CN113930517B

CN113930517B - Application of rs81439242 SNP molecular marker in breeding of live pig strain with body length correlation

Info

Publication number: CN113930517B
Application number: CN202111163935.8A
Authority: CN
Inventors: 乔瑞敏; 徐盼; 王小女; 张晨; 聚明明; 李明; 李新建
Original assignee: Henan Agricultural University; Jiangsu Agri Animal Husbandry Vocational College
Current assignee: Henan Agricultural University; Jiangsu Agri Animal Husbandry Vocational College
Priority date: 2020-09-12
Filing date: 2020-09-12
Publication date: 2023-07-07
Anticipated expiration: 2040-09-12
Also published as: CN113930517A; CN113881780B; CN112094917B; CN112094917A; CN113881780A

Abstract

The invention relates to application of an rs81439242 SNP molecular marker in breeding of live pig strains with body length correlation. The rs81439242 SNP marker is permeated into the Chinese local pig from the western pig blood margin, is extremely obviously associated with the body length (P < 0.01), and can be used for auxiliary selection breeding of the Chinese local pig body length molecular marker, thereby more effectively accelerating the breeding speed, improving the breeding accuracy, and having important economic benefit and social application value.

Description

Application of rs81439242 SNP molecular marker in breeding of live pig strain with body length correlation

The patent application of the invention is a divisional application with the application number of 202010956915.5, the application date of 2020, 9 and 12 days and the invention name of SNP mark of blood-related penetration site of western pig in Chinese local pig related to body length.

Technical Field

The invention relates to the technical field of pig Marker Assisted Selection (MAS), in particular to application of an rs81439242 SNP molecular marker in breeding of a live pig strain with a body length correlation.

Background

China is one of the earliest domestication sites of pigs worldwide. The climate is various and the topography is complex in all regions of the country, a large number of excellent local pig breeds are formed, and 1/3 of local pig breeds in the world come out of China. The local pig species in China are well known for delicious meat quality, good maternal performance, coarse feeding resistance and strong disease resistance, but the defects of backfat thickness and low lean meat percentage are common. The related data show that 90 local varieties exist in China at present, wherein the number of the national grade protection varieties is 42, the number of the provincial grade protection varieties is 32, and the number of other varieties is 15. These local pig species are listed in the national livestock and poultry genetic resource protection directory. According to characteristics of pig breeds and climate and geographic position of a primordial region, local pig breeds in China are divided into six types: north China, river sea, middle China, southwest, plateau, south China.

Currently, the main commercial swine in the global live pig market are Duroc, changbai, dabai, barkshire, pittand, han Pusha swine, commonly known as western commercial swine, which are classified as lean, fat, and dual purpose. Compared with the Chinese local pig species, the Western commercial pig species have the characteristics of high growth speed, strong fertility, high lean meat percentage, high physique, long body trunk and the like; wherein, the Duroc pigs in the United states have the characteristics of high growth speed, high efficiency, high feed conversion rate, thin backfat and the like; british long white pigs and large white pigs are known for excellent reproductive performance; the lean meat percentage of the Pitch pig in Belgium is extremely high; the Barkhausen in the United kingdom has excellent meat quality and excellent reproductive performance; the body of the Han general summer pig in the United kingdom is long, the backfat is thin, and the eye muscle area is large.

The pigs in the world are mainly domesticated by the boars of European continents and the boars of Asian continents respectively and independently, but historically, multiple blood-source communication is carried out between the pig breeds in the middle and the west. It is well documented that, as early as the open world, guangzhou is open to the open market, and that south China pigs were in the ocean to Europe, affecting the genome of European pig breeds. In 1979, pigs such as Meishan pigs, maple pigs, jiaxing pigs and Jinhua pigs were introduced in France; civilian pigs, meishan pigs and further Fengjing pigs were introduced in the United states in 1989; to date, genomic analysis has shown that the blood source of Chinese local pig breeds is also mixed in large white pigs and long white pigs. Meanwhile, the Western pig breeds are formally introduced in China at the beginning of the nineteenth century; after 1949, su Dabai, barker summer, changbai, dabai, duroc, han Puxia and the like are introduced into China in a large quantity, and a foreign trade pig farm is specially built for the purpose. Along with the transformation of the consumption habit of residents in China to lean pork, a large number of Chinese local pigs and western pig breeds are subjected to cross breeding.

