygosis TC of isozygotying for the total length of Epinephelus coioide of TT, such as, when the genotype of this SNP site is TT, then can determine the individuality belonging to fast growth of Epinephelus coioide to be measured.Thus, for detecting the primer pair of foregoing SNP marker of the present invention, the molecular mark of Epinephelus coioide can be effective to, and then can assist and realize short period of time, low cost, high accuracy ground seed selection Epinephelus coioide improved seeds in early days.
According to another aspect of the invention, present invention also offers a kind of test kit for detecting foregoing SNP marker.According to embodiments of the invention, this test kit comprises: the foregoing primer pair for detecting SNP marker of the present invention.Namely the primer pair with the nucleotide sequence shown in SEQIDNO:2-3 is comprised in test kit of the present invention.According to embodiments of the invention, utilize the primer pair comprised in test kit of the present invention, effectively can realize the polymorphic detection treating the above-mentioned SNP marker relevant to total length proterties surveying Epinephelus coioide, determine the genotype in this SNP marker site of Epinephelus coioide to be measured, and then effectively can determine the total length proterties of Epinephelus coioide to be measured.Particularly, this SNP marker site genotype is isozygoty that to be significantly higher than genotype be herein the Epinephelus coioide of CC or heterozygosis TC of isozygotying for the total length of Epinephelus coioide of TT, such as, when the genotype of this SNP site is TT, then can determine the individuality belonging to fast growth of Epinephelus coioide to be measured.Thus, test kit for detecting foregoing SNP marker of the present invention of the present invention, the molecular mark of Epinephelus coioide can be effective to, and then can assist and realize short period of time, low cost, high accuracy ground seed selection Epinephelus coioide improved seeds in early days.
In accordance with a further aspect of the present invention, present invention also offers foregoing SNP marker of the present invention, primer pair or test kit, the purposes in Epinephelus coioide seed selection.As previously mentioned, by the reagent that can be used in detecting the SNP marker relevant to Epinephelus coioide total length proterties of the present invention such as aforesaid primer pair or comprise the test kit etc. of this primer pair, effectively can detect the genotype of the above-mentioned SNP marker determining Epinephelus coioide to be measured, and then effectively can determine the total length proterties of Epinephelus coioide to be measured based on the genotype obtained, thus effectively can assist Epinephelus coioide seed selection.
And then, according to a further aspect in the invention, present invention also offers a kind of method detecting Epinephelus coioide total length proterties.According to embodiments of the invention, the method surveys by treating the detection that Epinephelus coioide carries out foregoing SNP marker, determines the total length proterties of described Epinephelus coioide to be measured.Particularly, can by the reagent that can be used in detecting the SNP marker relevant to Epinephelus coioide total length proterties of the present invention such as aforesaid primer pair or comprise the test kit etc. of this primer pair, treat survey Epinephelus coioide and carry out pcr amplification, order-checking, to detect the genotype determining the above-mentioned SNP marker of Epinephelus coioide to be measured, and then effectively can determine the total length proterties of Epinephelus coioide to be measured based on the genotype obtained.Wherein, as previously mentioned, this SNP marker site genotype is isozygoty that to be significantly higher than genotype be herein the Epinephelus coioide of CC or heterozygosis TC of isozygotying for the total length of Epinephelus coioide of TT, such as, when the genotype of this SNP site is TT, then and the individuality belonging to fast growth of Epinephelus coioide to be measured.Thus, the method of detection Epinephelus coioide total length proterties of the present invention, Epinephelus coioide total length proterties can be detected fast, efficiently and accurately, and then the molecular mark of Epinephelus coioide can be effective to, thus can assist and realize short period of time, low cost, high accuracy ground seed selection Epinephelus coioide improved seeds in early days.
