CN103421770B - Heredity markers of pig carcass quality trait and pig meat quality trait related to DIO3 gene and application of heredity markers - Google Patents

Abstract

The invention belongs to the technical field of livestock heredity marker manufacturing, and particularly relates to preparation and application of SNP heredity markers of the pig carcass quality trait and the pig meat quality trait. Gene segments of the pig carcass quality trait and the pig meat quality trait, used as the heredity markers, are obtained through cloning a pig DIO3 gene; the nucleotide sequence of the gene segment is shown as sequence table SEQ ID No: 1; a T369-G369 base substitution exists on the 369 bp part of the SEQ ID No: 1, so that NsbI-RFLP polymorphism is generated. The invention further discloses a method for preparing the heredity markers of the pig carcass quality trait and the pig meat quality trait, as well as application of the manufactured heredity markers to the polymorphism detection of the pig carcass quality trait and the pig meat quality trait, so that a new marker is provided for the mark auxiliary selection of pigs.

Description

DIO3 gene is as the genetic marker of hog on hook and Meat Quality and application

Technical field

The invention belongs to the genetic marker preparing technical field of pig breeding and pig, be specifically related to a kind of with hog on hook with the fragment of Genes Affecting Meat Quality DIO3 is cloned and as the application of pig genetic marker.

Background technology

China is that the first in the world is raised pigs big country, and pork is the main body of China's meat production, and be the main sources of urban and rural residents' meat consumption, the standard of living directly having influence on our people produced by pork.Along with improving constantly of people's living standard, people are not only satisfied with market enough thin porks, and requirement can buy the thin pork of delicate succulence, local flavor deliciousness.Therefore, improve lean ratio and meat quality, the new lines of high-quality, high yield, special favor is cultivated in research, and sets up efficient breeding technique system, just becomes the main direction of studying of pig breeding.

The emphasis that cultivation has high-quality, highly efficient and productive bacon hogs is pig breeding scholar research always.Important economical trait carries out genetic improvement by conventional breeding methods such as Phenotypic Selection, and required time is long, cost is high, along with the development of Protocols in Molecular Biology, progressively occur being that the molecular marker assisted selection of core and molecule marker infiltrate equimolecular breeding technique with molecule marker, these technology combine with traditional breeding method and greatly accelerate the process of pig breeding, gene or the mark that can be applied to molecular marker assisted selection must have larger contribution rate to objective trait, i.e. key-gene or mark, therefore find these key-genes or with it closely linked molecule marker become basis and the prerequisite of molecular marker assisted selection, also be emphasis and the urgent problem of for some time pig biology field research at present and in the future.

DIO3(thyroxine deiodinase 3) gene plays central role (Germain D, GaltonV.The deiodinase family of selenoproteins.Thyroid, 1997,7 (4): 655-668) in thyroid hormone metabolism process.It causes Triiodothyronine inactivation (BiancoAC by making tetraiodothyronine (T4) and trilute (T3) inner ring take off iodine, SalvatoreD, Gereben B, Berry MJ, Larsen PR.Biochemistry, cellular and molecular biology, andphysiological roles of the iodothyronine selenodeiodinases.Endocr Rev, 2002,23 (1): 38-89).In adult's tissue, DIO3 activity is very low and be only expressed in the tissue such as skin, uterus and brain (Galton V, Martinez E, Hernandez A, Germain E, Bates J, Germain D.Pregnant rat uterus expresses high levels of thetype 3 iodothyronine deiodinase.Journal of Clinical Investigation, 1999,103 (7): 979-987).But, at decidua tissue, higher (the Huang S of expression amount in placenta tissue and fetal tissue, Dorfman D, Genest D, Salvatore D, Larsen P.Type 3 iodothyronine deiodinase is highly expressed in the human uteroplacental unit andin fetal epithelium.Journal of Clinical Endocrinology & Metabolism, 2003,88 (3): 1384-1388).

