CN107699624B

CN107699624B - SNP marker combination and identification method of small plum mountain pigs and raw meat products

Info

Publication number: CN107699624B
Application number: CN201711008654.9A
Authority: CN
Inventors: 潘玉春; 岳阳; 王起山; 张哲�; 徐忠; 孙浩; 刘登英; 赵伟; 马裴裴
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2017-10-25
Filing date: 2017-10-25
Publication date: 2021-06-29
Anticipated expiration: 2037-10-25
Also published as: CN107699624A

Abstract

A method for combining and identifying SNP markers of a small plum mountain pig and a raw meat product comprises the steps of extracting genome DNA of the raw pork or the meat product, carrying out agarose gel electrophoresis and Sanger sequencing after PCR amplification, and identifying the small plum mountain pig and the meat product thereof according to SNP genotypes of characteristic sites of sequencing results; the Sanger sequencing has the following identification sites: specific mutations appear at positions SNP6, SNP12, SNP16, SNP71 and SNP 79; the invention solves the problem that the prior art has no identification method related to the Meishan pigs and meat products thereof.

Description

SNP marker combination and identification method of small plum mountain pigs and raw meat products

Technical Field

The invention relates to a technology in the field of food safety monitoring, in particular to a SNP marker combination and an identification method of a small plum mountain pig and a raw meat product.

Background

Meishan pigs are one of excellent local varieties (strains) in the Taihu basin in China, and are famous for high reproductive capacity and delicious meat quality. With the development of sequencing technology, molecular markers have also evolved from Restriction Fragment Length Polymorphism (RFLP) of one generation, variable number of tandem repeat polymorphism (SSR) of a second generation, to Single Nucleotide Polymorphism (SNP). Compared with the first two generations of molecular markers, the third generation of molecular marker SNP has the advantages of rich variation, low requirement on DNA samples, high stability, accurate determination, simple and convenient detection method, high flux and the like. At present, the third generation molecular marker SNP has been widely applied to the fields of paternity test, animal and plant variety (strain) identification, genetic breeding and the like.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides an SNP marker combination and an identification method for identifying the small plum mountain pigs and the raw meat products, which utilize the third generation molecular marker identification and Sanger sequencing technology to identify the small plum mountain pigs and the raw meat products, solve the problem that no identification method related to the small plum mountain pigs and the meat products thereof exists in the prior art, and provide a method for identifying the small plum mountain pigs and the meat products thereof with accurate results, simple operation and low price and related special primers.

The invention is realized by the following technical scheme:

the invention relates to an SNP marker combination of a small plum mountain pig and a raw meat product, which comprises the following components: SNP6, SNP12, SNP16, SNP71 and SNP79, which specifically comprise the following sites: the 12412657 th site of chromosome 12, i.e. the 12 th site of SNPs, the 91761900 th site of chromosome 7, i.e. the 79 th site of SNPs, the 16740526 th site of chromosome 7, i.e. the 71 th site of SNPs, the 25668001 th site of chromosome 6, i.e. the 6 th site of SNPs, the 70624962 th site of chromosome 16, i.e. the 16 th site of SNPs.

The invention relates to a method for identifying the small plum mountain pigs and the raw meat products based on the SNP marker combination, which comprises the steps of extracting the genome DNA of the raw pork or the meat products, carrying out agarose gel electrophoresis and Sanger sequencing after PCR amplification, and identifying the small plum mountain pigs and the meat products thereof according to the SNP genotype of the characteristic sites of the sequencing result.

The Sanger sequencing has the following identification sites: specific mutations appeared at positions SNP6, SNP12, SNP16, SNP71, and SNP 79.

The sequence information of 500BP at the upstream and downstream of the gene of the SNP12 is shown as Seq ID No. 11.

The sequence information of 500BP at the upstream and downstream of the gene of the SNP6 is shown as Seq ID No. 12.

The sequence information of 500BP at the upstream and downstream of the gene of the SNP16 is shown as Seq ID No. 13.