In addition, the method for detection Epinephelus coioide total length proterties according to the above embodiment of the present invention can also have following additional technical characteristic:
According to embodiments of the invention, treat and survey the method that Epinephelus coioide carries out SNP marker detection and be not particularly limited.Order-checking, single strand conformation polymorphism polymerase chain reaction (PCRsinglestrandconformationpolymorphism, PCR-SSCP), the technology such as restriction fragment length polymorphism polymerase chain reaction (PCR-restriTCionfragmentlengthpolymorphism, PCR-RFLP) and flight time mass spectrum all can realize the detection of SNP.Wherein, order-checking is that a kind of accuracy is the highest, handiness strong, the detection technique that flux is large, sense cycle is short.Only need at the both sides of SNP site design pair of primers, the product of amplification 200-1000bp, then can the genotype of direct-detection SNP site by order-checking.Thus, the present invention adopts the method for order-checking to carry out SNP marker detection.According to concrete examples more of the present invention, surveying by treating the detection that Epinephelus coioide carries out foregoing SNP marker, determining the total length proterties of described Epinephelus coioide to be measured, comprising further: the genomic dna extracting Epinephelus coioide to be measured; Utilize foregoing primer pair, the genomic dna of described Epinephelus coioide to be measured is carried out pcr amplification, to obtain pcr amplification product; Described pcr amplification product is checked order, to obtain sequencing result; Based on described sequencing result, determine the genotype of the described SNP marker of described Epinephelus coioide to be measured; And the genotype of described SNP marker based on described Epinephelus coioide to be measured, determine the total length proterties of described Epinephelus coioide to be measured.Thereby, it is possible to effectively improve the efficiency detecting Epinephelus coioide total length proterties.
According to embodiments of the invention, the method extracting the genomic dna of Epinephelus coioide to be measured is not particularly limited, and any known genome DNA extracting method or test kit can be adopted to carry out.According to concrete examples more of the present invention, adopt the genomic dna of conventional phenol chloroform method extracting Epinephelus coioide to be measured.Thereby, it is possible to effectively obtain the genomic dna that quality is good, purity is high, be convenient to subsequent step and carry out.
According to embodiments of the invention, the condition that the genomic dna of described Epinephelus coioide to be measured carries out pcr amplification is not particularly limited.According to concrete examples more of the present invention, the amplification system of this pcr amplification is counted with 25 μ l: the template DNA 1 μ l of 50-100ng/ μ l, the each 1 μ l of upstream and downstream primer shown in SEQIDNO:2-3 of 10pmol/ μ l, the dNTPmix2.0 μ l of 10mmol/L, the Taq DNA polymerase 0.125 μ l of 5U/ μ l, 10 × PCR reaction buffer 2.5 μ l, surplus is distilled water; The reaction conditions of this pcr amplification is: 94 DEG C 5 minutes; 94 DEG C 30 seconds, 53 DEG C 30 seconds, 72 DEG C 30 seconds, 30 circulations; 72 DEG C 5 minutes.The fragment at SNP marker place of the present invention thereby, it is possible to increase fast, efficiently and accurately, obtains target amplification product, is convenient to the carrying out of subsequent step.
According to embodiments of the invention, the method that described pcr amplification product checks order is not particularly limited, as long as the sequence of the fragment at pcr amplification product and SNP marker place effectively can be obtained.According to concrete examples more of the present invention, can adopt be selected from HISEQ2000, SOLiD, 454 and at least one of single-molecule sequencing method described pcr amplification product is checked order.Thereby, it is possible to high-throughput, obtain sequencing result fast, efficiently and accurately.
According to embodiments of the invention, based on sequencing result, by comparison cabrilla with reference to genome sequence, effectively can determine that the genotype of the described SNP marker of Epinephelus coioide to be measured is TT, CC or TC.
According to embodiments of the invention, the total length of the TT genotype individuals of described SNP marker is significantly higher than CC and TC genotype individuals.Namely the total length proterties of the foregoing SNP marker of the present invention and Epinephelus coioide is closely related.Thus, based on the genotype of this SNP marker of the Epinephelus coioide to be measured determined, total length proterties and the growth and development traits of Epinephelus coioide to be measured can be determined accurately and effectively, such as, when the genotype of this SNP site is TT, then the individuality belonging to fast growth of Epinephelus coioide to be measured.And then method of the present invention can be effective to the molecular mark of Epinephelus coioide, thus can assist and realize short period of time, low cost, high accuracy ground seed selection Epinephelus coioide improved seeds in early days.
It should be noted that, the SNP marker relevant to Epinephelus coioide total length of the present invention and apply tool and have the following advantages:
(1) SNP marker provided by the invention is not by the restriction such as age, sex of Epinephelus coioide, can be used for the early stage seed selection of Epinephelus coioide, significantly can promote the breeding process of Epinephelus coioide;
(2) detect Epinephelus coioide as shown in SEQIDNO.1 from 5 ' end the method for the 251st SNP site, accurately and reliably, easy to operate;
(3) Epinephelus coioide as shown in SEQIDNO.1 from 5 ' end the detecting, for the marker assisted selection of Epinephelus coioide growth traits provides scientific basis of SNP site of the 251st.
