CN105861498A - SNP marker related to rubber yield of rubber tree trunk and application of SNP marker - Google Patents
SNP marker related to rubber yield of rubber tree trunk and application of SNP marker Download PDFInfo
- Publication number
- CN105861498A CN105861498A CN201610335315.0A CN201610335315A CN105861498A CN 105861498 A CN105861498 A CN 105861498A CN 201610335315 A CN201610335315 A CN 201610335315A CN 105861498 A CN105861498 A CN 105861498A
- Authority
- CN
- China
- Prior art keywords
- rubber tree
- snp marker
- measured
- genotype
- incineration method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 244000043261 Hevea brasiliensis Species 0.000 title claims abstract description 123
- 239000003550 marker Substances 0.000 title claims abstract description 60
- 229920001971 elastomer Polymers 0.000 title abstract description 8
- 238000009395 breeding Methods 0.000 claims abstract description 29
- 239000002773 nucleotide Substances 0.000 claims abstract description 10
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 10
- 238000000034 method Methods 0.000 claims description 78
- 238000001514 detection method Methods 0.000 claims description 19
- 238000012408 PCR amplification Methods 0.000 claims description 13
- 238000012360 testing method Methods 0.000 claims description 11
- 239000003292 glue Substances 0.000 claims description 6
- 238000012163 sequencing technique Methods 0.000 claims description 6
- 239000000284 extract Substances 0.000 claims description 4
- 230000001488 breeding effect Effects 0.000 abstract description 18
- 239000003147 molecular marker Substances 0.000 abstract description 8
- 108020004414 DNA Proteins 0.000 description 14
- 239000000047 product Substances 0.000 description 7
- 241000196324 Embryophyta Species 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 5
- 239000012634 fragment Substances 0.000 description 5
- 239000000463 material Substances 0.000 description 5
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 4
- 230000003321 amplification Effects 0.000 description 4
- 238000011161 development Methods 0.000 description 4
- 230000018109 developmental process Effects 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- PHTQWCKDNZKARW-UHFFFAOYSA-N isopentyl alcohol Natural products CC(C)CCO PHTQWCKDNZKARW-UHFFFAOYSA-N 0.000 description 3
- 238000002372 labelling Methods 0.000 description 3
- 239000012071 phase Substances 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 239000008346 aqueous phase Substances 0.000 description 2
- 239000000872 buffer Substances 0.000 description 2
- 230000004087 circulation Effects 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 230000004907 flux Effects 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 229920003052 natural elastomer Polymers 0.000 description 2
- 229920001194 natural rubber Polymers 0.000 description 2
- 229910052757 nitrogen Inorganic materials 0.000 description 2
- 238000003752 polymerase chain reaction Methods 0.000 description 2
- 230000008569 process Effects 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 239000011535 reaction buffer Substances 0.000 description 2
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 description 2
- 241000894007 species Species 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 229920002684 Sepharose Polymers 0.000 description 1
- 241000218636 Thuja Species 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 238000012098 association analyses Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- VOAXAOULFRTTAM-UHFFFAOYSA-N chloroform phenol Chemical compound C1(=CC=CC=C1)O.C(Cl)(Cl)Cl.C1(=CC=CC=C1)O.C1(=CC=CC=C1)O VOAXAOULFRTTAM-UHFFFAOYSA-N 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 238000009402 cross-breeding Methods 0.000 description 1
- 238000005138 cryopreservation Methods 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 230000008034 disappearance Effects 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 239000011536 extraction buffer Substances 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- 230000006872 improvement Effects 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000005259 measurement Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000004899 motility Effects 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 230000001681 protective effect Effects 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- DGVVWUTYPXICAM-UHFFFAOYSA-N β‐Mercaptoethanol Chemical compound OCCS DGVVWUTYPXICAM-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP marker related to rubber yield of rubber tree trunks and application of the SNP marker. The SNP marker is that the basic group at the 120bpth site from the 5'-end of the nucleotide sequence as shown in SEQIDNO:1 is C or A. The SNP marker is closely related to the rubber yield of the rubber tree trunks, and can be effectively applicable to molecular marker assistant breeding of rubber trees.
Description
Technical field
The present invention relates to a kind of SNP marker and application thereof, particularly relate to a kind of relevant to rubber tree dry incineration method
SNP marker and application.
