CN103484484B - Latcripin-5 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof - Google Patents

Latcripin-5 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof Download PDF

Info

Publication number
CN103484484B
CN103484484B CN201310411845.5A CN201310411845A CN103484484B CN 103484484 B CN103484484 B CN 103484484B CN 201310411845 A CN201310411845 A CN 201310411845A CN 103484484 B CN103484484 B CN 103484484B
Authority
CN
China
Prior art keywords
mushroom
latcripin
bacterial strain
gene fragment
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201310411845.5A
Other languages
Chinese (zh)
Other versions
CN103484484A (en
Inventor
黄敏
刘奔
曹淑云
钟民涛
伦永志
张伟
李星云
王晓丽
曹婧
宁安红
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dalian Medical University
Original Assignee
Dalian Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dalian Medical University filed Critical Dalian Medical University
Priority to CN201310411845.5A priority Critical patent/CN103484484B/en
Publication of CN103484484A publication Critical patent/CN103484484A/en
Application granted granted Critical
Publication of CN103484484B publication Critical patent/CN103484484B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention discloses a Latcripin-5 gene fragment of a mushroom C91-3 strain, encoding protein and a preparation method thereof, wherein the Latcripin-5 gene fragment has a nucleotide sequence represented by SEQIDNO:1, and the encoding protein has an amino acid sequence represented by SEQIDNO:2. The preparation method for the Latcripin-5 gene fragment comprises: extracting the total RNA of mycelium of the mushroom C91-3 strain; carrying out reverse transcription on the total RNA of the mycelium to synthesize cDNA; carrying out PCR amplification on the target gene, wherein the obtained cDNA is adopted as a template, and PCR reaction primers having two restriction enzyme cutting sites such as EcoR I and Xho I are adopted to carry out a PCR reaction; and recovering and purifying the DNA fragment.

Description

The Latcripin-5 gene fragment of mushroom C91-3 bacterial strain, proteins encoded and preparation method
Technical field
The present invention relates to and a kind ofly to extract from mushroom C91-3 bacterial strain latcripin-5gene fragment, proteins encoded and preparation method, coded albumen has DNA/RNA non-restriction endonuclease structural domain, has non-restriction endonuclease activity, inducing apoptosis of tumour cell, adjustment immunity of organisms, regulates cell cycle and the function such as antitumor.
Background technology
Fungi is rich in multiple bioactive molecules, comprises ribosome inactivating protein, antifungal protein, lectin, ubiquitin-like protein, polysaccharide and kinases.The advantages such as antineoplastic component is wherein few with untoward reaction, evident in efficacy have distinctive feature in oncotherapy.It is Basidiomycotina Basidiomycetes Pleurotaceae that Lentinus Edodes fungus C91-3 belongs to fungi, and this bacterial classification was preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center in 2013, and preserving number is CGMCC No.7354.Lentinus Edodes fungus C91-3 contains invigorating the spleen and benefiting QI, strengthening vital QI to eliminate pathogenic factors, enhancing body immunizing power, the effects such as anti-curing cancers.[Zhao C,Sun H,Tong X,et a1.An Antitumor leetin from edible Mushroon Agroebe aegerita[J].Bioehem J,2003,374:321—327]。Containing multiple protein composition in Lentinus Edodes fungus C91-3 fermented liquid, confirm that some protein ingredient has good antitumor action [Huang Min by animal experiment in vivo, Ning'an is red, Zhang Zhuoran etc. the research [J] of mushroom C91-3 hypha fermentation liquid mouse Anticancer effect in vivo. Chinese microecology magazine, 1996,8 (3): 38-50].Experiment in vitro also confirms, some protein ingredients in its fermented liquid have inducing apoptosis of tumour cell ability [wear soldier, Huang Min, Ning'an is red. mushroom C91-3 hypha fermentation liquid eggs suppresses mouse cervix JEG-3 U14 to grow and apoptosis-induced experimental study in vain. Zhejiang Medical, 2004,26(9); 656-658].But, up to now also not about extracting the relevant reports such as gene fragment, proteins encoded and the preparation method with inducing apoptosis of tumour cell from mushroom C91-3 bacterium.