Infiltration of the pig's blood margin affects the performance of local pigs in China. Therefore, by detecting the infiltration signal of western pigs to local pig species in China and analyzing the phenotype influenced by the infiltration signal, relevant molecular markers are developed and screened, and the economic character of the population is improved by improving the genotype of the infiltration site markers. In the method, the body length is a quantitative character, and is closely related to important economic characters such as slaughter rate, meat yield and the like. Compared with western pig breeds, the body length of the Chinese local pigs is not dominant, and is generally relatively short and small. At present, a good breeding effect is difficult to obtain by utilizing a conventional breeding means.

Disclosure of Invention

The invention aims to apply the rs81439242 SNP molecular marker to the breeding of live pig strains with related body length, such as the genotype identification, genetic breeding and the like, so as to solve the problems that the body length of pigs in China is not dominant and is generally relatively short.

In order to solve the technical problems, the invention adopts the following technical scheme:

studies confirm that western pig blood-source penetration site SNP markers related to body length in a group of Chinese local pigs:

located in the international swine genome version 11.1 reference sequence swine chromosome 12:

the first SNP marker, the point mutation of the base from A to G at the 2096738 th site and the complementary mutation thereof from T to C (corresponding to the 539 th bp in the sequence shown in SEQ ID: 1) are marked as a mutation site rs81439116;

a second SNP marker, wherein the point mutation of the 2129234 th base from C to T and the complementary mutation thereof are from G to A (corresponding to 598bp in the sequence shown in SEQ ID: 2), is marked as a mutation site rs81439242;

the third SNP marker, the point mutation of the 2145858 th base from T to C and the complementary mutation thereof, from A to G (corresponding to 453 st bp in the sequence shown in SEQ ID: 3), is denoted as mutation site rs81439307.

Primers for detecting the above SNP markers were designed:

(1) Primer pair for detecting the first SNP marker:

an upstream primer: ggagacccacctgtgaaacc the number of the individual pieces of the plastic,

a downstream primer: gacgagactggaactacgagca;

(2) Primer pairs for detecting the second SNP marker:

an upstream primer: taccgttgtcagcgatggag the number of the individual pieces of the plastic,

a downstream primer: ttgagcagcgtaggacttca;

(3) Primer pair for detecting the third SNP marker:

an upstream primer: tctgacctgacctctgggaact the number of the individual pieces of the plastic,

a downstream primer: cgtgacctcgtcggtaagtg.

A kit for detecting the SNP marker comprises at least one of the primer pairs.

The primer or the kit is applied to screening live pig strains with related body length.

A molecular marker is developed, a nucleotide sequence containing the SNP marker is taken as a basic sequence, a primer pair is designed, and DNA sequences obtained by PCR amplification are taken as templates of Chinese local pig, western pig and Chinese and western hybrid pig.

PCR amplification was performed with the above primers, respectively, to obtain the following molecular marker sequences:

as set forth in SEQ ID:1, wherein the first SNP marker site is located at the 539 th position of the sequence, and wherein an A/G polymorphism exists at the site;

as set forth in SEQ ID:2, wherein the second SNP marker site is located at the 598 th position of the sequence, and a C/T polymorphism exists at the site;

as set forth in SEQ ID:3, wherein the third SNP marker site is located at 453 of the sequence, and a T/C polymorphism exists at the site;

and the body length of the AA, CC and TT genotype individuals is obviously longer than that of the GG, TT and CC genotype individuals respectively.

A method for detecting SNP loci related to body length characters is designed, comprising the following steps:

(1) Taking a tissue sample of a live pig and extracting genome DNA;

(2) Carrying out PCR amplification by using the corresponding primers by taking live pig genome DNA as a template;

(3) Sequencing the amplified products, looking at SEQ ID NO:1 at position 539, interpreting the A/G polymorphism at the site; SEQ ID NO:2, 598, interpreting the C/T polymorphism at the site; SEQ ID NO:3 at position 453, the T/C polymorphism at that position is interpreted.

The application of the molecular marker in screening live pig strains related to body length; the method is particularly applied to screening of high-body long pig strains, and comprises the following steps:

(1) Detecting genotypes of mutation sites rs81439116, rs81439242 or/and rs81439307 in the genome of the to-be-selected live pig;

(2) And breeding an rs81439116 nucleotide site AA genotype individual, an rs81439242 nucleotide site CC genotype individual or/and an rs81439307 nucleotide site TT genotype individual as a breeding pig.