Background technology
Rubber tree is a kind of tropical tree species played an important role in World Economics and military developments, and it produces
Natural rubber tree is a kind of important raw material of industry and strategic materials.At present, the area of China's suitable planting rubber
Limited, actual cultivated area has reached the limit, does not the most expand cultivated area to increase the space of yield, significantly
Degree improves rubber tree yield per unit area and is an applicable Chinese rubber career development and alleviates natural rubber supply and demand
The feasible way of contradiction pressure.
Rubber tree cross-breeding is always the conventional method of Yield Breeding, but the conventional breeding cycle is long, and plants
The scarcity of matter resource, all restriction rubber tree prevalent variety cultivation and industry development.Along with sending out of Modern Molecular Biotechnology
Exhibition, molecular marker assisted selection breeding can solve the problems referred to above to a certain extent, promotes Rubber Tree Breeding process.
Molecular marker assisted selection breeding, i.e. molecular breeding, be traditional genetic breeding and the organic knot of modern molecular biology
The breeding method closed, utilizes DNA molecular marker to select breeding material, comprehensive improvement selection-breeding species
Important economical trait.In recent years, rubber tree molecular markers development and utilize work achieved with certain progress, but
Far from the demand meeting rubber tree molecular breeding.
Present stage need to excavate the molecular marker that effective rubber tree dry incineration method character is relevant, to realize in early days
Yield seed selection and raising Yield Breeding accuracy, thus obtain bigger Yield Breeding and genetic progress.
Summary of the invention
The invention reside in and overcome deficiency of the prior art, it is provided that be a kind of relevant to rubber tree dry incineration method, energy
Enough it is effective to SNP marker and the application thereof etc. of rubber tree selection-breeding.
Wherein, SNP (singlenucleotidepolymorphism, SNP, i.e. single nucleotide polymorphism) is
The class proposed by the human genome research center scholar Lander of Massachusetts Institute Technology for 1996 is divided
Sub-genetic marker, is primarily referred to as in genomic level the DNA sequence caused by the variation by single core thuja acid many
State property.The polymorphism that SNP shows relates only to the variation of single base, performance be have conversion, transversion,
Insertion and disappearance etc..
The first aspect of the invention is to provide a kind of SNP marker relevant to rubber tree dry incineration method, and it is special
Levying and be, the sequence of described SNP marker is as shown in SEQIDNO:1, shown in described SEQIDNO:1
Sequence base of 120bp site from 5 ' ends is C or A.According to the present invention, SEQIDNO:1 institute
Show that nucleotide sequence is as follows:
AGTTATCATAATGGAGGATCTTGGCCAGGTTTGTCCATTTTCTCTCTCT
ATTTAAACTGAATATCTCTCTATTAATATGATGTTCATGCCGTTAGGATAGCA
TTCCTGTCATGTTTCACXAGAGGTCTTAGAACATTATTTGGTGTTATTTTGT
TGAATAGAGGCTATTGATGAATTATACATAAAATTTATTGTATTCAGCCTAGT
TATACCCTAGACA (SEQIDNO:1).
Inventor finds, the dry incineration method of the rubber tree that site genotype is heterozygosis CA of this SNP marker
Being significantly higher than genotype herein is isozygoty CC and the rubber tree of the AA that isozygotys.And then, according to the present invention, pass through
The above-mentioned SNP of detection rubber tree, it is possible to effectively determine its dry incineration method character, specifically, as it was previously stated,
This SNP site genotype be the dry incineration method of the rubber tree of heterozygosis CA be significantly higher than herein genotype for isozygotying
CC and the rubber tree of the AA that isozygotys, such as when the genotype of this SNP site is heterozygosis CA, then can determine
Rubber tree to be measured belong to the individuality that dry incineration method is high.Thus, inventor determines, the SNP marker of the present invention
It is closely related with the dry incineration method character of rubber tree, it is possible to be effective to the molecular mark of rubber tree.
And then according to actual breeding demand, Rubber Tree Breeding material can be carried out Seedling selection, it is further able to effectively carry
The efficiency of high breeding and accuracy, improve the genetic level of rubber tree reproductive population such that it is able to accurately, efficiently
Select rubber tree improved seeds.Additionally, utilize the SNP marker of the present invention to carry out rubber tree molecular marker
Assistant breeding, has early screening, the advantage that time-consuming, with low cost, accuracy is high.