Summary of the invention
The present invention is the above-mentioned technical problem in order to solve existing for prior art, provides a kind of and to extract from mushroom C91-3 bacterial strain latcripin-5gene fragment, proteins encoded and preparation method, coded albumen has DNA/RNA non-restriction endonuclease structural domain, has inducing apoptosis of tumour cell, regulates immunity of organisms, regulates cell cycle and the function such as antitumor.
Technical solution of the present invention is a kind of mushroom C91-3 bacterial strain latcripin-5gene fragment, is characterized in that the nucleotide sequence as shown in SEQ ID NO:1.
A kind of above-mentioned mushroom C91-3 bacterial strain latcripin-5gene segment encodes albumen, is characterized in that the aminoacid sequence as shown in SEQ ID NO:2.
A kind of above-mentioned mushroom C91-3 bacterial strain latcripin-5the preparation method of gene fragment, is characterized in that carrying out as follows successively:
A. the mycelium total serum IgE of mushroom C91-3 bacterial strain is extracted;
B. by mycelium total serum IgE reverse transcription synthesis cDNA;
C. pcr amplification target gene:
Be template with obtained cDNA, carry out PCR reaction with the PCR reaction primer with EcoR I and Xho I two restriction enzyme sites; It is as follows that described PCR reacts primer sequence:
Upstream primer EcoR I:
5'- ATCGGATCC GAATTCGTAAGGCAAGCCTACGTTG -3'
Downstream primer Xho I:
5'- GGTGGTGGTG CTCGAGAGACTTGACTGCGTCCGAG -3'
D. purifying DNA fragment is reclaimed:
Obtained PCR primer is carried out 1% agarose gel electrophoresis, the obvious band near purifying 681bpMarker, cut glue and reclaim DNA fragmentation.
Described a step gets the mycelium of the cultivation mushroom C91-3 bacterial strain of 18 days, in mortar, add liquid nitrogen fully grind, after adding Trizol, room temperature leaves standstill 30min, and sample continues to be ground to lysate transparence after melting, after room temperature leaves standstill 5min, the centrifugal 5min of 12000r/min, is transferred to supernatant in new centrifuge tube, then adds 1/5 volume of chloroform, after gentle vibration, 4 C, 12000r/min is centrifugal, 15min; Draw upper strata aqueous phase solution and be transferred in another centrifuge tube, add equal-volume Virahol, the static 15min of room temperature after mixing, 4 C again, 12000r/min is centrifugal, 10min, abandon supernatant, then add 75% washing with alcohol and drying, finally by DEPC process water dissolution, obtain the mycelium total serum IgE of mushroom C91-3 bacterial strain.
The PCR reaction system 50 μ l:cDNA template 1 μ l of described step c, upstream primer 0.5 μ l, downstream primer 0.5 μ l, each 2.5 mM of dNTP Mixture() 4 μ l, 5 × PrimeSTAR Buffer(Mg 2+plus) 10 μ l, PrimeSTAR HS DNA Polymerase(2.5 U/ μ l) 0.5 μ l, sterile purified water 33.5 μ l; Reaction conditions: 98 DEG C of sex change 10s, 55 DEG C of renaturation 10s, 72 DEG C extend 1min, 30 circulations; 72 DEG C extend 5min; 4 DEG C of cooling 10min.
The present invention is from mushroom C91-3 mycelium transcript profile, clones one section of specific gene fragment, called after latcripin-5 gene fragments, the albumen coded by this gene fragment has DNA/RNA non-restriction endonuclease structural domain, has inducing apoptosis of tumour cell, regulates immunity of organisms, regulates cell cycle and the function such as antitumor.This gene fragment can be carried out gene recombination, and express efficiently in pET32-a prokaryotic expression system, expression product is carried out isolation andpurification by affinity chromatography, obtain the protein of this genes encoding, this albumen can be used for the mechanism in apoptosis of studying and the effect in cell-signaling pathways thereof, also can be used for the medicine preparing prevention or treatment tumour.
Accompanying drawing explanation
Fig. 1 is 1% agarose gel electrophoresis figure of embodiment of the present invention PCR primer.
Fig. 2 is embodiment of the present invention used carrier pET32a(+) electrophorogram after double digestion.
Fig. 3 is that the embodiment of the present invention is extracted latcripinthe positive bacterium colony of mono-clonal after-5 gene fragments transform.
