CN103421766B - Method for extracting anti-oxidant anti-tumor Latcripin-3 gene segment from mushroom C91-3 strain - Google Patents
Method for extracting anti-oxidant anti-tumor Latcripin-3 gene segment from mushroom C91-3 strain Download PDFInfo
- Publication number
- CN103421766B CN103421766B CN201310337850.6A CN201310337850A CN103421766B CN 103421766 B CN103421766 B CN 103421766B CN 201310337850 A CN201310337850 A CN 201310337850A CN 103421766 B CN103421766 B CN 103421766B
- Authority
- CN
- China
- Prior art keywords
- mushroom
- latcripin
- strain
- pcr
- extracting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a method for extracting an anti-oxidant anti-tumor Latcripin-3 gene segment from a mushroom C91-3 strain. The method is implemented sequentially according to the following steps: extracting mycelium total RNA from the mushroom C91-3 strain; inversely transcripting the mycelium total RNA to synthesize cDNA; taking the obtained cDNA as a template and performing polymerase chain reaction (PCR) on PCR reaction primers which are inserted into two limited incision enzyme sites BamHI and XhoI, wherein the upstream primer BamHI is (5'-3')GGCTGATATCGGATCCCTTGCCCAAGATCTTACCG and the downstream primer XhoI is (5'-3')GGTGGTGGTGCTCGAGGTCGGGGCAGTGAGGAATT; and performing 1% agarose gel electrophoresis on the obtained PCR product, purifying a remarkable stripe near 750 bpMarker, cutting colloid and recovering the DNA segment.
Description
Technical field
The present invention relates to a kind of preparation method of anti-oxidant, anti-tumor protein Structure and function domain, especially a kind of extract from mushroom C91-3 bacterial strain anti-oxidant, antitumor
latcripinthe method of-3 gene fragments.
Background technology
Fungi is rich in multiple bioactive molecules, comprises ribosome inactivating protein, antifungal protein, lectin, ubiquitin-like protein, polysaccharide and kinases.The advantages such as antineoplastic component is wherein few with untoward reaction, evident in efficacy have distinctive feature in oncotherapy.It is Basidiomycotina Basidiomycetes Pleurotaceae that Lentinus Edodes fungus C91-3 belongs to fungi, and this bacterial classification was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center in 2013, and preserving number is CGMCC No.7354.Lentinus Edodes fungus C91-3 contains invigorating the spleen and benefiting QI, strengthening vital QI to eliminate pathogenic factors, enhancing body immunizing power, the effects such as anti-curing cancers.[Zhao C,Sun H,Tong X,et a1.An Antitumor leetin from edible Mushroon Agroebe aegerita[J].Bioehem J,2003,374:321—327]。Containing multiple protein composition in Lentinus Edodes fungus C91-3 fermented liquid, confirm that some protein ingredient has good antitumor action [Huang Min by animal experiment in vivo, Ning'an is red, Zhang Zhuoran etc. the research [J] of mushroom C91-3 hypha fermentation liquid mouse Anticancer effect in vivo. Chinese microecology magazine, 1996,8 (3): 38-40].Experiment in vitro also confirms, some protein ingredients in its fermented liquid have inducing apoptosis of tumour cell ability [wear soldier, Huang Min, Ning'an is red. mushroom C91-3 hypha fermentation liquid eggs suppresses mouse cervix JEG-3 U14 to grow and apoptosis-induced experimental study in vain. Zhejiang Medical, 2004,26(9); 656-658].But, up to now also not about extract from mushroom C91-3 bacterium expressed albumen have antioxidase to antioxidant radical, can the gene fragment relevant report of inducing apoptosis of tumour cell.
Summary of the invention
The present invention is the above-mentioned technical problem in order to solve existing for prior art, provides one to extract from mushroom C91-3 bacterial strain anti-oxidant, antitumor
latcripinthe method of-3 gene fragments.