The second aspect of the invention is to provide a kind of for detecting the SNP mark described in first aspect of the present invention
The primer pair of note, described primer is to having the nucleotides sequence shown in SEQIDNO:2 and SEQIDNO:3
Row.Specifically, the sequence of described primer pair is as follows:
Forward primer: AGTTATCATAATGGAGGATCTTGGCC (SEQIDNO:2)；
Downstream primer: TGTCTAGGGTATAACTAGGCTGAATACAAT (SEQIDNO:3).
According to the present invention, utilize the primer of the present invention to can effectively the above-mentioned of rubber tree to be measured be produced with dry glue
The fragment at the SNP marker place that amount character is relevant carries out PCR amplification, and then can be the most real by order-checking
The now detection to this SNP marker, determines the genotype in this SNP marker site of rubber tree to be measured, and then can
Effectively determine the dry incineration method character of rubber tree to be measured.Specifically, this SNP marker site genotype is miscellaneous
It is isozygoty CC and the rubber tree of the AA that isozygotys that the dry incineration method of the rubber tree closing CA is significantly higher than genotype herein,
Such as when the genotype of this SNP site is heterozygosis CA, then can determine that the dry glue that belongs to of rubber tree to be measured is produced
Measure high individuality.Thus, with the primer pair of the SNP marker detecting the foregoing present invention, it is possible to effectively
For the molecular mark of rubber tree, and then early stage can be assisted to realize short time, low cost, Gao Zhun
Really property ground selection-breeding rubber tree improved seeds.
The third aspect of the invention is to provide a kind of for detecting the SNP mark described in first aspect of the present invention
The test kit of note, it comprises the primer pair described in second aspect of the present invention.I.e. the test kit of the present invention comprises
There is the primer pair of the nucleotide sequence shown in SEQIDNO:2 and SEQIDNO:3.According to the present invention,
Utilize the primer pair included in the test kit of the present invention, it is possible to effectively realize first side to rubber tree to be measured
The polymorphic detection of the SNP marker relevant to dry incineration method character described in face, determines that rubber tree to be measured should
The genotype in SNP marker site, and then can effectively determine the dry incineration method character of rubber tree to be measured.Specifically
Ground, this SNP marker site genotype is that the dry incineration method of the rubber tree of heterozygosis CA is significantly higher than base herein
Because type is isozygoty CC and the rubber tree of the AA that isozygotys, such as when the genotype of this SNP site is heterozygosis CA,
Then can determine rubber tree to be measured belongs to the individuality that dry incineration method is high.Thus, the present invention be used for detect this
The test kit of the SNP marker described in bright first aspect, it is possible to be effective to the molecular marker auxiliary of rubber tree
Breeding, and then early stage can be assisted to realize short time, low cost, high accuracy ground selection-breeding rubber tree improved seeds.
The fourth aspect of the invention is to provide the SNP marker as described in terms of the present invention is first, the present invention
Primer described in second aspect to or third aspect of the present invention described in test kit in rubber tree selection-breeding
Purposes.
As it was previously stated, by can be used in detecting the SNP relevant to rubber tree dry incineration method character of the present invention
The reagent of labelling, the such as primer described in second aspect of the present invention to or comprise the test kit etc. of this primer pair,
Can effectively detect the genotype of the above-mentioned SNP marker determining rubber tree to be measured, and then based on the base obtained
Because type can effectively determine the dry incineration method character of rubber tree to be measured such that it is able to effectively auxiliary rubber tree selection-breeding.
And then, the fifth aspect of the invention is to provide a kind of method detecting rubber tree dry incineration method character, logical
Cross the detection that rubber tree to be measured is carried out the SNP marker described in first aspect present invention, determine described rubber to be measured
The dry incineration method character of gum.