Fig. 4 is the SDS-PAGE electrophorogram of embodiment of the present invention recombinant expression protein.
Fig. 5 is the Western-blot electrophorogram of embodiment of the present invention induction expression protein.
Fig. 6 is the target protein SDS-PAGE electrophorogram after embodiment of the present invention purifying.
Fig. 7 is the growth inhibition ratio schematic diagram of the target protein after embodiment of the present invention purifying to A549 cell.
Fig. 8 is that the non-limiting endonuclease activity of target protein after embodiment of the present invention purifying detects electrophorogram.
Mushroom C91-3 bacterial strain preservation date: on March 15th, 2013;
Classification And Nomenclature: mushroom ( lentinula edodes);
Depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC);
Depositary institution address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
Preserving number: CGMCC No.7354.
Embodiment
A. the mycelium total serum IgE of mushroom C91-3 bacterial strain is extracted:
Take the mycelium of the culture medium culturing mushroom C91-3 bacterial strain of 18 days, add liquid nitrogen and fully grind in mortar, the Trizol room temperature adding 1ml places 5min, then adds 0.2ml chloroform, after gentle vibration, and 4 C, 12000r/min is centrifugal, 15min; Draw upper strata aqueous phase solution 0.5ml and be transferred to another clean 1.5ml centrifuge tube, add equal-volume Virahol, put upside down the rear static 15min of room temperature of mixing, 4 C again, 12000r/min is centrifugal, 10min, abandon supernatant, then add 75% ethanol 1ml to wash and drying, finally by DEPC process water dissolution, the mycelium total serum IgE of mushroom C91-3 bacterial strain;
Ultraviolet spectrophotometer checking purity, OD260/280 ratio is between 1.8 ~ 2.0.
Carry out 1.0% agarose gel electrophoresis checking, show that RNA DNA purity is higher.
B. by mycelium total serum IgE reverse transcription synthesis CDNA;
Use TaKaRa 3 '-Full RACE Core Set Ver.2.0 test kit reverse transcription synthesis cDNA, this test kit is purchased from precious biotechnology (Dalian) company limited.
Reaction system: shiitake mushroom hypha total serum IgE (1 ug/ μ l) 1 μ l, 3 ' RACE Adaptor (5 uM) 1 μ l, dNTP Mixture (10 mM each) 1 μ l, RNase Free dH 2o 4.5 μ l;
Reaction conditions: 70 DEG C, 10 min place 2 minutes immediately on ice;
Then following component is added: 5 × M-MLV Buffer 2 μ l, RNase Inhibitor (40 U/ μ l) 0.25 μ l, Reverse Transcriptase M-MLV (without RNase) (200 U/ μ l) 0.25 μ l, system cumulative volume reaches 10 μ l.
Reaction conditions: 42 DEG C, 60 min 70 DEG C, 15 min obtain inverse transcription reaction liquid (cDNA).
A. pcr amplification target gene:
Be template with obtained cDNA, carry out PCR reaction with the PCR reaction primer with EcoR I and Xho I two restriction enzyme sites; It is as follows that described PCR reacts primer sequence:
Upstream primer EcoR I:
5'- ATCGGATCC GAATTCGTAAGGCAAGCCTACGTTG -3'
Downstream primer Xho I:
5'- GGTGGTGGTG CTCGAGAGACTTGACTGCGTCCGAG -3'
Primer entrusts the synthesis of precious biological (Dalian) company.
PCR reaction system 50 μ l:cDNA template 1 μ l, upstream primer 0.5 μ l, downstream primer 0.5 μ l, each 2.5 mM of dNTP Mixture() 4 μ l, 5 × PrimeSTAR Buffer(Mg 2+plus) 10 μ l, PrimeSTAR HS DNA Polymerase(2.5 U/ μ l) 0.5 μ l, sterile purified water 33.5 μ l; Reaction conditions: 98 DEG C of sex change 10s, 55 DEG C of renaturation 10s, 72 DEG C extend 1min, 30 circulations; 72 DEG C extend 5min; 4 DEG C of cooling 10min.
PCR product through 1% agarose gel electrophoresis as shown in Figure 1, M: DL2,000 DNA Marker in Fig. 1; 1: latcripin-5 object cloned sequence products, prove this gene fragment of successful clone.