DIO3 gene is positioned at the Dlk1-Dio3 marking bunch distalmost end, (Hernandez A is located at DLK1 downstream of gene-800kb, ParkJ, Lyon G, Mohandas T, Germain D.Localization of the type 3 iodothyronine deiodinase (DIO3) gene to human chromosome 14q32 and mouse chromosome 12F1.Genomics, 1998, 53 (1): 119-121), pig DIO3 gene is imprinted gene, the growth of the QTLs remarkably influenced pig of many markings is had in pig, the thickness of backfat, trunk composition and breeding (De Koning D, Rattink A, Harlizius B, Van Arendonk J, Brascamp E, Groenen M.Genome-wide scan for body composition in pigs reveals important role of imprinting.Proceedings of the National Academy of Sciences of the United States of America, 2000, 97 (14): 7947-7950).But it is very limited to the report of pig production performance about imprinted gene.The invention provides the heritable variation in imprinted gene DIO3 gene 3 ' non-translational region (3 ' UTR) and the relation between trunk and Meat Quality.

Summary of the invention

The object of the invention is to the specific DNA fragment of clone pig DIO3 gene, as the genetic marker of pig production character (particularly hog on hook proterties and Meat Quality) and the application in trait associations is analyzed thereof, the marker assisted selection for pig provides a kind of new mark.The invention still further relates to preparation method and the application of this mark.

The present invention is realized by following technical proposal:

Applicant is by screening, and obtain the genetic marker of a kind of hog on hook and Meat Quality, its nucleotide sequence is as follows:

AACTTGGTGGGCTCTGCCTTCGAGCTTTCTAAGCCCACGTGCAAACGCCCCAAACGAAGTCAGGCTTGGCGAGGGCCCAGTGACACAGCTGTGCTGAGCCATGGATCGCAGGCAGAGTCTGCCCCCTCGGCCAAGCCACCTGAAGATTCTCCTCCGCCTCCCCGGGGCTCTGCTTCAGTGACTGTCCCTCACCTGTGTTGCCTGGCTCACTCTAAGTCCCCTTCTGGCTGCAGAGGCAGCGCCACCCTTGCTTGTGTGCCCCTGGACTTGTCCTTGCACAGGCCCCTGCCACGCGCTCTCCCCAGCGTGCCCTTAGCCAGGCGCATTGGCCCCGCGCAGAGAGACTTTGGCCGCAGCCGCGCGCCCTGRCGCAGCTAGGTTACAGCACCGCGTCTGGCTCACCCTAGTTGCCTGGCACCCACACCTGTCGCTCGTCCGGAGGCGATGCCCTGCTGCTTTTGTGTCTACTTCTTGTCCCTGAGTTGGGGGAGGAGGCTTGGAATGGGAAAGGGTGGGTGGGCAGGGTTACGTTCCCCCCCCTCATTTGGGATGCTCACGAGCCCCACTGCTGATGACGAGCTGTCTCTAACTGGTCTTGACCACGAGCCGGTTCTGAATTGCAGGAGACTCGAAGCAGCGCCCAAACCGAGAGGGGAAAGTGCTCTGGGTTTCCTTAATGAAACCACATCAACGGGGTGGGAGAGGGAGGTTGGGGGACTGTTGGGGGACAGAGGG

R in above-mentioned sequence is T or G, causes Nsb I-RFLP polymorphism.

Applicant devises a kind of primer pair of increase pig DIO3 gene and the sudden change of this gene fragment of detection, and its DNA sequence dna is as follows:

Forward primer: AACTTGGTGGGCTCTGCC,

Reverse primer: CCCTCTGTCCCCCAACAG.

Establish a kind of method of screening the genetic marker of hog on hook and Meat Quality, prepare according to following steps:

Genomic dna is extracted from pig blood, according to pig DIO3 gene order design primer, its sequence is as sequence table SEQ ID NO:2 and SEQ ID NO:3, in pig genomic dna, pcr amplification is carried out with the primer shown in sequence table SEQ ID NO:2 and SEQ ID NO:3, PCR primer purifying, cloning and sequencing, obtain the nucleotide sequence as shown in sequence table SEQ ID NO:1 and SEQ ID NO:4.