Technical solution of the present invention is that one is extracted anti-oxidant, antitumor from mushroom C91-3 bacterial strain
latcripinthe method of-3 gene fragments, is characterized in that carrying out as follows successively:
A. the mycelium total serum IgE of mushroom C91-3 bacterial strain is extracted;
B. by mycelium total serum IgE reverse transcription synthesis cDNA;
C. pcr amplification target gene:
With obtained cDNA for template, react primer with the PCR inserting BamH I and Xho I two restriction endonuclease sites and carry out PCR reaction; It is as follows that described PCR reacts primer sequence:
Upstream primer BamH I:
( 5′-3′)GGCTGATATCG
GATCCCTTGCCCAAGATCTTACCG
Downstream primer Xho I:
( 5′-3′)GGTGGTGGTGC
TCGAGGTCGGGGCAGTGAGGAATT;
D. purifying DNA fragment is reclaimed:
Obtained PCR primer is carried out 1% agarose gel electrophoresis, bright near purifying 750 bpMarker
Aobvious band, cuts glue and reclaims DNA fragmentation.
Described a step gets the mycelium of the cultivation mushroom C91-3 bacterial strain of 18 days, adds liquid nitrogen and fully grind in mortar, and room temperature places 5min, then adds chloroform, after gentle concussion, and 4 C, 12000r/min is centrifugal, 15min; Draw upper strata aqueous phase solution and be transferred in another centrifuge tube, add equal-volume Virahol, the static 15min of room temperature after mixing, 4 C again, 12000r/min is centrifugal, 10min, abandon supernatant, then add 75% washing with alcohol and drying, finally by DEPC process water dissolution, obtain the mycelium total serum IgE of mushroom C91-3 bacterial strain.
The PCR reaction system 50 ul:Premix Taq 25 μ l of described step c, cDNA template 2 μ l, upstream primer 1 μ l, downstream primer 1 μ l, sterile purified water 21 μ l; Reaction conditions: 95 DEG C of denaturation 6min; 94 DEG C of sex change 30s, 55 DEG C of renaturation 45s, 72 DEG C extend 45s, 30 circulations; 72 DEG C extend 10min; 4 DEG C of cooling 10min.
The present invention is from mushroom C91-3 mycelium transcript profile, clones one section of specific gene fragment, called after
latcripin-3 gene fragments, the albumen expressed by this gene fragment has the antioxidase to antioxidant radical, the various biological functions such as inducing apoptosis of tumour cell.This gene fragment can be carried out gene recombination, and efficient solubility expression is carried out in pET32-a prokaryotic expression system, expression product is carried out isolation andpurification by affinity chromatography, obtain the protein of this genes encoding, this albumen can be used for the mechanism in apoptosis of studying and the effect in cell-signaling pathways thereof, also can be used for the medicine preparing prevention or treatment tumour.
Accompanying drawing explanation
Fig. 1 is the mycelium total serum IgE 1.0% agarose gel electrophoresis figure of the mushroom C91-3 bacterial strain that the embodiment of the present invention is extracted.
Fig. 2 is that embodiment of the present invention PCR primer is through 1% agarose gel electrophoresis figure.
Fig. 3 is that the expressive host bacterium of embodiment of the present invention recombinant expression plasmid is through 1% agarose gel electrophoresis figure.
Fig. 4 is the solubility expression 1% agarose gel electrophoresis figure of embodiment of the present invention target protein.
Fig. 5 is that embodiment of the present invention target protein Western-blotting identifies colouring reagents box colour developing schematic diagram.
Fig. 6 is the target protein 12%SDS-PAGE electrophorogram after embodiment of the present invention purifying.
Fig. 7 is the SRB experimental result schematic diagram of the target protein target protein after embodiment of the present invention purifying.
Mushroom C91-3 bacterial strain preservation date: on March 15th, 2013;
Classification And Nomenclature: mushroom (
lentinula edodes);
Depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC);
Depositary institution address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
Preserving number: CGMCC No.7354.