The sequence information of 500BP at the upstream and downstream of the gene of the SNP71 is shown as Seq ID No. 14.

The sequence information of 500BP at the upstream and downstream of the gene of the SNP79 is shown as Seq ID No. 15.

The PCR amplification, wherein the primers involved comprise: the primer pairs of C12, C16, C6, C71 and C79 specifically comprise:

upstream primer C12-F as shown in Seq ID No. 1: 5 'GTGTGCCTCCCACTCCATCA 3' of the formula I,

upstream primer C12-R as shown in Seq ID No. 2: 5 'CTACCAAATGTTAATTCCCTTCA 3';

upstream primer C16-F as shown in Seq ID No. 3: 5 'CCTCTGCCTGGTAGCCGTTA 3' of the formula I,

upstream primer C16-R as shown in Seq ID No. 4: 5 'GCGAGGTAGGCAAGGAAGAA 3';

upstream primer C6-F as shown in Seq ID No. 5: 5 'GTGCCCAGGAAAACTACAAA 3' of the formula I,

upstream primer C6-R as shown in Seq ID No. 6: 5 'GAGAGCCTCCAACACAGACAA 3';

upstream primer C71-F as shown in Seq ID No. 7: 5 'AAATGTCACTGTTTTACTGCG 3' of the formula I,

upstream primer C71-R as shown in Seq ID No. 8: 5 'TGGTCCTATTCCCCTTCAGA 3';

upstream primer C79-F as shown in Seq ID No. 9: 5 'CCACACCCTCTCGTTCCCAG 3' of the formula I,

upstream primer C79-R as shown in Seq ID No. 10: 5 'CTGTCGGCAGTGTGGTGTCG 3'.

The PCR amplification comprises a reaction system of 1ng/uL template DNA, 1uL primer and H₂O3.8 uL and 2 xTaq PCR Masrer Mix 50uL, and/or the reaction program of the PCR reaction is pre-denaturation at 95 ℃ for 2min, pre-denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, cycle times for 30 times, and re-extension at 72 ℃ for 10 min.

The mass concentration of the agarose gel is 2%.

The gel electrophoresis has the following band requirements: c12 was about 280 a long, C6 was about 250 a long, C71 was about 241 a long, C79 was about 271 a long, and C16 was about 180 a long.

The Sanger sequencing has the following identification sites: specific mutations appear at positions SNP6, SNP12, SNP16, SNP71 and SNP 79;

the reference genome SNP6 is located at the 25668001 th site of chromosome 6, the alignment sequence is CGGAGGACA, the last site is an identification site, the genotype is A, and the specific mutation of the small plum mountain pig is G;

the reference genome SNP12 is located at the 12412657 th site of chromosome 12, the alignment sequence is GCAAAGGCA, the last site is an identification site, the genotype is A, and the specific mutation of the small plum mountain pig is G;

the reference genome SNP16 is located at 70624962 th site of 16 # chromosome, the alignment sequence is AATAGCAGC, the last site is an identification site, the genotype is C, and the specific mutation of the small plum mountain pig is T;

the reference genome SNP71 is located at the 16740526 th site of chromosome 7, the alignment sequence is GTAATAGCG, the last site is an identification site, the genotype is G, and the specific mutation of the small plum mountain pig is A;

the reference genome SNP79 is located at the 91761900 th site of chromosome 7, the alignment sequence is AGCTATGTT, the last site is an identification site, the genotype is T, and the specific mutation of the small plum mountain pig is C.

The small Meishan pigs refer to Meishan pigs native to Jiangsu sentence capacity and Jiangsu Taicang, and belong to Taihu lake pig species.

The pork product of the small plum mountain pig is a pickled product and a cooked food product which are prepared by processing the small plum mountain pig as a raw material.