D. purifying DNA fragment is reclaimed:
Obtained PCR primer is carried out 1% agarose gel electrophoresis, bright near purifying 681bpMarker
Aobvious band, cuts glue and reclaims DNA fragmentation, and name life is latcripin-5 gene fragments.
Experiment:
1. latcripin-5 gene fragment orders measure:
Check order by the precious biotech firm in Dalian mensuration, mushroom C91-3 latcripin-5nucleotide sequencing is as SEQ ID NO.1. latcripin-5the long cDNA for 681bp of gene fragment order, it contains 227 codon open reading-frame (ORF)s (ORF).Through using the retrieval of ncbi database nucleotide similarity to show, without the gene fragment order of any similarity, prove that this gene is a novel gene segments.
2. latcripinthe clonal expression of-5 gene fragments
2.1 vector construction
2.1.1 by plasmid pET32a(+), use BamH I/Xho I to carry out enzyme and cut;
Reaction system (37 DEG C are spent the night):
pET32a(+)(100 ng/μl) 10 μl
10×K Buffer 5 μl
BamHⅠ(10 U/μl) 1 μl
XhoⅠ(10 U/μl) 1 μl
dH2O Up to 50 μl
Get 5 μ l and carry out 1% agarose gel electrophoresis, result as shown in Figure 2: M: λ-Hind III digest;-plasmid 1: pET32a(+);-BamH I/Xho I 2: pET32a(+); Show that plasmid cleavage is complete, can follow-up test be carried out.
2.1.2 carrier recovery
TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 is used to cut the DNA fragment that glue reclaims about 5.9 kbp.
2.1.3 by pET32a(+) carrier and the embodiment of the present invention latcripin-5gene fragment is recombinated
Use In-Fusion HD Cloning Kit, respectively by the embodiment of the present invention latcripin-5 gene fragments and enzyme are cut rear recovery carrier and are connected, reaction system and condition as follows:
latcripin-5 gene fragments (100 ng/ μ l) 2 μ l
Enzyme cuts rear recovery carrier (50 ng/ μ l) 1 μ l
5xIn-Fusion HD Enzyme Premix 2 μl
dH2O Up to 10 μl
50℃ 15 min
Get above-mentioned In-Fusion product 2.5 μ l thermal transition extremely e.coliin Rosetta-gami (DE3), coat on the LB flat board containing four kinds of microbiotic (Pyocianil, tsiklomitsin, paraxin, kantlex), 37 DEG C of incubated overnight.Cultivation results as shown in Figure 3, shows that positive transformants bacterial strain grows.
Simultaneously, the LB liquid culture that the positive bacterium colony of mono-clonal choosing grow on plates is inoculated in containing four kinds of microbiotic (Pyocianil, tsiklomitsin, paraxin, kantlex) is cultivated 14 hours based on 37 DEG C, adopt precious biotech firm Plasmid Miniprep Kit V3.l extracting plasmid to carry out order-checking qualification, result is as SEQ ID NO.1.
2.2 latcripinthe abduction delivering of-5 albumen and qualification
2.2.1 latcripinthe self-induction of-5 albumen is expressed
The positive bacterium colony of mono-clonal of picking 2.1.3, be inoculated in 10 ml containing in the LB liquid nutrient medium of four kinds of microbiotic (Pyocianil, tsiklomitsin, paraxin, kantlex), at 37 DEG C, 180 r/min shaking culture 5 hours, be inoculated in 10ml containing in the self-induction substratum of four kinds of microbiotic (Pyocianil, tsiklomitsin, paraxin, kantlex), at 37 DEG C, 180 r/min shaking culture 2,3 hours.Get bacterium liquid and carry out multigelation fragmentation (4 times), low temperature (4 DEG C) centrifugal 5000rpm/min, 5min, get supernatant, adds 50 μ l PBS.After supernatant being pressed protein sample disposal methods, do 12%SDS-PAGE electrophorogram as shown in Figure 4, M:Marker in Fig. 4; 1: experimental group 2h; 2: experimental group 3h; 3: negative control group 2h; 4: negative control group 3h.Show latcripin-5 albumen in positive strain by successful abduction delivering.