Embodiment
A. the mycelium total serum IgE of mushroom C91-3 bacterial strain is extracted:
Take the mycelium of the culture medium culturing mushroom C91-3 bacterial strain of 18 days, add liquid nitrogen and fully grind in mortar, room temperature places 5min, then adds 0.2ml chloroform, after gentle concussion, and 4 C, 12000r/min is centrifugal, 15min; Draw upper strata aqueous phase solution 0.5ml and be transferred to another clean 1.5ml centrifuge tube, add equal-volume Virahol, put upside down the rear static 15min of room temperature of mixing, 4 C again, 12000r/min is centrifugal, 10min, abandon supernatant, then add 75% ethanol 1ml to wash and drying, finally by DEPC process water dissolution, the mycelium total serum IgE of mushroom C91-3 bacterial strain;
Ultraviolet spectrophotometer checking purity, OD260/280 ratio is between 1.8 ~ 2.0.
Carry out 1.0% agarose gel electrophoresis checking, result as shown in Figure 1, shows that RNA DNA purity is higher.
B. by mycelium total serum IgE reverse transcription synthesis CDNA;
Use TaKaRa 3 '-Full RACE Core Set Ver.2.0 test kit reverse transcription synthesis cDNA, this test kit is purchased from precious biotechnology (Dalian) company limited
Reaction system: shiitake mushroom hypha total serum IgE (1 ug/ul) 1 ul, 3 ' RACE Adaptor (5 uM) 1 ul, dNTP Mixture (10 mM each) 1 ul, RNase Free dH2O 4.5 ul;
Reaction conditions: 70 DEG C, 10 min place 2 minutes immediately on ice;
Then following component is added: 5 × M-MLV Buffer 2 ul, RNase Inhibitor (40 U/ul) 0.25 ul, Reverse Transcriptase M-MLV (RNase H-) (200 U/ ul) 0.25 ul, system cumulative volume reaches 10 ul.
Reaction conditions: 42 DEG C, 60 min 70 DEG C, 15 min obtain inverse transcription reaction liquid (cDNA).
C. pcr amplification target gene;
With obtained cDNA for template, react primer with the PCR inserting BamH I and Xho I two restriction endonuclease sites and carry out PCR reaction; It is as follows that described PCR reacts primer sequence:
Upstream primer BamH I:
( 5′-3′)GGCTGATATCG
GATCCCTTGCCCAAGATCTTACCG
Downstream primer Xho I:
( 5′-3′)GGTGGTGGTGC
TCGAGGTCGGGGCAGTGAGGAATT;
Primer entrusts the synthesis of precious biological (Dalian) company.
PCR reaction system 50 ul:Premix Taq 25 ul, cDNA template 2 μ l, upstream primer 1 ul, downstream primer 1 ul, sterile purified water 21 ul.Reaction conditions: 95 DEG C of denaturation 6min; 94 DEG C of sex change 30 s, 55 DEG C of renaturation 45 s, 72 DEG C extend 45 s, 30 circulations; 72 DEG C extend 10min; 4 DEG C of cooling 10min.PCR product through 1% agarose gel electrophoresis as shown in Figure 2, proves this gene fragment of successful clone.
D. purifying DNA fragment is reclaimed;
Obtained PCR primer is carried out 1% agarose gel electrophoresis, bright near purifying 750 bpMarker
Aobvious band, cuts glue and reclaims DNA fragmentation, and name life is
latcripin-3 gene fragments.
Experiment:
1. Latcripin-3 gene fragment order measures: the Latcripin-3 gene fragment that embodiment reclaims be connected with pMD19-T cloning vector, construction recombination plasmid pMD19T-Latcripin-3, transform competent E. coli JM109.Recombinant vectors order-checking is measured by the precious biotech firm in Dalian, and mushroom C91-3 Latcripin3 nucleotide sequencing is as SEQ ID NO.3.