Technical effects

Compared with the prior art, the method takes the specific SNPs loci of the small plum mountain pig variety as identification basis, researches and identifies the method of the small plum mountain pig from a molecular level, and takes Sanger sequencing as a main molecular identification method, so that the small plum mountain pig and other pig varieties (strains) can be identified, for example: the method is characterized in that the pig is a Changbai pig, a big white pig, a Duroc, a Peterland, a Bake summer, a Zhongmeishan pig, a Fengjing pig, a rice pig, a Erhualian pig, a Jiaxing black pig, a Shakuo pig and the like, and the operation is simple and rapid.

Drawings

FIG. 1A is a gel electrophoresis of a DNA fragment of about 280 bplength that is qualified for amplification using the primer pair C12; b is a gel electrophoresis picture of DNA fragments with the length of about 250 bpwith the qualified amplification of the primer pair C6; c is a gel electrophoresis picture of a DNA fragment with the length of 241 bpwith the primer pair C16; d is a gel electrophoresis picture of DNA fragments with the length of about 271 bpwith the qualified amplification of the primer pair C71; e is a gel electrophoresis picture of DNA fragments with the length of about 180 bpwith the qualified amplification of the primer pair C79;

FIG. 2 is a sequencing diagram of the 12412657 th site SNP polymorphism of chromosome 12 of a Ministry pig, wherein the identification site is SNP, and the marker below the normal sequencing data is SNP site information specific to Ministry pig;

FIG. 3 is an enlarged view of a portion of FIG. 2;

FIG. 4 is a sequencing diagram of the 25668001 th site SNP polymorphism of chromosome 6 of a Ministry pig, wherein the identification site is SNP, and the marker below the normal sequencing data is SNP site information specific to Ministry pig;

FIG. 5 is an enlarged view of a portion of FIG. 4;

FIG. 6 is a sequencing diagram of the 70624962 th site SNP polymorphism of chromosome 16 of a Ministry pig, wherein the identified site is SNP, and the marker below the normal sequencing data is SNP site information specific to Ministry pig;

FIG. 7 is an enlarged view of a portion of FIG. 6;

FIG. 8 is a sequencing diagram of the 16740526 th site SNP polymorphism of chromosome 7 of a Chimonanthus nitens, wherein the identified site is SNP, and the marker below the normal sequencing data is SNP site information specific to Chimonanthus nitens;

FIG. 9 is an enlarged partial schematic view of FIG. 8;

FIG. 10 is a sequencing diagram of the 91761900 th site SNP polymorphism of chromosome 7 of a Ministry pig, wherein the identified site is SNP, and the marker below the normal sequencing data is SNP site information specific to Ministry pig;

FIG. 11 is an enlarged view of a portion of FIG. 10;

in the figure: the identification sites are: specific mutations appear at positions SNP6, SNP12, SNP16, SNP71 and SNP 79;

Detailed Description

Twenty samples of ear tissues of the small Meishan pigs and ten samples of each variety (strain) of the ear tissues of other twelve varieties (strains) are selected and identified, and the improved SDS method is adopted to extract the tissue DNA.

PCR amplification was performed using primer pairs C12, C6, C16, C71, and C79.

The reaction system of the PCR reaction is a 10uL system: template DNA 1ng/uL, primer 1uL, H₂O3.8 uL and 2 XTaq PCR Masrer Mix 50uL, and/or the reaction program of the PCR reaction is pre-denaturation at 95 ℃ for 2min, pre-denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, cycle times for 30 times, and re-extension at 72 ℃ for 10 min.

The amplification result was detected by electrophoresis in 2% agarose gel and 1 XTAE buffer as medium under the conditions of current 10A, voltage 100V and time 40 min. When the gel electrophoresis pattern of the amplification product of the C12 primer shows a band with the length of about 280bp in the figure 1, the amplification result is considered to be qualified; when the gel electrophoresis pattern of the amplification product of the C6 primer shows a band with the length of about 250bp in figure 1, the amplification result is considered to be qualified; when the gel electrophoresis pattern of the amplification product of the C16 primer shows a band with the length of about 241bp in figure 1, the amplification result is considered to be qualified; when the gel electrophoresis pattern of the amplification product of the C79 primer shows a band with the length of about 271bp in the figure 1, the amplification result is considered to be qualified; when the gel electrophoresis pattern of the amplification product of the C16 primer shows a band of about 180bp in length in FIG. 1, the amplification result is considered to be qualified.