Genetic marker of the present invention can be applied in hog on hook and Meat Quality detection.The primer pair of design also can be applicable in hog on hook and Meat Quality detection.

More detailed technical scheme is as described in " embodiment ".

Accompanying drawing explanation

Sequence table SEQ ID NO:1 is the nucleotide sequence of the local pig " plum mountain pig " of clone.Length is 736bp, wherein there is a T/G at the 369bp of this sequence and replaces.

Sequence table SEQ ID NO:2 and 3 is nucleotide sequences of the primer pair of design.

Sequence table SEQ ID NO:4 is the nucleotide sequence of the external pig kind " Large White " of clone.Length is 736bp, wherein there is a G/T at the 369bp of this sequence and replaces.

Fig. 1: be Large White, landrace, plum mountain pig and peaceful pig DIO3 sequence alignment result and SNP site respectively.

Fig. 2: pig DIO3 gene 3 ' UTR amplification.

Agarose concentration is 1.5%; In figure: swimming lane M is DL2000Marker; Swimming lane 1-4 is respectively the amplified fragments in Large White, landrace, plum mountain pig and peaceful pig, and clip size is 736bp.

Fig. 3: pig DIO3 gene Nsb I-RFLP detected result.

Agarose concentration is 1.5%; In figure: swimming lane M is DL2000Marker; GG genotype, 736bp; GT genotype, 736bp, 371bp, 365bp; TT genotype, 371bp, 365bp.

Fig. 4: the nucleotide sequence being 3 ' UTR of the pig DIO3 gene that the present invention clones, wherein the R at 369bp place is T or G sudden change, and this sudden change causes Nsb I-RFLP polymorphism.

Embodiment

The acquisition of embodiment 1 pig DIO3 gene fragment and the foundation of pleiomorphism detecting method

Test pig kind of the present invention is Large White, landrace, plum mountain pig and peaceful pig, and sample provides by Animal Husbandry and Veterinary Inst., Hubei Academy of Agricultural Sciences's animal embryo and key lab of molecular breeding Hubei Province, is general types.

The extraction of pig genomic dna:

Genomic DNA kit (TIANamp Genomic DNAKit) (the operating by this test kit specification sheets) that adopt Beijing Tian Gen biochemical technology company limited to produce extracts, and concrete steps are as described below:

(1) two external pig kinds " Large White " " landrace " and place of china blood relationship pig " plum mountain pig " and " peaceful pig " blood sample will be taken from, respectively put into the EP pipe of 2ml, add 200 these test kits of μ l damping fluid GA(after being cut into pasty state with the ophthalmologic operation of alcohol swab wiped clean and carry).

(2) add 20 μ l Proteinase K Solution (this test kit carries) again, mixing is placed in 56 DEG C of water-baths to digest spends the night.

(3) add 200 these test kits of μ l damping fluid GB(to carry), fully put upside down mixing, place 10 minutes for 70 DEG C, solution strain is limpid, and brief centrifugation is to remove the globule of cap wall.

(4) add 200 μ l dehydrated alcohols, fully vibration mixing 15 seconds, now may occur flocks, brief centrifugation is to remove the globule of cap wall.

(5) all add in an adsorption column CB3 (adsorption column puts into collection tube) by previous step gained solution and flocks, centrifugal 30 seconds of 12000rpm, outwells waste liquid, is put back in collection tube by adsorption column CB3.

(6) in adsorption column CB3, add 500 these test kits of μ l damping fluid GD(carry), centrifugal 30 seconds of 12000rpm, outwells waste liquid, adsorption column CB3 is put into collection tube.

(7) in adsorption column CB3, add 600 these test kits of μ l rinsing liquid PW(carry), centrifugal 30 seconds of 12000rpm, outwells waste liquid, adsorption column CB3 is put into collection tube.

(8) repetitive operation step 7.

(9) put back in collection tube by adsorption column CB3, centrifugal 2 minutes of 12000rpm, outwells waste liquid.Adsorption column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.