2. the clonal expression of Latcripin-3 gene fragment
The structure of 2.1 Latcripin-3 gene fragment recombinant expression plasmids: with the double digested pET32a (+) of BamH I and Xho I, 1.0% agarose gel electrophoresis is selected to be separated, purified linear pET32a (+) carrier segments is reclaimed with DNA gel extraction, connect the Latcripin3 gene fragment of pET32a (+) carrier segments and embodiment of the present invention acquisition with T4DNA ligase enzyme, then obtain recombinant expression plasmid pET32a (+)-Latcripin3 gene fragment.Recombinant expression plasmid transformation of E. coli JM109, is spread evenly across on the LB flat board of Pyocianil by converted product, cultivate 14 hours in 37 DEG C.The positive bacterium colony of picking mono-clonal, be inoculated in 3ml respectively containing in the LB liquid nutrient medium of Pyocianil, at 37 DEG C, 190 rpm/min shaking culture are spent the night; With Plasmid Miniprep Kit V3.l extracting plasmid, and carry out nucleic acid sequencing qualification.Nucleic acid sequencing qualification result shows that sequence is consistent with Latcripin-3 gene fragment order.
The expressive host bacterium of 2.2 recombinant expression plasmids transforms selects freeze-thaw method, recombinant expression plasmid pET32a (+)-Latcripin3 gene fragment is proceeded in expressive host bacterium intestinal bacteria Rosetta-gami (DE3) competent cell, coat on the LB flat board containing four kinds of microbiotic (Pyocianil, tsiklomitsin, paraxin, kantlex), 37 DEG C of incubated overnight.The positive bacterium colony of mono-clonal choosing grow on plates is inoculated in containing four kinds of microbiotic (Pyocianils, tsiklomitsin, paraxin, kantlex) LB liquid culture based on 37 DEG C cultivate 14 hours, preserve bacterial strain, adopt precious biotech firm Plasmid Miniprep Kit V3.l extracting plasmid simultaneously, after BamH I and Xho I is double digested, carry out 1.0% agarose gel electrophoresis detection validation, 1.0% agarose gel electrophoresis result as shown in Figure 3, in Fig. 3,1 is empty pET32a (+) double digestion, 2 is pET32a (+)-Latcripin3 double digestion, show object pET32a (+)-Latcripin3 gene fragment successful conversion in the bacterial strain of Rosetta-gami (DE3).
The solubility expression of 2.3Latcripin3 albumen
The TB that the bacterial strain that 2.2 steps are preserved is inoculated in containing four kinds of microbiotic (Pyocianil, tsiklomitsin, paraxin, kantlex are high density) in 1:100 ratio is supported in base, wherein contain the glucose of 1%, at 37 DEG C, 190 rpm/min shaking culture 5 hours, treat bacterial concentration OD
600when=0.8, add IPTG and make its solution final concentration be 1mmol/L, 16 DEG C of inductions of spending the night, morning 4 DEG C next day, 8000r/min, within 10 minutes, reclaim bacterium.With PBS, bacterium is washed 3 times, resuspended with appropriate PBS, add PMSF trash ice and hatch ultrasonic degradation, low temperature (4 DEG C) centrifugal 10000rpm/min, 5min, does 12%SDS-PAGE electrophoresis detection (as Fig. 4) by supernatant protein, in Fig. 4,1 is Latcripin-3 target protein, 2 is pET-32a empty carrier expressing protein, tentatively shows that Latcripin3 target protein has expression.
2.4 target protein Western-blotting identification and analysis
2.3 step gained soluble proteins samples are carried out Western blot qualification, be transferred on NC film by the mode of wet transferring film, after 5% skimmed milk room temperature confining liquid closes 120 minutes, first anti-Mouse Anti-His Tag Monoclonal Antibody, 4 DEG C of overnight incubation, add the second anti-horseradish enzyme labelling goat anti-mouse IgG (H+L) incubated at room again 90 minutes, colouring reagents box colour developing (as Fig. 5), shows Latcripin3 target protein successful expression.