Additional aspect of the present invention and advantage will part provide in the following description, and part will become obvious from the following description, or be recognized by practice of the present invention.
Accompanying drawing explanation
Above-mentioned and/or additional aspect of the present invention and advantage will become obvious and easy understand from accompanying drawing below combining to the description of embodiment, wherein:
Fig. 1 shows according to one embodiment of the invention, the genotypic order-checking peak figure of SNP marker site CC of the present invention, TC and TT tri-kinds.
Embodiment
Embodiments of the invention are described below in detail.Being exemplary below by the embodiment be described with reference to the drawings, only for explaining the present invention, and can not limitation of the present invention being interpreted as.
The acquisition of the SNP marker that embodiment 1 is relevant to Epinephelus coioide total length
The acquisition of 1.1 Epinephelus coioide colonies
The colony adopted is the Epinephelus coioide of Grouper cultivating field, Hainan hatching on November 10th, 2010, on December 10th, 2010, and 15,000 tail fry is transferred to a net cage and continues to raise.On August 8th, 2011, select 199 individualities at random from this net cage, clip fish body dorsal rags in 95% ethanol-20 DEG C preservation, for extracting genome DNA.
1.2 Epinephelus coioide extracting genome DNA
This test adopts the genomic dna in conventional phenol chloroform method extracting Epinephelus coioide fin ray, and concrete steps are as follows:
(1) get 0.3 ~ 0.5g fin ray in 1.5mlEppendorf pipe, shred, Bechtop is uncapped dry 20min;
(2) after ethanol volatilizees substantially, TE damping fluid (10mmol/mlTris, 1mmol/mlEDTA, SDS5%, pH=8.0) wash 1 ~ 2 time, add 600 μ lDNA extract (0.001mol/LTris-Cl, 0.1mol/LEDTA, SDS5% again, pH=8.0) and 3 μ l proteolytic enzyme k(200mg/ml), 55 DEG C of water-baths digestion about 3h, front 30min every 10min jog centrifuge tube 1 time, digests to liquid in pipe and clarifies;
(3) add autogamy phenol chloroformic solution (phenol: chloroform: primary isoamyl alcohol=25:24:1) 600 μ l, put upside down centrifuge tube 10min back and forth gently, the centrifugal 10min of 12000r.Get the extracting again of the above-mentioned phenol chloroform of upper strata aqueous phase equal-volume, until there is no white precipitate between aqueous phase and organic phase;
(4) use chloroform 1 time again, take out supernatant liquor, add 2 times of volumes precooling dehydrated alcohol precipitation DNA, put upside down mixing, 4 DEG C of centrifugal 10min of standing 30min, 12000r, precipitation use 70% washing with alcohol again, centrifugal dry precipitation after add 50 μ l sterilized waters dissolve.4 DEG C save backup or-20 DEG C of preservations for a long time.
1.3 adopt genomes sequence of resurveying to obtain the relevant SNP marker of Epinephelus coioide total length
Based on Hiseq2000 high-flux sequence platform, the data volume of above-mentioned 199 individualities are resurveyed sequence, generation about 0.5G, the average Epinephelus coioide genome covering 0.5X.Also the growth traits phenotypic evaluation such as total length are carried out to these 199 individualities simultaneously.Adopt PLINK software, carry out GWAS analysis based on MixedLiner model, from 7.5 ten thousand SNP, have found a SNP site relevant to total length.This SNP site is positioned at the 251bp site of sequence shown in SEQIDNO:1, represent this site, place, and the base in site is T or C in SEQIDNO:1 sequence with Y herein.This site genotype is isozygoty that to be significantly higher than genotype be herein the Epinephelus coioide of CC or heterozygosis TC of isozygotying for the total length of Epinephelus coioide of TT.
The sequence verification of the SNP marker that embodiment 2 is relevant to Epinephelus coioide total length and application
2.1 extract the genomic dna in Epinephelus coioide fin ray to be measured
Epinephelus coioide to be measured is from the Epinephelus coioide colony in embodiment 1, and random selecting 70 tail fish, according to the DNA extraction method extracting genomic dna described in embodiment 1.