(10) proceeded to by adsorption column CB3 in a clean centrifuge tube, the unsettled dropping in the middle part to adsorption film 50-200 μ l elution buffer TE, room temperature places 2-5 minute, 12000rpm centrifugal 2 minutes, by solution collection in centrifuge tube.

(11) carry out saving backup at detection is placed on-20 DEG C to the concentration of the DNA extracted and quality, obtain DNA sample.

Genome sequence (the GenBank number of logging in: NM-001001625, http://www.ncbi.nlm.nih.gov/nuccore/NM_001001625.2) according to DIO3 gene designs following primer:

Forward primer F:5'AACTTGGTGGGCTCTGCC 3',

Reverse primer R:5'CCCTCTGTCCCCCAACAG 3'.

Utilize above-mentioned primer to carry out pcr amplification in Large White, landrace, plum mountain pig and peaceful pig genomic dna, PCR reaction system 25 μ L, in system, the concentration of each component is 50ng template DNA, 1 × Taq buffer 2.5mmol/L, 1.5mmol/LMgCl ₂, 2.5mmol/L dNTPs, 0.5mmol/L PCR primers, 2U Taq DNA polymerase, the working procedure of PCR is as follows: denaturation 94 DEG C of 4min; 94 DEG C of 45s, 61 DEG C of 40s, 72 DEG C of 45s, 35 circulations; Last 72 DEG C are continued to extend 10min.

To the PCR primer of above-mentioned four pig kinds through Gel Extraction Kit test kit (purchased from Shanghai Sheng Gong biotechnology company limited, according to the operation of test kit specification sheets) purifying, cloning and sequencing (order-checking entrust Shanghai Sheng Gong biotechnology company limited carry out), the size obtaining fragment is 736bp, and its nucleotide sequence is as sequence table SEQ ID NO:1(plum mountain pig) and SEQ IDNO:4(Large White) shown in.Carry out sequence alignment through ClusterW software, find that being wherein arranged in this fragment 369bp place (being namely positioned at 3 ' UTR) T/G variation causes Nsb I restriction enzyme site (TGC ↓ GCA) polymorphism.

Get 5 μ L PCR primer and add restriction enzyme 0.5 μ L (10U/ μ L), 10 × buffer 1 μ L, ddH ₂o 3.5 μ L, puts 37 DEG C of isothermal reactions and spends the night, and by the sepharose gel electrophoresis analysis of 1.5%, observes and records enzyme cut genotyping result at gel imaging system.This site of Nsb I nonrecognition when the base at 369bp place is all G, be designated as GG type (736bp), when mutational site base is all T, this site of Nsb I enzyme identification, is designated as TT type (371bp+365bp), is designated as GT type (736bp+371bp+365bp) when G and T exists.The enzyme of the PCR-Nsb I-RFLP of pig DIO3 gene cuts genotyping result as Fig. 3.

The polymorphism distribution detection validation of embodiment 2 genetic marker of the present invention in different swinery

Detect pig DIO3 gene 3 ' UTR district PCR-Nsb I-RFLP polymorphism distribution frequency in two China's pig kind (plum mountain pig, peaceful pig) and two external pig kinds (Large White, landrace), detected result is as shown in table 1.In plum mountain pig, peaceful pig, TT gene frequency is preponderated, allelotrope T frequency higher, in great Bai, landrace, G gene frequency is higher, great Bai, long white, Mei Shan, peaceful, etc. in four strains the allelic frequency of G be respectively 0.77,0.69,0.23,0.30; The allelic frequency of T is respectively 0.23,0.31,0.77,0.70.