The purifying of 2.5 target proteins
Above-mentioned 2.4 step gained soluble proteins samples are mixed with the binding buffer equal-volume containing 10mM imidazoles, by nickel post, utilizes the affinity chromatography of HIS label to carry out the purifying of albumen, dense by difference
The gradient elution (concentration is 200mM, 300mM, 500mM) of degree imidazoles, obtains single target protein 12%SDS-PAGE electrophoresis checking (as Fig. 6), 1 whole bacterial protein, and 2 spread liquid, 3 elutriants; Collect protein concentrate.Electrophoresis the result shows: can successfully obtain Latcripin3 target protein after ni-sepharose purification.
2.6 protein-active analyses
A. adopt the target protein of existing method to 2.5 step purified concentration to check order, its aminoacid sequence, as shown in SEQIDNO:4, names Latcripin-3 albumen.
Aminoacid sequence and functional structure domain analysis are analyzed: analyzed by the coded product of DNASTAR software package to embodiment of the present invention nucleic acid.
Adopt Protean module, analyze the general aspects of polypeptide;
Similarity system design completes with BLAST on NCBI website;
Adopt Pfam database, known protein sequence is carried out retrieval analysis, its functional domain of prediction peroxidase albumen, has anti-oxidant protease activity, have scavenging free radicals and anti-tumor activity.Analysis shows, Latcripin3 protein structure domain and peroxidase albumen have certain sequence similarity, illustrates that Latcripin-3 albumen has anti-oxidant protease activity, have scavenging free radicals and anti-tumor activity.
B., after the Latcripin-3 target protein of purified concentration being carried out micro-BCA protein quantification, typeⅡ pneumocyte is selected to carry out cell toxicant SRB experiment.SRB(Sulforhodamine B Sulforhodamine B) be a kind of water-soluble protein dyestuff that can be combined with the basic aminoacids of biomacromolecule, its be incorporated into measure in cell number can reflect total protein concentration so that reflection cell count number.OD value at 515 nm wavelength places and viable count are good linear relationship.The SRB experimental result of target protein as shown in Figure 7, illustrates that the albumen of genetic expression of the present invention has restraining effect significantly to typeⅡ pneumocyte, when protein concentration is 15ug/ml, tumour inhibiting rate close to 30%, and is concentration dependent.
Sequence table
<110> Dalian Medical Univ
<120> extracts anti-oxidant, antitumor from mushroom C91-3 bacterial strain
latcripinthe method of-3 gene fragments
<160> 4
<210> 1
<211> 35
<212> DNA
<213> artificial sequence
<220>
<223> primer
<400>1
GGCTGATATCGGATCCCTTGCCCAAGATCTTACCG 35
<210> 2
<211> 35
<212> DNA
<213> artificial sequence
<220>
<223> primer
<400>2
GGTGGTGGTGCTCGAGGTCGGGGCAGTGAGGAATT 35
<210> 3
<211> 732
<212> DNA
<213> mushroom C91-3 bacterial strain (
lentinula edodes)
<400> 3
1 CTTGCCCAAG ATCTTACCGA GACACTATTC GAGAACCAGT GTGGTGAAAC
51 GGCCCATGAA GTGCTTCGTT TGAGCTTCCA TGATGCTATT GCTATCTCTC
101 AATCCCTCGG TCCGTCGGCT GGAGGAGGCG CTGACGGTTC TATGTTGATC
151 TTCCCGGACG TCGAGCCCAA CTTCGCCGCC AACCTCGGAA TCTCCGACAG
201 CGTGAACGAC CTCGCTCCAT TCTTGGCTTC AGGAAAATTC CCGACTATTA
251 CTGCGGGAGA TATGATCCAG TTCGGTGCCG CTGTCGCTGT CGGCCTTTGT
301 CCTGGTGCAC CTCAATTGGA GTTCCGCGCC GGACGACCCA ACGCTACCGC
351 TCCTGCTGTT GACGGTCTGA TCCCTGAACC GCAAAATACT GTCGATGAAA