2.2 amplifications are containing the nucleotide fragments of SNP site
The genomic dna of the Epinephelus coioide each to be measured obtained with aforementioned extraction is for template, utilize forward primer F:5 '-AGGTCCTTCACAAAGCCGTCAC-3 ' (SEQIDNO:2) and reverse primer R:5 '-CGTCGCAGCATCGCCTCAAA-3 ' (SEQIDNO:3), amplify the nucleotide fragments at SNP place to be measured.Wherein, PCR reaction system is counted with 25 μ l: 50-100ng/ μ l template DNA 1 μ l, 10pmol/ μ l primers F and each 1 μ l of R, 10mmol/LdNTPmix2.0 μ l, 5U/ μ lTaqDNA polysaccharase 0.125 μ l, 10 × PCR reaction buffer 2.5 μ l, surplus is distilled water; PCR reaction conditions is: 94 DEG C 5 minutes; 94 DEG C 30 seconds, 53 DEG C 30 seconds, 72 DEG C 30 seconds, 30 circulations; 72 DEG C 5 minutes.
2.3 order-checkings identify SNP site genotype
The each pcr amplification product obtained in above-mentioned steps is carried out unidirectional order-checking on ABI3730 sequenator, identifies the genotype at 251bp place (i.e. SNP marker of the present invention) in SEQIDNO:1 sequence.Wherein, the genotypic order-checking peak figure of CC, TC and TT tri-kinds as shown in Figure 1.Genotype and the total length thereof of 70 Epinephelus coioide to be measured these SNP site individual are as shown in table 1 below.
The genotype of 70 these SNP site of individuality and total length thereof
| Individual numbering | Genotype | Total length (cm) | Individual numbering | Genotype | Total length (cm) |
| s127 | CC | 12.2 | s183 | CC | 19.6 |
| s67 | CC | 12.4 | s38 | CC | 19.6 |
| s75 | CC | 12.5 | s112 | CC | 19.7 |
| s22 | CC | 13.2 | s164 | CC | 19.9 |
| s115 | CC | 13.4 | s88 | CC | 19.9 |
| s131 | CC | 13.4 | s150 | TC | 16.6 |
| s4 | CC | 13.6 | s194 | TC | 16.7 |
| s155 | CC | 13.7 | s1 | TC | 17.0 |
| s39 | CC | 13.9 | s111 | TC | 19.0 |
| s162 | CC | 14.0 | s35 | TC | 19.0 |
| s64 | CC | 14.0 | s2 | TC | 19.1 |
| s121 | CC | 14.1 | s8 | TC | 13.4 |
| s156 | CC | 14.3 | s176 | TC | 14.0 |
| s50 | CC | 14.5 | s143 | TC | 14.1 |
| s173 | CC | 14.6 | s140 | TC | 15.4 |
| s68 | CC | 14.6 | s66 | TC | 14.4 |
| s46 | CC | 14.6 | s65 | TC | 14.5 |
| s62 | CC | 14.6 | s142 | TC | 16.2 |
| s28 | CC | 14.9 | s105 | CT | 16.3 |
| s9 | CC | 14.9 | s116 | TC | 16.5 |
| s119 | CC | 14.9 | s99 | TC | 19.8 |
| s144 | CC | 14.9 | s89 | TC | 20.0 |
| s141 | CC | 15.0 | s168 | TC | 20.5 |
| s14 | CC | 15.2 | s174 | TC | 21.0 |
| s175 | CC | 15.4 | s26 | TC | 21.0 |
| s56 | CC | 15.4 | s118 | TC | 21.5 |
| s37 | CC | 15.5 | s82 | TC | 21.1 |
| s90 | CC | 16.5 | s163 | TT | 26.3 |
| s98 | CC | 16.5 | s190 | TT | 17.5 |
| s25 | CC | 16.6 | s125 | TT | 17.9 |
| s77 | CC | 16.6 | s73 | TT | 18.0 |
| s123 | CC | 16.6 | s7 | TT | 18.8 |
| s94 | CC | 19.4 | s41 | TT | 18.9 |
| s78 | CC | 19.4 | s97 | TT | 20.2 |
| s44 | CC | 19.6 | s83 | TT | 23.0 |
The association analysis of 2.4SNP loci gene type and total length
Based on the result of table 1, utilize SAS9.0 software Mixed program to carry out linear analogue and analyze the genotype of SNP site and the cognation of total length proterties, represent phenotypic number with individual total length when wherein analyzing, the model of employing is as follows:
Y
ijk=μ+G
i+a
j+e
ijk。
Wherein, Y
ijkfor individual total length value, μ colony total length average, G
ifor genotype effects vector, a
jfor minor-polygene vector, e
ijkfor random residual effect vector.