Compared with the prior art, the invention has the main beneficial technical effects that:

the invention confirms that the rs81439242 SNP marker is obviously related to the body length of the live pig, and the molecular marker and the primer developed based on the SNP can be used for detecting the SNP; therefore, the SNP marker can be identified to screen the live pig strain with longer body length, and the obtained live pig strain with longer body length has important economic benefit and social value.

The rs81439242 SNP molecular marker is successfully applied to selective breeding of live pig strains, so that the breeding speed is more effectively increased, and the breeding accuracy is improved.

Drawings

FIG. 1 is an Fst graph of the infiltration signal sites between Chinese and western pig species and an evolutionary tree graph of the homozygous section where the infiltration signal sites are located, and allele frequency distribution diagrams of the infiltration signal sites in the Chinese and western pig species, wherein the most obvious sites are the locus rs81439116, locus rs81439242 and locus rs81439307 of chromosome 12.

Fig. 2 is an enlarged view of the portion b in fig. 1.

FIG. 3 is a gel electrophoresis chart of PCR amplification of chromosome 12 at position rs81439116, position rs81439242 and position rs81439307.

FIG. 4 is an example of a sequencing typing map of chromosome 12 at position rs81439116, position rs81439242, and position rs81439307.

FIG. 5 is the effect of chromosome 12 at position rs81439116, position rs81439242 and position rs81439307 on the body length of Sujiang pigs (distribution diagram corresponding to genotype and body length).

Detailed Description

The following examples are given to illustrate the invention in detail, but are not intended to limit the scope of the invention in any way.

The instruments and devices referred to in the following examples are conventional instruments and devices unless otherwise specified; the related reagents and raw materials are all conventional products sold in the market unless specified; the test methods are conventional, unless otherwise specified.

Embodiment one: acquisition of SNP markers

ADMIXTURE population genetic structural analysis was performed using SNP chip scan data of 929 first 40 Chinese local pigs and 165 first 6 western pigs (878 individuals from a download of public database and 216 individuals detected by the inventors of the present application); the results showed that 8 of these swine breeds were representative of chinese local swine breeds: including the two-flowered pigs and the Meishan pigs representing the river sea, the land Sichuan pigs and the Wuzhishan pigs representing the south China, the Ganxi two-head black pigs and the sand-ridge pigs representing the China, and the Neijiang pigs and the Lankang pigs representing the southwest, while the Xiyan black pigs are traditionally divided into the Chinese pig species, but are greatly affected by the infiltration of blood edges of the western pig species.

Therefore, in order to obtain the blood-margin infiltration signals of the western pig breeds to the middle local pig breeds, the SNP chip scanning data of the 8 Chinese representative pig breeds and the mountain-confirmed black pigs are utilized to calculate the Fst value between the two pig breeds, and the first 1% is taken as a threshold line; and simultaneously, carrying out selection signal analysis inside the black pig group in the definite mountain. Taking the obvious SNP locus shared between the two results as candidate infiltration loci, obtaining 3 SNP loci in total, wherein the 3 SNP loci are located in rs81439116, rs81439242 and rs81439307 (see FIG. 1a and FIG. 1 b) of chromosome 12. Genotyping showed that these 3 SNP sites were almost all homozygous (AA, TT and TT) in 139 individuals of these 8 chinese local swine, whereas different (AG, CT, TC) individuals were found in 165 western swine (see fig. 1 c).

Embodiment two: cloning and genotyping of SNP markers

1. Test animal origin

Pig farm of some Sujiang ginger in Jiangsu province: the tested pig species is Su ginger pig, which is a lean type black stock line variety cultivated by Chinese local pig species ginger Qu Hai and western pig species Duroc pig species by a transverse fixation and subculture breeding method. The Sujiang pig has the advantages of high growth speed of western pig species and high carcass lean meat percentage, and has the characteristics of high fertility and excellent meat quality of Chinese local pigs. Thus, the Sujiang pigs are suitable for assessing the effects of gene communication between Chinese and Western pig breeds.

2. Extracting pig genome DNA of Sujiang

Collecting 365-head Su ginger pig tissue samples, and extracting DNA; porcine ear tissue DNA was extracted using TIANGEN TIANamp Genomic DNA Kit (DP 304-03) and the following procedures were performed according to the instructions:

(1) 68mL of absolute ethyl alcohol and 200mL of absolute ethyl alcohol are respectively added into the buffer solution GD and the rinsing solution PW, and the mixture is fully and uniformly mixed.

(2) About 10-20mg of the tissue sample was collected in a 2mL EP tube, and after complete shearing, 200uL of buffer GA was added and shaken until thoroughly suspended.