Specifically, can be by can be used in the relevant to rubber tree dry incineration method character of the detection present invention
The reagent of SNP marker, the such as primer described in second aspect of the present invention to or comprise the reagent of this primer pair
Boxes etc., carry out PCR amplification, order-checking to rubber tree to be measured, in order to detection determines the above-mentioned SNP of rubber tree to be measured
The genotype of labelling, and then the dry incineration method of rubber tree to be measured can be effectively determined based on the genotype obtained
Shape.Wherein, as it was previously stated, the dry glue of the rubber tree that this SNP marker site genotype is heterozygosis CA is produced
It is isozygoty CC and the rubber tree of the AA that isozygotys that amount is significantly higher than genotype herein, such as when this SNP site
When genotype is heterozygosis CA, rubber tree the most to be measured belong to the individuality that dry incineration method is high.Thus, the present invention
The method of detection rubber tree dry incineration method character, it is possible to detect rubber tree dry incineration method quickly, efficiently and accurately
Character, and then the molecular mark of rubber tree can be effective to such that it is able to auxiliary realizes short in early days
Time, low cost, high accuracy ground selection-breeding rubber tree improved seeds.
Wherein, the method that rubber tree to be measured carries out SNP marker detection is not particularly limited.Order-checking, strand
Conformational polymerphism polymerase chain reaction PCR singlestrandconformationpolymorphism,
PCR-SSCP), restriction fragment length polymorphism polymerase chain reaction
(PCR-restriTCionfragmentlength polymorphism, PCR-RFLP) and flight time matter
The technology such as spectrum all can realize the detection of SNP.Wherein, order-checking is that a kind of accuracy is the highest, motility strong,
The detection technique that flux is big, the detection cycle is short.Pair of primers, amplification only need to be designed in the both sides of SNP site
The product of 200-1000bp, then the genotype of SNP site can be directly detected by order-checking.Thus, this
Invention uses the method for order-checking to carry out SNP marker detection.According to the present invention, by rubber tree to be measured is carried out
The detection of foregoing SNP marker, determines the dry incineration method character of described rubber tree to be measured, wraps further
Include: extract the genomic DNA of rubber tree to be measured；Utilize the primer pair described in second aspect of the present invention, will
The genomic DNA of described rubber tree to be measured carries out PCR amplification, in order to obtain pcr amplification product；To institute
State pcr amplification product to check order, in order to obtain sequencing result；Based on described sequencing result, determine described
The genotype of the described SNP marker of rubber tree to be measured；And described SNP of based on described rubber tree to be measured
The genotype of labelling, determines the dry incineration method character of described rubber tree to be measured.Thereby, it is possible to be effectively improved detection
The efficiency of rubber tree dry incineration method character.
In the present invention, the method for the genomic DNA extracting rubber tree to be measured is not particularly limited, and can use
Any of genome DNA extracting method or test kit are carried out.According to some concrete examples of the present invention,
CTAB method is used to extract the genomic DNA of rubber tree to be measured.Thereby, it is possible to it is good, pure effectively to obtain quality
Spend high genomic DNA, it is simple to subsequent step is carried out.
In the present invention, the genomic DNA of described rubber tree to be measured is carried out the condition of PCR amplification not by spy
Do not limit.According to some concrete examples of the present invention, the amplification system of this PCR amplification is calculated as with 25 μ l:
100-200ng/ μ l masterplate DNA 1 μ l, shown in SEQIDNO:2 and SEQIDNO:3 of 10 μMs
Forward primer and each 1 μ l of reverse primer, 10 × PCR reaction buffer 2.5 μ l, 2.5mM dNTP 2.0 μ l,
The TapDNA polymerase 0.2 μ l of 5U/ μ l, water surplus.This PCR reaction condition is: 95 DEG C of denaturations 5min
After, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min totally 30 circulations, 72 DEG C extend 5min.Thus,
The fragment at the SNP marker place of the present invention can be expanded quickly, efficiently and accurately, it is thus achieved that target amplification is produced
Thing, it is simple to the carrying out of subsequent step.
In the present invention, the method checking order described pcr amplification product is not particularly limited, as long as can
Effectively obtain the pcr amplification product i.e. sequence of the fragment at SNP marker place.According to the present invention one
A little concrete examples, can use selected from sequence measurements such as HISEQ2000, SOLiD, 454 and unimolecules
Described pcr amplification product is checked order by least one.Thereby, it is possible to it is high flux, quick, efficient, accurate
Really obtain sequencing result.
The present invention is based on sequencing result, by comparison rubber tree with reference to genome sequence, it is possible to effectively determine to be measured
The genotype of the described SNP marker of rubber tree is CA, CC or AA.