The genotype of SNP site and the association analysis of total length proterties the results are shown in following table 2.
The table genotype frequency in 2SNP site and the association analysis with total length
As shown in Table 2, the homozygous individual total length average of TT is maximum, and the individual total length average of TC heterozygous is taken second place, and the homozygous individual total length average of CC is minimum.
Association analysis result shown in table 2 shows, the difference of TT genotype individuals total length average and TC genotype individuals total length average reaches significance level (P<0.05), the average of TC genotype individuals total length and the difference of CC genotype individuals reach significance level (P<0.05), and the difference of TT genotype individuals total length average and CC genotype individuals total length average reaches pole significance level (P<0.01).And then, prove the 251st bit base T or C from 5 ' end of nucleotide sequence shown in SEQIDNO:1, with Epinephelus coioide total length proterties significant correlation, be the SNP marker that Epinephelus coioide total length proterties is relevant, the total length of the TT genotype individuals of this SNP marker is significantly higher than CC and TC genotype individuals.
In the description of this specification sheets, specific features, structure, material or feature that the description of reference term " embodiment ", " some embodiments ", " example ", " concrete example " or " some examples " etc. means to describe in conjunction with this embodiment or example are contained at least one embodiment of the present invention or example.In this manual, identical embodiment or example are not necessarily referred to the schematic representation of above-mentioned term.And the specific features of description, structure, material or feature can combine in an appropriate manner in any one or more embodiment or example.
Although illustrate and describe embodiments of the invention, those having ordinary skill in the art will appreciate that: can carry out multiple change, amendment, replacement and modification to these embodiments when not departing from principle of the present invention and aim, scope of the present invention is by claim and equivalents thereof.
Claims (8)
1. the SNP marker that Epinephelus coioide total length proterties is relevant, is characterized in that, the sequence of described SNP marker is as shown in SEQIDNO:1, and the 251st bit base from 5 ' end of sequence shown in described SEQIDNO:1 is T or C.
2. SNP marker according to claim 1, is characterized in that, the total length of the TT genotype individuals of described SNP marker is significantly higher than CC and TC genotype individuals.
3. require a primer pair for the SNP marker described in 1 or 2 for test right, it is characterized in that, the nucleotide sequence of described primer pair is as shown in SEQIDNO:2-3.
4. require a test kit for the SNP marker described in 1 or 2 for test right, it is characterized in that, comprise:
Primer pair according to claim 3.
5. the SNP marker described in claim 1 or 2, primer pair according to claim 3 or the purposes of test kit according to claim 4 in Epinephelus coioide seed selection.
6. detect a method for Epinephelus coioide total length proterties, it is characterized in that, surveying by treating the detection that Epinephelus coioide carries out the SNP marker described in claim 1 or 2, determining the total length proterties of described Epinephelus coioide to be measured.
7. method according to claim 6, is characterized in that, surveying the detection that Epinephelus coioide carries out the SNP marker described in claim 1 or 2, determining the total length proterties of described Epinephelus coioide to be measured, comprising further by treating:
Extract the genomic dna of Epinephelus coioide to be measured;
Utilize the primer pair described in claim 3, the genomic dna of described Epinephelus coioide to be measured is carried out pcr amplification, to obtain pcr amplification product;
Described pcr amplification product is checked order, to obtain sequencing result;
Based on described sequencing result, determine the genotype of the described SNP marker of described Epinephelus coioide to be measured; And
Based on the genotype of the described SNP marker of described Epinephelus coioide to be measured, determine the total length proterties of described Epinephelus coioide to be measured.