(3) Adding 20 mu L of proteinase K solution, mixing, placing in a 56 ℃ water bath kettle for 2-3h until the ear-like tissue is dissolved, and centrifuging briefly to remove water drops on the inner wall of the tube cover.

(4) 200uL of buffer solution GB is added, fully and reversely mixed, water bath is carried out for 10min at 70 ℃, the solution is clear, and the solution is centrifuged briefly to remove water drops on the inner wall of the tube cover.

(5) Adding 200uL absolute ethyl alcohol, fully shaking and uniformly mixing for 15s, wherein flocculent precipitation possibly occurs at the moment, and centrifuging briefly to remove water drops on the inner wall of the tube cover.

(6) The solution obtained in the previous step and the flocculent precipitate were both put into an adsorption column CB3, the adsorption column was placed into a collection tube, and then centrifuged at 12,000rpm for 30 seconds, the waste liquid was discarded, and the adsorption column CB3 was put back into the collection tube.

(7) 500uL of buffer solution GD was added to the adsorption column CB3, centrifuged at 12,000rpm for 30s, and the waste liquid was poured off to place the adsorption column CB3 into a collection tube.

(8) 600uL of the rinse PW was added to the column CB3, centrifuged at 12,000rpm for 30 seconds, the waste liquid was poured off, and the column CB3 was placed in a collection tube.

(9) Repeating the operation step (8).

The adsorption column CB3 was returned to the collection tube and centrifuged at 12,000rpm for 2 minutes to discard the waste liquid. The adsorption column CB3 was left at room temperature for several minutes to thoroughly dry the residual rinse solution in the adsorption material.

⑪ transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 50-200uL of elution buffer TE into the middle part of the adsorption film, standing for 2-5min at room temperature, centrifuging at 12,000rpm for 2min, and collecting the solution into the centrifuge tube.

⑫ after quality and concentration are detected by a Nanodrop-100 spectrophotometer, the quality is checked to be qualified, and the concentration is diluted to 20ng/uL and stored at the temperature of minus 20 ℃ for standby.

3. PCR amplification and sequencing typing of fragments of interest

PCR amplification was performed using the extracted DNA as a template according to the designed primers (SEQ ID:4 to SEQ ID: 9):

(1) PCR amplification system: 10. mu.l reaction system comprising 2 XEs Taq Master mix (Dye) 5. Mu.l (century well), primer SEQ ID NO:4 to 5. Mu.l (10 pmol/. Mu.l) each, 0.5. Mu.l (20 ng/. Mu.l) of DNA and double distilled water was added to 10. Mu.l. PCR amplification conditions: 94 ℃ for 5 min;94℃30s, 70℃30s, 72℃50s,30 cycles; storing at 72deg.C for 10min and 4deg.C.

(2) PCR amplification system: 10. mu.l reaction system comprising 2 XEs Taq Master mix (Dye) 5. Mu.l (century well), primer SEQ ID NO:6 to 7. Mu.l (10 pmol/. Mu.l) each, 0.5. Mu.l (20 ng/. Mu.l) of DNA, and double distilled water was added to 10. Mu.l.

PCR amplification conditions: 94 ℃ for 5 min;94℃30s, 66.6℃30s, 72℃50s,30 cycles; 72 ℃ for 10min; preserving at 4 ℃.

(3) PCR amplification system: 10. mu.l reaction system comprising 2 XEs Taq Master mix (Dye) 5. Mu.l (century well), primer SEQ ID NO:8 to 9. Mu.l (10 pmol/. Mu.l) each, 0.5. Mu.l DNA (20 ng/. Mu.l) and double distilled water was added to 10. Mu.l; PCR amplification conditions: 94 ℃ for 5 min; 30 cycles at 94℃30s, 68℃30s, 72℃50s, 30; 72 ℃ for 10min; preserving at 4 ℃.

And (5) after the PCR amplification product is qualified through 1.2% gel electrophoresis detection, sending the PCR amplification product to a sequencing company for sequencing.

The sizes of the amplified target fragments are 829bp, 522 bp and 812bp respectively through detection, and an electrophoresis chart is shown in figure 3.