In the present invention, the dry incineration method of the CA genotype individuals of described SNP marker is significantly higher than CC and AA
Genotype individuals.The i.e. foregoing SNP marker of the present invention is closely related with the dry incineration method character of rubber tree.
Thus, based on a determination that the genotype of this SNP marker of rubber tree to be measured, it is possible to determine accurately and effectively and treat
Survey the dry incineration method character of rubber tree, such as when the genotype of this SNP site is CA, rubber tree the most to be measured
Belong to the individuality that dry incineration method is high.And then the method for the present invention can be effective to the molecular marker of rubber tree auxiliary
Help breeding such that it is able to auxiliary realizes short time, low cost, the high accuracy ground excellent product of selection-breeding rubber tree in early days
Kind.
Beneficial effects of the present invention:
(1) SNP marker that the present invention provides is not limited by the age etc. of rubber tree, can be used for the morning of rubber tree
Phase selection-breeding, can remarkably promote the breeding process of rubber tree；
(2) detection rubber tree as shown in SEQIDNO.1 from 5 ' ends the side of SNP site of 120bp
Method, accurately and reliably, easy to operate；
(3) rubber tree detection of the SNP site of 120bp from 5 ' ends as shown in SEQIDNO.1,
Marker assisted selection for rubber tree dry incineration method character provides scientific basis.
Summary of the invention
Below in conjunction with specific embodiment, the present invention is further illustrated, to be more fully understood that the present invention.
Embodiment 1: the acquisition of the SNP marker relevant to rubber tree dry incineration method
1.1 rubber tree germplasm materials obtain
The colony used is rubber tree 1981'IRRDB kind matter, plants in Chinese Academy of Tropical Agricultural Sciences's rubber
Institute country rubber tree Germplasm Resources, its genetic background is mainly derived from Brazil's Amazon river region Acker
In state (Acre), Mato Grosso state (Mato Grosso) and Lang Duoniya stateThree
State.In June, 2014, gathering 34 parts of kind matter young leaflet tablet liquid nitrogen cryopreservations, to take back laboratory standby.
1.2 rubber tree germplasm materials DNA extraction
Take the rubber tree blade of freezen protective, use CTAB method to extract genomic DNA: (1) weighs 1g
Rubber tree tender leaf, grinds to form fine powder after liquid nitrogen flash freezer, transfer in 50ml centrifuge tube.(2) 10ml is added
2 × extract with CTAB buffer the beta-mercaptoethanol of 2% (the most in advance add) of 65 DEG C of preheatings, rotate gently from
Heart pipe makes plant tissue be uniformly dispersed in extraction buffer, 65 DEG C of incubation 1h, and rotates centrifugal the most gently
Pipe.(3) mixture is cooled to room temperature and adds isopyknic Tris-phenol chloroform isoamyl alcohol (25 24 1),
Then overturning centrifuge tube makes it mix, it is to note that do not vibrate, and prevents from interrupting DNA.(4) room temperature, 12000
Rpm is centrifuged 10min and makes its split-phase.(5) draw aqueous phase in another centrifuge tube, add the isopyknic chloroform of people:
Isoamyl alcohol (24 1), reverse mixing.Room temperature, 12000rpm is centrifuged 10min.(6) aqueous phase is drawn extremely
In another centrifuge tube, adding isopyknic isopropanol, reverse mixing, room temperature places 20min.(7) room temperature,
14000rpm is centrifuged 20min.Abandon supernatant, 75% ethanol rinse of precipitation use 1ml ice pre-cooling 2 times.(every
During secondary rinsing, room temperature, 14000rpm is centrifuged 10min).(8) abandon supernatant, superclean bench dries
DNA precipitates.It is then dissolved in 200 μ l TE (pH 8.0) buffer or ddH2O.Add people 1 μ l Rnase
A (10mg/m1), 37 DEG C of water-bath 30min ,-20 DEG C save backup.
1.3 use the order-checking of Sanger method to obtain the SNP marker that rubber tree dry incineration method is relevant
Based on Sanger method order-checking platform, 9 samples in above-mentioned colony are carried out yield related gene order-checking,
Analyze its nucleotide polymorphic site, use Tassel 3.0_standalone software analysis SNP site with
Know the dependency of economical character, find a SNP site relevant to rubber tree dry incineration method.This position, site
In the 120bp site of sequence shown in SEQ ID NO:1, in SEQ ID NO:1 sequence, use X
Represent site at this, and the base in site herein is C or A.This site genotype is the rubber of heterozygosis CA
It is isozygoty CC or the rubber tree of the AA that isozygotys that the dry incineration method of tree is significantly higher than genotype herein.