401 TTTTGGCACG TTTCCAGGAT GCTGCAAACA TGAATGCTGA GGACATTGTT
451 TCTCTGCTTG TATCACACAC AGTGGCCCGA GCCGATCACG TCGATCCCAC
501 TTTGGACGCT GCACCTTTCG ACTCGACTCC TTTCACCTTT GACTCACAGT
551 TCTTCCTCGA AACCCTCTTG ACTGGTGTCG GATTCCCTGG AACTACCAAC
601 AACACTGGTG AAGTTTCCTC CCCTCTTCCC CTCACTGTTG GCGACAACGT
651 TGGAGAACTC CGACTCCAAT CGGACTTCGA GCTGGCTCGT GACTCCCGAA
701 CTGCCTGTTT CTGGCAATCA ATGATCAACC AG 732
<210> 4
<211> 244
<212> PRT
<213> mushroom C91-3 bacterial strain (
lentinula edodes) expression product
<400> 4
1 LAQDLTETLF ENQCGETAHE VLRLSFHDAI AISQSLGPSA GGGADGSMLI
51 FPDVEPNFAA NLGISDSVND LAPFLASGKF PTITAGDMIQ FGAAVAVGLC
101 PGAPQLEFRA GRPNATAPAV DGLIPEPQNT VDEILARFQD AANMNAEDIV
151 SLLVSHTVAR ADHVDPTLDA APFDSTPFTF DSQFFLETLL TGVGFPGTTN
201 NTGEVSSPLP LTVGDNVGEL RLQSDFELAR DSRTACFWQS MINQ 244
Claims (1)
1. a mushroom C91-3 bacterial strain
latcripinthe application of-3 genetic expression albumen in preparation treatment lung-cancer medicament, described mushroom C91-3 bacterial strain
latcripinthe aminoacid sequence of-3 genetic expression albumen is as shown in SEQ ID NO:4.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310337850.6A CN103421766B (en) | 2013-08-06 | 2013-08-06 | Method for extracting anti-oxidant anti-tumor Latcripin-3 gene segment from mushroom C91-3 strain |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310337850.6A CN103421766B (en) | 2013-08-06 | 2013-08-06 | Method for extracting anti-oxidant anti-tumor Latcripin-3 gene segment from mushroom C91-3 strain |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103421766A CN103421766A (en) | 2013-12-04 |
CN103421766B true CN103421766B (en) | 2015-05-27 |
Family
ID=49647160
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310337850.6A Expired - Fee Related CN103421766B (en) | 2013-08-06 | 2013-08-06 | Method for extracting anti-oxidant anti-tumor Latcripin-3 gene segment from mushroom C91-3 strain |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103421766B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104711272A (en) * | 2014-12-14 | 2015-06-17 | 上海勤生缘生物科技有限公司 | Laccase protein gene and cloning and sequencing method thereof |
CN104726466A (en) * | 2014-12-14 | 2015-06-24 | 上海勤生缘生物科技有限公司 | Antrodia Biotin protein gene and cloning and sequencing method thereof |
CN104694556A (en) * | 2014-12-14 | 2015-06-10 | 上海勤生缘生物科技有限公司 | Antrodia camphorate FPPS (farnesyl diphosphate synthase) protein gene as well as cloning and sequencing method thereof |
CN104878021B (en) * | 2015-05-22 | 2018-01-16 | 大连医科大学 | The genetic fragments of Latcripin 11 of the bacterial strains of mushroom C91 3, encoding proteins, Preparation method and use |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20110134610A (en) * | 2010-06-09 | 2011-12-15 | 경상대학교산학협력단 | Specific primer for diagnosing lentinula edodes virus lehv, and method for diagnosing using the same |
CN102888470A (en) * | 2012-10-30 | 2013-01-23 | 福建农林大学 | RT-PCR primer of mushroom dsRNA virus and detection method |
-
2013
- 2013-08-06 CN CN201310337850.6A patent/CN103421766B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20110134610A (en) * | 2010-06-09 | 2011-12-15 | 경상대학교산학협력단 | Specific primer for diagnosing lentinula edodes virus lehv, and method for diagnosing using the same |
CN102888470A (en) * | 2012-10-30 | 2013-01-23 | 福建农林大学 | RT-PCR primer of mushroom dsRNA virus and detection method |
Non-Patent Citations (3)
Title |
---|