The genotypes of the rs81439116 site, the rs81439242 site and the rs81439307 site in the sequencing result are respectively read, the sequencing peak diagram is shown in fig. 4, and the sequencing peak diagrams of 3 genotype representative individuals of the 3 sites are respectively shown in fig. 4, and are shown in the following figures: the sequencing result of the individual with 3 genotypes at the locus rs81439116 is AA, AG and GG from top to bottom (figure 4 a); sequencing results of individuals with 3 genotypes at the locus rs81439242 are CC, CT and TT in sequence from top to bottom (figure 4 b); the sequencing results of individuals with 3 genotypes at the locus rs81439307 are TT, TC and CC in sequence from top to bottom (figure 4 c).

4. Correlation analysis

By using analysis of variance, the relation between genotype and body length of the loci was analyzed, and correlation analysis of genotype and body length was performed in the hybrid of the local pig breed and the western pig breed in China, namely Sujiang pig, the 3 western pig breeds obtained in example I, the Sujiang pig was bred in the nursery of Jiangsu farmer science and technology, genotype and body length data were provided for this field, and the research results showed that the 3 loci were significantly correlated with the body length of Sujiang pigs (p=0.04), see fig. 5.

As shown in FIG. 5, the rs81439116 site, the rs81439242 site, the rs81439307 site and the body length are all extremely obviously related (P=0.04, P < 0.01), and the AA type individual at the rs81439116 site, the CC type individual at the rs81439242 site and the TT type individual at the rs81439307 site can be bred to gradually increase the body length, so that the aim of improving the body length performance of the Sujiang pig is fulfilled.

The invention has been described in detail with reference to the examples; however, it will be understood by those skilled in the art that various specific parameters in the above embodiments may be changed or equivalents of related methods or steps may be substituted, so as to form a plurality of specific embodiments, which are common variations of the present invention and are not repeated herein, without departing from the spirit of the present invention.

Sequence listing

<110> Henan agricultural university

Jiangsu Agri-animal Husbandry Vocational College

Application of <120>rs81439242 SNP molecular marker in breeding of live pig strain related to body length

<210>1

<211> 829

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ggagacccac ctgtgaaacc agcaaggcct ggtcgcccat ccccagcctg ttctggatgt 60