Table 1DIO3 gene 3 ' UTR district Nsb I enzyme cuts polymorphic distribution results in different varieties

The association analysis of the molecule marker that embodiment 3 the present invention clones and pig production character and application

In order to determine that whether pig DIO3 gene pleiomorphism is relevant with Meat Quality to hog on hook, select 235 great Bai × Mei Shan F ₂generation (blood sample entrusts key lab of the pig genetics and breeding Ministry of Agriculture of Hua Zhong Agriculture University to gather) sources group is test materials, Nsb I-RFLP the method adopting embodiment 1 to set up carries out polymorphic detection, adopt SAS statistical software (SAS Institute Inc, Version 8.0) GLM program singly marks variance analysis, analyze the correlationship of pig DIO3 gene Nsb I-RFLP different genotype and hog on hook and Meat Quality, adopt model to be:

Model Y _ijk=μ+G _i+ S _j+ Y _k(+b _ijkx _ijk)+e _ijk

Y _ijfor trait phenotypes value, μ is mean value, G _ifor genotype effects, S _j, Y _kfor fixed effect, be respectively sex, annual effect, b _ijkfor the regression coefficient of slaughter weight or slaughter age, carcass trait take slaughter weight as concomitant variable, and Meat Quality take slaughter age as concomitant variable, e _ijkfor residual error effect.

When Nsb I-RFLP genotype is different as can be seen from Table 2, between lean ratio, fat meat rate, thin fertile ratio, 6-7 lumbar vertebrae there is significant difference (P<0.05) in fat thickness, buttocks fat thickness, eye muscle area, and intramuscular fat content exists pole significant difference (P<0.01).

The statistical analysis table of table 2 pig DIO3 gene 3'UTR district PCR-Nsb I-RFLP genotype and trunk and Meat Quality

Note: 1, in These parameters, between dressing percentage, lean ratio, thin fat meat ratio, shoulder fat thickness, 6-7 lumbar vertebrae, fat thickness, buttocks fat thickness, eye muscle area are carcass trait; Percentage of water loss, Coefficient shrinkage, muscle colour and intramuscular fat content are Meat Quality.

2, above numerical value is least square mean value ± standard error; Containing same letter, colleague represents that difference is not remarkable, different lowercase alphabet shows significant difference (P<0.05), and different capitalization represents that difference extremely significantly (P<0.01).

Claims (1)

1. the application of genetic marker in Large White, plum mountain hog on hook and Meat Quality SNP detect, is characterized in that the nucleotide sequence of this genetic marker is as follows:

AACTTGGTGGGCTCTGCCTTCGAGCTTTCTAAGCCCACGTGCAAACGCCCCAAACGAAGTCAGGCTTGGCGAGGGCCCAGTGACACAGCTGTGCTGAGCCATGGATCGCAGGCAGAGTCTGCCCCCTCGGCCAAGCCACCTGAAGATTCTCCTCCGCCTCCCCGGGGCTCTGCTTCAGTGACTGTCCCTCACCTGTGTTGCCTGGCTCACTCTAAGTCCCCTTCTGGCTGCAGAGGCAGCGCCACCCTTGCTTGTGTGCCCCTGGACTTGTCCTTGCACAGGCCCCTGCCACGCGCTCTCCCCAGCGTGCCCTTAGCCAGGCGCATTGGCCCCGCGCAGAGAGACTTTGGCCGCAGCCGCGCGCCCTGRCGCAGCTAGGTTACAGCACCGCGTCTGGCTCACCCTAGTTGCCTGGCACCCACACCTGTCGCTCGTCCGGAGGCGATGCCCTGCTGCTTTTGTGTCTACTTCTTGTCCCTGAGTTGGGGGAGGAGGCTTGGAATGGGAAAGGGTGGGTGGGCAGGGTTACGTTCCCCCCCCTCATTTGGGATGCTCACGAGCCCCACTGCTGATGACGAGCTGTCTCTAACTGGTCTTGACCACGAGCCGGTTCTGAATTGCAGGAGACTCGAAGCAGCGCCCAAACCGAGAGGGGAAAGTGCTCTGGGTTTCCTTAATGAAACCACATCAACGGGGTGGGAGAGGGAGGTTGGGGGACTGTTGGGGGACAGAGGG

R in above-mentioned sequence is T or G, causes Nsb I-RFLP polymorphism.