Embodiment 2: the sequence verification of the SNP marker relevant to rubber tree dry incineration method and application
2.1 amplifications nucleotide fragments containing SNP site
With the aforementioned genomic DNA of rubber tree each to be measured obtained that extracts as masterplate, utilize forward primer F:5 '-
AGT TAT CAT AAT GGA GGA TCT TGG CC-3 ' (SEQ ID NO:2) and reverse primer R:
5 '-TGT CTA GGG TAT AAC TAG GCT GAA TAC AAT-3 ' (SEQ ID NO:3), expand
Increase the nucleotide fragments SNP place to be measured.Wherein, PCR reaction system is 25 μ l:100-200ng/ μ l
The each 1 μ l of masterplate DNA 1 μ l, 10 μMs of primers F and R, 10 × PCR reaction buffer 2.5 μ l, 2.5mM
The Tap archaeal dna polymerase 0.2 μ l of dNTP 2.0 μ l, 5U/ μ l, water surplus；PCR reaction condition is: 95 DEG C
After denaturation 5min, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min totally 30 circulations, 72 DEG C of extensions
5min。
2.2 order-checkings identify SNP site genotype
By the PCR primer obtained in above-mentioned steps through sepharose electrophoresis detection, reclaim and be inserted into pMD
In 18-T carrier, each sample selects 6 monoclonals to carry out check order (raw work biological engineering Shanghai company limited),
The genotype of (i.e. the SNP marker of the present invention) at 120bp in identification SEQ ID NO:1 sequence.34
Genotype and the dry incineration method thereof of rubber tree to be measured this SNP site individual are as shown in table 1 below.
The genotype of 1 34 rubber trees to be measured of table this SNP site individual and dry incineration method thereof
| Plant matter numbering | Genotype | Dry incineration method (g) | Plant matter numbering | Genotype | Dry incineration method (g) |
| XJA00276 | CC | 14.7 | XJA03765 | CA | 63.8 |
| XJA00323 | CC | 12.2 | XJA03788 | CC | 40.3 |
| XJA00445 | CC | 14.3 | XJA04002 | CC | 18.8 |
| XJA01197 | CC | 29.8 | XJA04075 | CC | 30.1 |
| XJA01198 | CC | 23.0 | XJA04210 | CC | 16.0 |
| XJA01663 | CC | 11.0 | XJA04314 | CC | 20.9 |
| XJA01840 | CC | 31.9 | XJA04397 | CC | 22.6 |
| XJA02534 | CC | 26.6 | XJA04634 | CC | 44.3 |
| XJA02682 | CC | 32.5 | XJA04971 | CC | 15.8 |
| XJA02702 | CC | 15.9 | XJA04975 | AA | 11.7 |
| XJA02967 | CC | 20.0 | XJA05006 | CA | 55.6 |
| XJA02968 | CC | 15.9 | XJA05190 | CC | 10.4 |
| XJA02974 | CC | 26.2 | XJA05255 | CC | 28.4 |
| XJA03000 | CC | 30.7 | XJA05381 | CC | 26.7 |
| XJA03015 | CC | 37.1 | XJA05539 | CC | 12.4 |
| XJA03019 | CC | 32.3 | XJA05728 | CC | 24.4 |
| XJA03642 | CC | 30.5 | XJA05787 | CC | 44.8 |
2.3SNP loci gene type and the association analysis of dry incineration method
Result based on table 1, utilizes the general linear model analysis of Tassel 3.0_standalone software
The genotype of SNP site and the relatedness of dry incineration method, find genotype and the dry incineration method of this SNP site
Dependency reached pole significant level (R2=0.455377, p=0.000045).DPS software is used to divide
Difference relation such as table 2 between analysis SNP site genotypic frequency and dry incineration method, wherein CA heterozygous
Body dry incineration method average is the highest, and the homozygous individual dry incineration method average of CC is taken second place, the homozygous dry incineration method of AA
Average is minimum, and the difference of CA genotype individuals dry incineration method average and CC genotype individuals dry incineration method average
The different pole significant level (P < 0.01) that reaches, CA genotype individuals dry incineration method average is done with AA genotype individuals
The difference of glue yield average reaches pole significant level (P < 0.01).And then, it was demonstrated that core shown in SEQ ID NO:1
Nucleotide sequence is base A of 120bp site or C and the rubber tree notable phase of dry incineration method character from 5 ' ends
Close, for the SNP marker that rubber tree yield traits is relevant, the dry glue of the CA genotype individuals of this SNP marker
Yield is significantly higher than CC and AA genotype individuals.