agtcattcaa gggcatgttc ggatccccgc cagccgtgct cagaaacccc aaggcgacct 120

cgatggcaga cagagcctca caggcgtcgc tgtaggactg cagctgtcct ctgatggcgc 180

cgatgaccga gttggggagg gggtgctagg aaatcaaagg caggagcggg tccgtggcgg 240

gtcgctgcct gataagcgtg cttaccttct ccacggccaa ggccccgggt gggacggact 300

ctgatagcag cagcagcgga caccccgagc ttgctcaggg ccagcgccgt tcagggactt 360

tacagaaagt gagatgaagt ggctgactcc tcagaacatc tcggtgaggg cgtgtgcacg 420

gacacgcata cgtgcacacc acagacacat cacacgtgcg cacaccccaa gcacaacaca 480

cgtaactcac aaaagcagga ctaaacgagc tctccgggct ttctgaccag cccacagaat 540

cctgccatca tcgctaagca cccactgccc gagtcccctc tgctgatcct caacaggaaa 600

acgcctgctg acctgccgtc ccgcccgccc tctggaaaga gccctgggct cggggaccgg 660

ggggaggccc cgaaacgccg ctgctcacag caaatgctgg agcagctggg acagtcctga 720

cacgggaacc ctcggacagg acgggcgcgt gtgctcgtga gaagacagat cacctggggc 780

atcttgttcc tgatttccat gaagagatgc tcgtagttcc agtctcgtc 829

<210> 2

<211> 1102

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

taccgttgtc agcgatggag gcgcttctgc ggaaaaccag ctttgccaca tggacaagta 60

gagacggtaa aactgtttag gcttcgctga tgactactga ggctgagcct ttttccccgt 120

gttttctgga atctgtataa ttatcctgtt aacagttagt atttaacttt cattcatttt 180

taaaacttag gggatttact tgattcctaa gaatcctttt tttttttaat taacccttaa 240

tcatgcgatt gtatgttctc ctcaaatctg tcagtttcct tttttacaca ctgaaagttg 300

aaatcttcaa tcttcccact gaaatttcaa ttattgctgc ggtccgttaa atatttagct 360

aaaacattta agaaggggtc acgggaaaat cagaggtggg cttctcgtta ataaaggctc 420

cgtgtttttc ggggggctgg gcagtggctt gagcgtccag ctctgagggt ccccgggggg 480

catttcctca cgccccgtcc tctgagccca cattccgttc caacatcaca gctctggaag 540

ctgaggaaga gctcccacgc tggcatcctg tggatgtcgc accagctcgc ggggccccca 600

tgccaggacc tacctctaac tcctcctggg tggacactct ggtggtcagc agaaggaaat 660

cccgcaggta gccctgaaga aggtcctgcc tctggtgggc agagagctga gcaagaaacc 720

tgcccagcgg cgtctgacga aagagctcca ccaacttctc agccgggcct gcagggaggg 780

gatgagggga ggggacagag aggggcttgg gatgagcgcg gcgaccctgc ctgccttcca 840

cgcggaaggc aggaacgagg ccagggttct gagaaggctg cctcggggtc attgctgtgt 900

catcgtctct ggacactaat tctcccagcg ggagagcagg aacaaaggca gaaggggtgt 960

ccattcagcc tcgacagccc accagcccca gagaaaacac agactaggac agagcaagtt 1020

catgtcaacc aagccatcag gcgcctggga gccaggaccc aagcgggccg ccttccaggg 1080

gctgaagtcc tacgctgctc aa 1102

<210>3

<211> 812

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tctgacctga cctctgggaa ctagaattct cccttgtgtg tgtgtgtgtg tgtgtgtgag 60

agagagagag agagcgagag cataaaaccc ccttttgata acaaactgct ataaccaaag 120

cctcctcccc aagttagcgc cattaagaaa gacggtgctt caggcaggta cgctttctgc 180

attccgagca ccacgggcat ttaacctgga cccacagcat ccatcccaaa gggaacaaaa 240

ccaatttaag acaccgttaa tgaacaaaag agcgttttta tgccaggcat tattccaaaa 300

taaacttaaa gactgttttt tccttactaa cacggaactc agctactctg cagagacaca 360

gcggggaatc acagaagcat ctcgaagccc gcccccccgc ccacacacag tggcatcaaa 420

gtgccctgac acacaccagc ttcgagggcc tctgaggcag ggcggaactc ctttccagga 480

tttcaacgac atataaatgg cacgggttcc gaagccacat cttcccattt atgtccatta 540

agtactgaag aatgaggagt ttgaaaagaa acatcccaac tccagtccgt acctaaagac 600

acaatcacgc gggtgtgtaa acacacggaa ggcggcagct ctcccaaccc gaaggctctc 660

ttattcggct ttttggtatg atgaaaaagc atcactacgt gtagaaaaaa gaaagtcttt 720

atactgggag ggggcagggc cggaggtggc agcgaggcct tccgactcag ccactcagct 780

ggaggccgag ggcacttacc gacgaggtca cg 812

<210>4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ggagacccac ctgtgaaacc 20

<210>5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gacgagactg gaactacgag ca 21

<210>6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

taccgttgtc agcgatggag 20

<210>7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ttgagcagcg taggacttca 20

<210>8

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tctgacctga cctctgggaa ct 22

<210>9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

cgtgacctcg tcggtaagtg

Claims

Application of the rs81439242 SNP molecular marker in breeding of live pig strains with body length correlation.
2. The application of the primer or the kit for detecting the rs81439242 SNP molecular marker in screening live pig strains with related body length.
3. The use according to claim 2, wherein the primer or kit comprises the following primer pairs:

an upstream primer: taccgttgtcagcgatggag the number of the individual pieces of the plastic,

a downstream primer: ttgagcagcgtaggacttca.
4. The application of the following molecular markers in screening live pig strains related to body length:

designing a primer pair by taking a nucleotide sequence containing an rs81439242 mutation site as a basic sequence, and carrying out PCR amplification by taking DNA of local pig species in China, pig species in western region and hybrid pig species in Chinese and western region as templates to obtain a DNA sequence; the DNA sequence is shown in SEQ ID NO:2, the rs81439242 SNP marker point is positioned at 598 th site of the sequence, and the C/T polymorphism exists at the point.
5. A method of screening a high quality growing pig line comprising the steps of:

(1) Detecting the genotype of a mutation site rs81439242 in the genome of a to-be-selected live pig;

(2) And (5) breeding individuals with the rs81439242 nucleotide locus CC genotype as breeding pigs.
6. A method of screening a high quality growing pig line comprising the steps of:

(1) Detecting genotypes of mutation sites rs81439242 and rs81439307 in the genome of the to-be-selected live pig;

(2) And breeding individuals with the CC genotype at the rs81439242 nucleotide locus and individuals with the TT genotype at the rs81439307 nucleotide locus as breeding pigs.