2.2.2 target protein Western-blotting identification and analysis
After SDS-PAGE electrophoretic separation sample, the PAGE glue mode of wet transferring film is transferred on NC film, after 5% skimmed milk room temperature confining liquid closes 100 minutes, the first anti-Mouse Anti-His Tag Monoclonal Antibody, 4 DEG C of overnight incubation.Add the second anti-horseradish enzyme labelling goat anti-mouse IgG (H+L) incubated at room again 60 minutes, the colour developing of colouring reagents box as shown in Figure 5, in Fig. 51: negative control group; 2: experimental group 2h.Show that induction expression protein is the target protein being added with His label.
2.3 latcripinthe purifying of-5 albumen and activity identification
2.3.1. latcripinthe purifying of-5 albumen
The thalline low temperature 5000r/min above-mentioned condition induced, 10min ~ 20 min is centrifugal, and every 50 ~ 100 mg thalline (weight in wet base) add 1 ~ 2 ml bacterial lysate.10000 × g, 4 DEG C are centrifugal 15 ~ 20 minutes, cleer and peaceful precipitation in separation, and collecting precipitation (inclusion body).Precipitation is resuspended in Binding Buffer.10,000 × g centrifugal 20 minutes, collect supernatant.By supernatant load upper prop, utilize the affinity chromatography of His label to carry out the purifying of albumen, use appropriate Elution Buffer wash-out, collect elution peak.Obtain single target protein, the checking of 12%SDS-PAGE electrophoresis as shown in Figure 6.In Fig. 6,1: sample solution; 2: the 1 pipe elutriants; 3: the 2 pipe elutriants; 4: the 3 pipe elutriants; 5: the 4 pipe elutriants; 6: the 5 pipe elutriants; 7: stream wears liquid.Show that target protein is by successful purification.
Adopt the target protein of existing method purified concentration to check order, its aminoacid sequence is as shown in SEQ ID NO:2.This Novel special M-band sequence (Latcripin-5 albumen is called for short Lp-5), analyze through the retrieval of ncbi database amino acid similarity and Pfam database retrieval, result shows that Latcripin-5 albumen has DNA/RNA non-restriction endonuclease structural domain.
DNA/RNA non-restriction endonuclease is that a class can be degraded the lytic enzyme of various forms DNA and RNA, to the phosphodiester bond of DNA and RNA of strand, double-strand, wire, ring-type and supercoiled form, all there is very high activity, produce the acid of 5 '-phosphoric acid nucleoside or 5 '-phosphoric acid oligonucleotide, and sequence requirements is not had to nucleic acid.Can biological products be reduced, especially the content of virus type product Exogenous Nucleic Acid, reduce anaphylaxis, improve security; Lysis, can reduce the viscosity of sample, shortens the treatment time, improves protein yield, is conducive to precipitating and being separated of supernatant liquor, is conducive to the separation of composition during ultrafiltration time centrifugal, validity during raising column chromatography purification; Particle (virus, inclusion body etc.) pre-treatment, contributes to the purifying of particle; Bioanalysis, in ELISA, column chromatography, two dimensional electrophoresis and engram analysis, can improve resolving power and the rate of recovery.
Illustrate that target protein of the present invention has non-restriction endonuclease activity, can inducing apoptosis of tumour cell, regulate immunity of organisms, regulate cell cycle and the various biological function such as antitumor.
2.3.2. the desalination of inclusion body protein and renaturation
Inclusion body protein after purifying is carried out gradient dialysis, inclusion body protein is loaded in the dialysis tubing of MW16000, two ends dialysis sackholder clamping.Dialysis tubing is put into the dialysis renaturation liquid of 0.5L ~ 2L, ice bath, stir dialysis, 24h ~ 72 h, every 6 ~ 8 h change liquid renaturation, progressively reduce urea concentration until 0.By the solution centrifugal 10000rmp in dialysis tubing, 4 DEG C centrifugal, and 20 ~ 30min supernatant is the recombinant protein of renaturation.