Subjecting qualified sample PCR amplification products to Sanger sequencing, and analyzing sequencing results, wherein the comparison sequence of the SNP12 is GCAAAGGCA, the last position of the comparison sequence is a polymorphic site of the SNP12, and the sequencing results are compared with the sequencing results of the C12 primer amplification products, as shown in FIG. 6, the genotype of the SNP12 in a reference genome is A, the genotype of the variety (line) specific SNP of the meishan is G, the comparison sequence of the SNP6 is CGGAGGACA, the last position of the comparison sequence is a polymorphic site of the SNP6, and the sequencing results are compared with the sequencing results of the C6 primer amplification products, as shown in FIG. 7, the genotype of the SNP6 in the reference genome is A, the genotype of the variety (line) specific SNP genotype of the meishan is G, the comparison sequence of the SNP16 is AATAGCAGC, the last position of the comparison sequence is a polymorphic site of the SNP16, as shown in FIG. 8, the genotype of the SNP16 in the reference genome is C, the variety (line) of the meishan is T3985, the last position of the comparison sequence is a polymorphic site of SNP71, and the comparison is carried out with the sequencing result of the C71 primer amplification product, as shown in FIG. 8, the genotype of SNP71 in a reference genome is G, and the special SNP genotype of the Xiaomeishan breed (strain) is A, the comparison sequence of SNP79 is AGCTATGTT, the last position of the comparison sequence is a polymorphic site of SNP79, and the comparison is carried out with the sequencing result of the C79 primer amplification product, as shown in FIG. 8, the genotype of SNP79 in a reference genome is T, and the special SNP genotype of the Xiaomeishan breed (strain) is C;

TABLE 1, 12 porcine species sample sequencing result SNP polymorphism analysis tables

Site of the body

sMS

mMS

MI

SW

FJ

ER

JX

YY

PP

DD

LL

BB

SNP12

Aa

AA

SNP16

Aa

AA

Aa

AA

SNP79

Aa

AA

SNP71

Aa

AA

SNP6

Aa

AA

Aa

AA

In the table, mMS is a Zhongmeishan pig; the sMS is a small Meishan pig; SW is a pig with a pig-shaped pig; FJ is Fengjing pig; ER is Erhualian; MI is rice pig, JX is Jiaxing black pig; DD refers to Duroc pigs; LL is Changbai pig; BB is Bakela pig, PP is Pietrain pig; YY is big white pig.

The sequencing data can show that the selected Meishan pig breed specific SNPs have specificity in 12 groups, except that mutations exist at the SNPs16 site and the SNPs79 site of the Meishan pig; the SNPs71 site of the big white pig has mutation; the rice pig has mutation at the site of SNPs6, no mutation occurs in other groups, and only the small Meishan pigs have specific mutation at the site of SNPs 12.

The unique SNPs loci of the small Meishan pigs selected by GGRS are comprehensively utilized to accurately identify the breeds of the small Meishan pigs. Comprehensively utilizing the identification sites, if the sites of SNPs16 and SNPs79 have mutation, deducing that the pig to be detected is probably a Zhongmeishan pig; if the site of the SNPs6 has mutation and the other four sites have no mutation, the pig species to be detected can be concluded to be the rice pig; if there is a mutation at the site of SNPs71 and no mutation at the remaining four sites, it can be concluded that the swine to be tested is a large white pig.

500BP sequence information on the upstream and downstream of the gene of SNP12 is shown in Seq ID No. 11.

500BP sequence information on the upstream and downstream of the gene of SNP6 is shown in Seq ID No. 12.