Difference relation between table 2 SNP site of the present invention genotypic frequency and dry incineration method
Above the specific embodiment of the present invention is described in detail, but it has been intended only as example, the present invention
It is not restricted to particular embodiments described above.To those skilled in the art, any to the present invention
The equivalent modifications carried out and replacement are the most all among scope of the invention.Therefore, in the essence without departing from the present invention
The impartial conversion made under god and scope and amendment, all should contain within the scope of the invention.
Claims (8)
1. a SNP marker relevant to rubber tree dry incineration method, it is characterised in that described SNP marker
Sequence as shown in SEQIDNO:1, sequence shown in described SEQIDNO:1 from 5 ' end 120bp
The base of site is C or A.
SNP marker the most according to claim 1, it is characterised in that the heterozygosis of described SNP marker
The dry incineration method of CA genotype rubber tree is significantly higher than isozygoty CC and AA genotype rubber tree of isozygotying.
3. the primer pair being used for test right requirement SNP marker described in 1 or 2, it is characterised in that
The nucleotide sequence of described primer pair is as shown in SEQIDNO:2 and SEQIDNO:3.
4. the test kit being used for test right requirement SNP marker described in 1 or 2, it is characterised in that
It comprises the primer pair described in claim 3.
5. primer described in SNP marker, claim 3 as claimed in claim 1 or 2 to or right
Require the purposes in rubber tree selection-breeding of the test kit described in 4.
6. the method detecting rubber tree dry incineration method character, it is characterised in that by rubber tree to be measured
Carry out the detection of SNP marker described in claim 1 or 2, determine the dry incineration method of described rubber tree to be measured
Character.
Method the most according to claim 6, it is characterised in that by rubber tree to be measured is carried out right
The detection of requirement SNP marker described in 1 or 2, determines the dry incineration method character of described rubber tree to be measured, enters
One step includes:
Extract the genomic DNA of rubber tree to be measured；
Utilize the primer pair described in claim 3, the genomic DNA of described rubber tree to be measured is carried out PCR
Amplification, in order to obtain pcr amplification product；
Described pcr amplification product is checked order, in order to obtain sequencing result；
Based on described sequencing result, determine the genotype of the described SNP marker of described rubber tree to be measured；And
The genotype of described SNP marker based on described rubber tree to be measured, determines the dry of described rubber tree to be measured
Glue yield traits.
Method the most according to claim 7, it is characterised in that the heterozygosis CA base of described SNP marker
Because the dry incineration method of type rubber tree is higher than CC and the AA genotype rubber tree of isozygotying of isozygotying.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610335315.0A CN105861498B (en) | 2016-05-19 | 2016-05-19 | One kind SNP marker relevant to rubber tree dry incineration method and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610335315.0A CN105861498B (en) | 2016-05-19 | 2016-05-19 | One kind SNP marker relevant to rubber tree dry incineration method and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105861498A true CN105861498A (en) | 2016-08-17 |
| CN105861498B CN105861498B (en) | 2018-12-14 |
Family
ID=56635405
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610335315.0A Expired - Fee Related CN105861498B (en) | 2016-05-19 | 2016-05-19 | One kind SNP marker relevant to rubber tree dry incineration method and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105861498B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109459435A (en) * | 2018-12-27 | 2019-03-12 | 中国热带农业科学院热带生物技术研究所 | The detection method of the screening technique of rubber tree kind, the breeding method of rubber tree and rubber tree yield |