8. method according to claim 7, is characterized in that, the total length of the TT genotype individuals of described SNP marker is significantly higher than CC and TC genotype individuals.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310411231.7A CN104419705B (en) | 2013-09-10 | 2013-09-10 | Snp marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310411231.7A CN104419705B (en) | 2013-09-10 | 2013-09-10 | Snp marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104419705A CN104419705A (en) | 2015-03-18 |
| CN104419705B true CN104419705B (en) | 2016-01-27 |
Family
ID=52969829
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310411231.7A Active CN104419705B (en) | 2013-09-10 | 2013-09-10 | Snp marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104419705B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104878004B (en) * | 2015-06-18 | 2018-11-16 | 广东海洋大学 | One kind SNP marker detection associated with haliotis diversicolor Reeve growth traits and its application |
| CN107022608B (en) * | 2017-03-21 | 2020-09-08 | 镇江华大检测有限公司 | SNP marker and application thereof |
| CN107217094B (en) * | 2017-06-14 | 2021-02-09 | 海南华大海洋科技有限公司 | SNP marker related to growth rate of genetically improved farmed tilapia and application thereof |
| CN109852710B (en) * | 2019-04-11 | 2022-06-21 | 深圳华大海洋科技有限公司 | SNP marker related to ammonia tolerance of grouper and application thereof |
| CN117683911B (en) * | 2024-02-02 | 2024-05-14 | 中山大学 | Primer for detecting SNP molecular markers related to protein utilization characteristics of garrupa feed and application of primer |
-
2013
- 2013-09-10 CN CN201310411231.7A patent/CN104419705B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| Single Nucleotide Polymorphisms in the Leptin-a Gene and Associations with Growth Traits in the Orange-Spotted Grouper(Epinephelus coioides);Yun Wei;《International Journal of Molecular Sciences》;20130430;第14卷(第4期);8625-8637 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104419705A (en) | 2015-03-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104419706B (en) | Snp marker and application thereof | |
| CN101942437B (en) | Specific primers for microsatellite markers of EST sequences of Litopenaeus vannamei and application thereof | |
| CN104419705B (en) | Snp marker and application thereof | |
| CN102134593B (en) | Gender-specific microsatellite marker for Cynoglossus semilaevis and application of same in identification of superfemale Cynoglossus semilaevis | |
| CN106086195A (en) | One SNP marker relevant to the cabrilla speed of growth and application thereof | |
| CN101240348B (en) | Rapid identification method for half-smooth tongue-sole genetic sex | |
| CN109852710A (en) | One kind SNP marker relevant to grouper ammonia tolerance and application thereof | |
| CN107217094A (en) | One SNP marker related to the gift tilapia speed of growth and its application | |
| CN107022608B (en) | SNP marker and application thereof | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN105671175A (en) | Detection method for cattle SPAG17 gene insertion/deletion and application thereof | |
| CN108411007B (en) | SNP marker and its application | |
| CN106048028A (en) | Grouper-growth-rate-related SNP (single-nucleotide polymorphism) marker and application thereof | |
| CN103937790B (en) | A kind of molecule marker of being closely related with Semen Brassicae campestris sulphur resources and application | |
| CN105624322A (en) | Method for developing SSR (Simple Sequence Repeat) molecular mark of nibea albiflora for population identification | |
| CN104328119A (en) | Microsatellite molecular marker related to growth character of megalobrama amblycephala and application of molecular marker | |
| CN101845487A (en) | Construction method of Apostichopus japonicus standard microsatellite marker | |
| CN105385767A (en) | Primers and method for identifying different families of eriocheir sinensis | |
| CN105838809B (en) | One kind SNP marker relevant to rubber tree latex dust quantity and its application | |
| CN102321750A (en) | Method for rapidly screening bian chicken weight gain degree by molecular marking | |
| CN105861498A (en) | SNP marker related to rubber yield of rubber tree trunk and application of SNP marker | |
| CN105950729A (en) | SNP (single nucleotide polymorphism) marker related to hevea brasiliensis stem girth and application thereof | |
| CN102816759A (en) | Detection method for single nucleotide polymorphism of STMN1 gene of Beijing duck and molecular markers thereof | |
| CN102586451A (en) | Method for matching and breeding jian carps | |
| CN106048027A (en) | Grouper-growth-rate-related SNP (single-nucleotide polymorphism) marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: 518083 Yantian District, Yantian District, Shenzhen, Guangdong. Co-patentee after: Sun Yat-sen University Patentee after: Shenzhen Huada Academy of life science Co-patentee after: Hainan University Co-patentee after: Shenzhen Huada Ocean Technology Co., Ltd. Address before: 518083 comprehensive building, Beishan Industrial Zone, Yantian District, Shenzhen, Guangdong Co-patentee before: Sun Yat-sen University Patentee before: BGI-Shenzhen Co-patentee before: Hainan University Co-patentee before: SHENZHEN BGI AQUATIC PRODUCT TECHNOLOGY CO., LTD. |
|
| CP03 | Change of name, title or address |