500BP sequence information on the upstream and downstream of the gene of SNP16 is shown in Seq ID No. 13.

500BP sequence information on the upstream and downstream of the gene of SNP71, as shown in Seq ID No. 14.

500BP sequence information on the upstream and downstream of the gene of SNP79 is shown in Seq ID No. 15.

At present, no relevant patent about identification of the small plum mountain pig and the meat product variety (strain) thereof exists at home and abroad, and the third generation molecular marker is used for identifying the small plum mountain pig and the meat product variety (strain) thereof, so that the market vacancy is filled, and the counterfeit identification problem of the small plum mountain pig variety (strain) is effectively solved. Compared with the existing patent for identifying pig breeds by utilizing the first generation molecular marker (RFLP) and the second generation molecular marker (SSR), the identification method has the advantages of simpler operation, more accurate result, rapidness and high efficiency. Meanwhile, the invention utilizes the third generation molecular marker SNP to overcome the defect that the first two generations of molecular markers can use less sites, and compared with the identification technology of the first two generations of molecular markers, the identification method is simplified.

The foregoing embodiments may be modified in many different ways by those skilled in the art without departing from the spirit and scope of the invention, which is defined by the appended claims and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.

Sequence listing

<110> Shanghai university of transportation

SNP marker combination and identification method of <120> small plum mountain pigs and raw meat products

<130> f-a985e

<141> 2017-10-25

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> upstream primer C12-F ()

<400> 1

gtgtgcctcc cactccatca 20

<210> 2

<211> 23

<212> DNA

<213> downstream primer C12-R ()

<400> 2

ctaccaaatg ttaattccct tca 23

<210> 3

<211> 20

<212> DNA

<213> upstream primer C16-F ()

<400> 3

cctctgcctg gtagccgtta 20

<210> 4

<211> 20

<212> DNA

<213> downstream primer C16-R ()

<400> 4

gcgaggtagg caaggaagaa 20

<210> 5

<211> 20

<212> DNA

<213> upstream primer C6-F ()

<400> 5

gtgcccagga aaactacaaa 20

<210> 6

<211> 21

<212> DNA

<213> downstream primer C6-R ()

<400> 6

gagagcctcc aacacagaca a 21

<210> 7

<211> 21

<212> DNA

<213> upstream primer C71-F ()

<400> 7

aaatgtcact gttttactgc g 21

<210> 8

<211> 20

<212> DNA

<213> downstream primer C71-R ()

<400> 8

tggtcctatt ccccttcaga 20

<210> 9

<211> 20

<212> DNA

<213> upstream primer C71-F ()

<400> 9

ccacaccctc tcgttcccag 20

<210> 10

<211> 20

<212> DNA

<213> downstream primer C71-R ()

<400> 10

ctgtcggcag tgtggtgtcg 20

<210> 11

<211> 1001

<212> DNA

<213> SNP12(SNP12)