AB306949.1;Sakamoto,Y 等;《GenBank》;20081001;全文 * |
香菇C91-3 cDNA文库的构建及鉴定;王晓丽等;《时珍国医国药》;20091231(第12期);"材料与方法","结果" * |
香菇菌C91-3凋亡相关蛋白24414在毕赤酵母GS115中的表达与鉴定;刘奔等;《中国微生态学杂志》;20120229;第24卷(第2期);1.2 * |
Also Published As
Publication number | Publication date |
---|---|
CN103421766A (en) | 2013-12-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103421766B (en) | Method for extracting anti-oxidant anti-tumor Latcripin-3 gene segment from mushroom C91-3 strain | |
CN105296433A (en) | CTLA4 antibody, pharmaceutical composition thereof and application of pharmaceutical composition | |
CN103074361B (en) | Method for integrating exogenous gene into sheep listeria genome | |
CN106834336A (en) | A kind of heterogenous expression and purification process of Trichoderma harzianum acid protease P6281 | |
CN101463344B (en) | Antihuman Her2 monoclonal antibody hybridoma cell lines, monoclonal antibody, reagent kit and uses thereof | |
CN104725517A (en) | Method for enhancing target protein display quantity on yeast cell surface | |
CN102465134B (en) | Method for preparing recombinant anthropogenic Cu/Zn superoxide dismutase | |
CN103555762B (en) | AFP and GM-CSF dual-gene co-expression recombinant vector as well as preparation method and application of recombinant vector | |
CN103614414A (en) | AFP (Alpha Fetoprotein) and IL-2 (Interleukin-2) double-gene co-expressing recombinant vector as well as preparation method and application thereof | |
CN102286490A (en) | Preparation and renaturation method of chicken interferon gamma | |
CN112538452A (en) | Cervical cancer therapeutic vaccine based on recombinant attenuated Listeria monocytogenes and preparation method thereof | |
CN105647970A (en) | Prostate-cancer-specific PAP (prostatic acid phosphatase)-GM-CSF (granulocyte-macrophage colony-stimulating factor)-IL-6 (interluekin-6) genetic recombinant fusion protein and preparation method thereof | |
CN103484478B (en) | The Latcripin-18 gene fragment of mushroom C91-3 bacterial strain, proteins encoded and preparation method | |
CN105349554A (en) | Latcripin-9 gene segment of shiitake mushroom C91-3 strain, coding protein, preparation method and application | |
CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
CN103484476B (en) | Latcripin-13 gene segment of mushroom C91-3 strain, coded protein and preparation method | |
CN103484477B (en) | Latcripin-15 gene segment of mushroom C91-3 strain, coded protein and preparation method | |
CN105154420A (en) | CDNA (complementary deoxyribonucleic acid) sequence of ganoderma lucidum terpene synthase GL22395 encoding gene and application of cDNA sequence | |
CN103898128B (en) | The Latcripin-16 gene fragment of mushroom C91-3 bacterial strain, proteins encoded and preparation method | |
CN103484479B (en) | Latcripin-4 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof | |
CN105176897A (en) | Recombinant engineering strain expressing GnRH/M2 fusion polypeptide and construction and application thereof | |
CN104878021A (en) | Latcripin-11 gene fragment of lentinula edodes C91-3 strain, and encoding protein, preparation method and application of Latcripin-11 gene fragment | |
CN103484484B (en) | Latcripin-5 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof | |
CN100374548C (en) | BCG vaccine strain of recombined interferon and its preparation process | |
CN103484483A (en) | Latcripin-2 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150527 Termination date: 20190806 |