| CN113846177A (en) * | 2021-07-30 | 2021-12-28 | 中国热带农业科学院橡胶研究所 | SNP molecular marker for rubber tree secondary emulsion tube array number and application thereof |
| CN117487950A (en) * | 2022-05-31 | 2024-02-02 | 中国热带农业科学院橡胶研究所 | Construction method of rubber tree variety DNA fingerprint library |
-
2016
- 2016-05-19 CN CN201610335315.0A patent/CN105861498B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| CAMILA ET AL: "De Novo Assembly and Transcriptome Analysis of the Rubber Tree (Hevea brasiliensis) and SNP Markers Development for Rubber Biosynthesis Pathways", 《PLOS ONE》 * |
| WIRULDA ET AL: "SINGLE NUCLEOTIDE POLYMORPHISM MARKER DEVELOPMENT IN THE RUBBER TREE, HEVEA BRASILIENSIS (EUPHORBIACEAE )", 《AMERICAN JOURNAL OF BOTANY》 * |
| 卢世香: "树皮结构和HblMYC1基因与橡胶树产量相关性研究", 《中国优秀硕士论文全文数据库 农业科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109459435A (en) * | 2018-12-27 | 2019-03-12 | 中国热带农业科学院热带生物技术研究所 | The detection method of the screening technique of rubber tree kind, the breeding method of rubber tree and rubber tree yield |
| CN113846177A (en) * | 2021-07-30 | 2021-12-28 | 中国热带农业科学院橡胶研究所 | SNP molecular marker for rubber tree secondary emulsion tube array number and application thereof |
| CN113846177B (en) * | 2021-07-30 | 2023-04-25 | 中国热带农业科学院橡胶研究所 | SNP molecular marker for number of secondary emulsion tubes of rubber tree and application of SNP molecular marker |
| CN117487950A (en) * | 2022-05-31 | 2024-02-02 | 中国热带农业科学院橡胶研究所 | Construction method of rubber tree variety DNA fingerprint library |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105861498B (en) | 2018-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104419706B (en) | Snp marker and application thereof | |
| CN105838785B (en) | SSR molecular marker and application with sesame black seed coat gene close linkage | |
| CN105063185A (en) | Closely-linked marker of spike length major QTL (quantitative trait loci) and application of closely-linked marker | |
| CN102140522A (en) | Detection method for Apostichopus japonicas AjE101 micro-satellite DNA label | |
| CN101921758B (en) | Molecular marking method of soybean low phosphorus-resistant gene GmAPt | |
| CN106086195A (en) | One SNP marker relevant to the cabrilla speed of growth and application thereof | |
| CN109852710A (en) | One kind SNP marker relevant to grouper ammonia tolerance and application thereof | |
| Niwa et al. | Rapid DNA extraction from conchocelis and ITS-1 rDNA sequences of seven strains of cultivated Porphyra yezoensis (Bangiales, Rhodophyta) | |
| CN107217094A (en) | One SNP marker related to the gift tilapia speed of growth and its application | |
| CN107099588B (en) | Development and application of SSR (simple sequence repeat) marker for identifying earliness of upland cotton | |
| CN105861498A (en) | SNP marker related to rubber yield of rubber tree trunk and application of SNP marker | |
| CN104419705B (en) | Snp marker and application thereof | |
| CN105838809A (en) | SNP mark relevant to quantity of rubber tree laticifers and application of SNP mark | |
| CN108411007B (en) | SNP marker and its application | |
| CN107475418A (en) | With molecular labeling, primer and the application of millet tiller character close linkage | |
| CN107022608A (en) | SNP marker and its application | |
| CN105950729A (en) | SNP (single nucleotide polymorphism) marker related to hevea brasiliensis stem girth and application thereof | |
| CN112662806B (en) | Rhynchosia SSR molecular marker primer composition and application thereof | |
| CN112029894B (en) | SSR-labeled fingerprint of sabina pterata as well as construction method and application thereof | |
| CN104805081A (en) | Wheat grain heavy molecular marker and application thereof | |
| CN105063201A (en) | Molecular marker of corn chromosome 9 ear row number major QTL and application thereof | |
| Yuhanna et al. | Genetic variability of Phaius and Dendrobium orchids based on molecular markers | |
| CN103966316A (en) | Microsatellite family identifying method for diploid misgurnus anguillicaudatus and application of method | |
| CN114262749A (en) | Molecular marker primer pair, kit and detection method for loquat pulp color and application | |
| CN107034292A (en) | Chinese cabbage holds green property gene Brnye1 and its molecular labeling and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20181214 |