<400> 11

ctaaggtgcc ggccaggggc agcgcctctc atagaagcgg acaactgagg gctgtgaaaa 60

ataaaagcga gaggggaggc acgtgaaatt taggcctcgg ccagacgccg aggagaagcg 120

tgccgttgcc cgagagccag ggtaacaagt ggagggagct gctccgcgtg gggctggagg 180

agcagatggg acctgggctt gcgttcgctt cgctgcaggt gccgggggac acgtgggagg 240

aggcggtcag gcgtggagcc ggcgaggaaa gccggggggg gggggggcta cctgcaggcc 300

tcgggccaca ggaagaggct gaagcctcgg ggggacggga gggccttcgg cagcagaggg 360

acaaacgggg accttcctag gagccaagac gcatccacca gcggctccaa cccttaggac 420

gcaggcagga ggatggaagg agggaaagac cgggacggct agagagcggg ggcggcggtc 480

aggaaggtgg ggagcggggc cctgggtgcc atggggaggt gggactgtga ggtggcagat 540

gctgcctgga gaccaaggcc ctctctgtct ttcgcctcgc atttcggcct ctggttggaa 600

acagtcagct tggcagcctg gcagtcgtga taggctttgg cgagcagcaa cgctgcgaat 660

agcttgagat gaaattagct gataaattca ttgtgtccta tgtttaaagc aaaaattaca 720

acagaagtgt ccatctctaa tctttggtta aatatggttc aaaatgtctg attaaaaaat 780

atatatatct gatttagtca gagcgttttg acctggtttg agggcatctt tcaaaagagg 840

caagccatga ctgctctttc ttttctgcat atttaaactc ttgacaatta taaataagtt 900

aaatctctcc ctcaaagtac caattatctc cttatgttcg agaaggcatg tcttgccaaa 960

tatggcattc tacacaaaac acaaaataag gccacaaagg c 1001

<210> 12

<211> 1001

<212> DNA

<213> SNP6(SNP6)

<400> 12

ttccagtcat gggggaaggt atgaggaagt ttccaagcat catggaaggt cttacatatg 60

catgtcagtg ctttggattg gaaagtttat gaaatttgga gccagttgga cctgagttca 120

atcccatttc tcttcatcta atatcagttt cctttcttga aaataggttt cataaatcta 180

atatcctagg atcattgtga agtttgaatg atgcaaatgc ataagcaatt cctactcaag 240

tattaactca ctattaattc atagagaaat accaaaatca ggcattgata atatcttatt 300

tttataatgt ataaggagac cagtgagaga atgagaaaaa gagaattaaa cttattcaaa 360

atctttgcag ctagcaagtg gcaaaactag ggttcaaatc tgtgtggctc taagtgagct 420

ctttcggatg ctctccatgt ttagagtact gacttatcaa attttatagt gaaaaatttt 480

acaaaggact ataaattttc actcagtatt aacatatgac atcaatgtta tggtcaatga 540

attatgtatt ctgcatatcc cttaggctgt ttgtggtttt taaatgtgac ataagcgtta 600

gcaatattac ttgattacca ctggaatagc aagtctttca gtggatgtca attaacatct 660

tttttacaca gatgttccag gattgaagaa gaaatatact gattaatacc tccctcaaat 720

cctgggataa agatgaaagt attatattat ccacttgctg gccagttcaa taaactagat 780

taaagaaagg aatgagaagc tatccctcca ggcttaatga aatatgtgtt tagccgagca 840

ggctggttag aattgagcct cctcacagag acatctgttg ccaaataatg ttttttgttt 900

tgttctgtct ttttcctatt actattatta ttaacattga ccttggtggt gatccagcac 960

tcttgctgct gcctttaggt tctaaagata taaaacaact a 1001

<210> 13

<211> 1001

<212> DNA

<213> SNP16(SNP16)

<400> 13

catcgtggca cagtggttaa agaatctgac taggaactat gaggttgtgg gttcaatccc 60

tggccttgct cagtgggtta aggatccggc gttgccatga gctgtggtgt aggttgcaga 120

cgcagttcgg atccgatgtt gctgtggctc tggcgtaggc cggtggctac agctccgata 180

caacccctag cctgggaacc tacatatgcc gcgggagcgg cccaagaaat ggcaaaaaga 240

taaaaaataa ataagtaaat aaatgaagga aggagaatca aaggcaggaa gagaagctcc 300

cctagaggag tccatggtct acttggagca cctgccatca cagtgaactt cccaattttg 360

ttctaatgtc agcactaatg actttctcct ccaagctgca gccagctctg ctcctcttta 420

gtgctgtcag ctgctatcca acctctcagc agacgcttgg gaatagggag attctgacac 480

agagagcact agttgggatc tgccaagcag tgacgtttgt aattgcagtt aaaaactgct 540

gcatctaaga ctccacctcc ctcccttcac ttctcctgtt caccactggg acactgaaag 600

ggctctgtgc aaagatgcct gctgtgccat taagcatgca gggacaatgc tgcccagatg 660

ataatctgca tgaagacaga gggtcttctc tgggtcatta tgaggaacag tgattttcca 720

ttattcttac atttcttaag cattgaatgt tttatgtgat agctttaaaa gcatcaccac 780

tatactatgt ataacatctc tgcgaataag ccctttccac attttatttc cattaaatga 840

ccaaccaagt taatgttttc agagaacaag tgattctgtt tcagtcacta cttttctatc 900

taaatttcca tcggatccca agttttaaga taagcacgag ttaacagaga gagagtaaaa 960

gagacgaata tgcaaagttg tactttctgt gagtttcagc c 1001

<210> 14

<211> 1001

<212> DNA

<213> SNP71(SNP71)

<400> 14

acaaacatga agacaaagac aatgaacaga ttttaaaatg gatattcaag gagtgtaaat 60

cagacggggt agaagctttc attacaggct ttgtagagtc atttgatttt tttaaattat 120

gcacacattt cattctgata atactgcaag ttaagtggaa atgcgaaaga aaaagaacta 180

aacttccaag ttgctggtag tcagctggtg tagagcttct gccatcacca gcagtagtca 240

tgtgttcaac acatgcccca gcggctggag gaatttccta ctaagacttt aagccgcaac 300

cagcccagtt ttctcttttg attagtatcc agtcttcggg catgcatact tgtggttagt 360

acacagtggg aggattgaaa agaggcacat ggaaaagttc gatgctgagc ctcagacact 420

gcaggtgttc ttcaagttgg tcgtcttcct aacagagtca aataaggacc acaaacatca 480

aaacatcatg gaaaaccggc tgcaaccaaa atcagggcat ggaaaaattg gtccttaaga 540

atcattctgt ggtagcgctg ttgaattggc atgggtgaaa agtggagcaa attgccttat 600

tcaacacagt gaagaggctc taggaaaaca aagcacacac aataatggca gtaacaatgg 660

ctcttgtcag ataatcaccc tcctaatact gtgctctttg tgcttaatac tgtacctaat 720

actgcaccta atactatgcc ctctgtgctt aatactatac ctcatactgt actctaatat 780

atatataatc taataatgtt ctctgtgctt aatactatac ctaatactgt aatatatata 840

tataatctaa tacatattct ctgtgcttaa tactatacct catactgtac ctaatactat 900

gctctttgtg ctttaaatgt atttttctct ttgtaattat tatttttgtc tctagtatta 960

gtattattat tattttcatt gaaggatagt tcatttacaa t 1001

<210> 15

<211> 1001

<212> DNA

<213> SNP79(SNP79)

<400> 15

ttgagatctg ttgctgtgca atttggggca aattctataa tacctctcca cctcagtttc 60

ctcgtgtgct agttggagat agtaacacct attccatagg gttgttgtga agattaatag 120

agagaatatc tttaaagtgc taagctttat ggttggtaca aaggaaatgt tcaaaagaaa 180

ggtctttgta ttataacgaa cttcctttct tccggttcct aaatttatta agctcacttt 240

aaaaaattat tgtggttgga gttcccgtca tggtgctgcg gaaacaaatc cgaactagga 300

accatgaggt tgcaggtttg atccctggcc tcgctcagtg ggttaaggat ctggtgttgc 360

cgtgagctgt ggtgtaggtc gcagatgagg ctcggatctg atgttgctgt ggctgtggtg 420

taggctggca gctgtaactc caattagacc cctaggctgg aaaccgccat atgccgagag 480

tgcggcccta aaaagcaaaa ataaataaat aaataaataa ataaataaat aaataatatt 540

gtatttaaat gatatactta gttctctctt tttctcttcc tcatcacagc tcttccccag 600

tttttaccta ctactcgttt tgaacccact tcaccctggc ttccaaaatg tttcagattt 660

tattcccaat cctaatccta atctcgttat tattgcttag cctctccaag cctgttctgc 720

ctacagtgac ttcagcttgc agtggttcaa gtcaaagacc tgagaggtag ctttgtcccc 780

ttcttcttct tccttccacc acgaagtgga attctaaaca tttcagagtt cccgtcgtgg 840

ttcagcggtg aacgaaccag actagcatcc atgaggccag tgggtttgat ccgtggcctc 900

actcagtggg ttaaggatcc ggcgttgccg tgagctgtgg tgtaggttgc agattcggct 960

tggatcctgt gttgctgagg ctgtggtgta ggctggtggc a 1001

Claims

1. A method for identifying Meishan pig and raw meat products based on an SNP marker combination, which comprises the following steps: SNP6, SNP12, SNP16, SNP71 and SNP79, which specifically comprise the following sites: no.12 chromosome 12412657 site, namely SNPs12, No.7 chromosome 91761900 site, namely SNPs79, No.7 chromosome 16740526 site, namely SNPs71, No.6 chromosome 25668001 site, namely SNPs6, No. 16 chromosome 70624962 site, namely SNPs16, characterized in that, the identification method extracts genome DNA of raw pork or meat products, and carries out agarose gel electrophoresis and Sanger sequencing after PCR amplification, and the genotype of the SNP marker combination in the sequencing result is specific mutation, namely the SNP marker combination is identified as a small Meishan pig and meat products thereof; the small Meishan pigs refer to Meishan pigs native to Jiangsu sentence capacity and Jiangsu Taicang, and belong to Taihu lake pig species;

the PCR amplification is carried out in the presence of a primer,

wherein the primer comprises: the primer pairs of C12, C16, C6, C71 and C79 specifically comprise:

the amplification primers for SNP12 were:

upstream primer C12-F as shown in Seq ID No. 1: 5 'GTGTGCCTCCCACTCCATCA 3';

downstream primer C12-R as shown in Seq ID No. 2: 5 'CTACCAAATGTTAATTCCCTTCA 3';

the amplification primers for SNP16 were:

upstream primer C16-F as shown in Seq ID No. 3: 5 'CCTCTGCCTGGTAGCCGTTA 3';

downstream primer C16-R as shown in Seq ID No. 4: 5 'GCGAGGTAGGCAAGGAAGAA 3';

the amplification primers for SNP6 were:

upstream primer C6-F as shown in Seq ID No. 5: 5 'GTGCCCAGGAAAACTACAAA 3';

downstream primer C6-R as shown in Seq ID No. 6: 5 'GAGAGCCTCCAACACAGACAA 3';

the amplification primers for SNP71 were:

upstream primer C71-F as shown in Seq ID No. 7: 5 'AAATGTCACTGTTTTACTGCG 3';

downstream primer C71-R as shown in Seq ID No. 8: 5 'TGGTCCTATTCCCCTTCAGA 3';

the amplification primers for SNP79 were:

upstream primer C79-F as shown in Seq ID No. 9: 5 'CCACACCCTCTCGTTCCCAG 3';

downstream primer C79-R as shown in Seq ID No. 10: 5 'CTGTCGGCAGTGTGGTGTCG 3';

the genotype in Sanger sequencing is as follows:

2. The method of claim 1, wherein the PCR amplification is carried out in the presence of 1ng/uL template DNA, 1uL primer, and H primer₂O3.8 uL and 2 xTaq PCR Master Mix 50uL, and/or the reaction program of the PCR reaction is pre-denaturation at 95 ℃ for 2min, pre-denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 1min, cycle times for 30 times, and re-extension at 72 ℃ for 10 min.

3. The method of claim 1, wherein the agarose gel has a mass concentration of 2%.

4. The method of claim 1, wherein the gel electrophoresis is performed with the following bands: the length of the amplification product of the C12 primer pair was 280, the length of the amplification product of the C6 primer pair was 250, the length of the amplification product of the C71 primer pair was 241, the length of the amplification product of the C79 primer pair was 271, and the length of the amplification product of the C16 primer pair was 180.