2.3.3 external antitumor activity qualification (mtt assay) of Latcripin-5 albumen
After the target protein of purified concentration is carried out micro-BCA protein quantification, detect cell survival and growing state with mtt assay.The final concentration of target protein effect is adjusted to 7.5,15,30,60 μ g/ml, using PBS as blank.Evaluate its cytotoxicity to tumour cell (typeⅡ pneumocyte strain).With 0.25 ~ 1% trysinization logarithmic phase cell, collected by centrifugation after stopping, make cell suspension, cell counting adjusts its concentration to 5 × 10 4/ ml.Every hole adds 100 μ l, and the aseptic PBS of marginal pore fills, 5%CO2, hatch for 37 DEG C, be paved with to cell monolayer target protein every hole 100 μ l that (96 hole flat underside) at the bottom of hole add above-mentioned 50 μ g/ml, each concentration establishes 6 multiple holes, 5%CO2, hatches 6,12,24 hours for 37 DEG C.And observe under inverted microscope.Then every hole adds 20 μ lMTT solution (5mg/ml, i.e. 0.5%MTT), continues to cultivate 4h.Stop cultivating, suck nutrient solution in hole.Every hole adds 150 μ l dimethyl sulfoxide (DMSO), puts low-speed oscillation 10min on shaking table.The light absorption value in each hole is measured, reference wavelength 630nm, according to formulae discovery tumour inhibiting rate (inhibitory rate of cell growth)=(control group mean OD value-experimental group mean OD value)/control group mean OD value below at enzyme-linked immunosorbent assay instrument 562 nm place.When target protein concentration is 7.5,15,30,60 μ g/mL, 6,12, the tumour inhibiting rate of 24h as shown in Figure 7.Show that the albumen expressed by gene fragment of the present invention has restraining effect significantly to typeⅡ pneumocyte strain.
2.3.4 the non-limiting endonuclease activity qualification of Latcripin-5 albumen
A549 cell cultures, to logarithmic phase, pours out nutrient solution, cleans once with 1 × PBS.Every 10 cm 2the precious biotech firm in DNAiso Reagent(Dalian adding 1 ml in the culturing cell of growth provides), horizontal positioned for a moment, make lysate be uniformly distributed in cell surface and rock culture dish gently and make lysis, then use liquid-transfering gun piping and druming cell to make it come off.Lysate containing cell is transferred in centrifuge tube, repeatedly blows and beats until without obvious sediment in lysate with liquid-transfering gun.Room temperature leaves standstill 5 minutes.10,000 × g 4 DEG C centrifugal 10 minutes, supernatant is transferred in new centrifuge tube.The dehydrated alcohol of DNAiso Reagent 1/2 volume is added in above-mentioned lysate.Repeatedly putting upside down mixing 2 minutes, to occurring that nebulous DNA precipitates, supernatant liquor being poured out gently, DNA precipitation is stayed bottom centrifuge tube.Add the ethanol of 1 ml 75% lentamente along centrifugal tube wall, turn upside down washing centrifuge tube tube wall gently, and 12,000 × g 4 DEG C carefully discard ethanol after centrifugal 5 minutes.By the genomic dna precipitation at room temperature drying after removing ethanol 10 seconds, slowly add the TE Buffer(pH8.0 of 50 μ l) dissolve genomic dna.Detect OD260/OD280, be about 2.0, its final concentration be adjusted to 200ng/ μ l.After the target protein of purified concentration is carried out micro-BCA protein quantification, final concentration is adjusted to 60 μ g/ml.Get 4 EP pipes, often add the DNA that 5 μ l final concentrations are 200ng/ μ l in pipe, often add 2 μ lDNA enzymes afterwards in pipe respectively, Latcripin-5 albumen that 10 μ l, 5 μ l, 2.5 μ l concentration are 60 μ g/ml, it is 20 μ l that the general enzyme reaction buffer solution of each Guan Zhongyong supplies final volume, and 37 DEG C are reacted 1 hour.Get 5 μ l and carry out 1% agarose gel electrophoresis, result as shown in Figure 8: M: DL10000 DNA Marker; 1: DNA enzymatic positive control; 2: 10 μ l target proteins; 3:5 μ l target protein; 4:2.5 μ l target protein.Show that the target protein after 10 μ l purifying can the genomic dna of degradable 2 μ l; Latcripin-5 albumen has the non-limiting endonuclease activity of DNA/RAN.
Sequence table
 
<110> Dalian Medical Univ
 
<120> mushroom C91-3 bacterial strain latcripin-5gene fragment, proteins encoded and preparation method
<160> 4
 
<210> 1
<211> 681
<212> DNA
<24> mushroom C91-3 bacterial strain ( lentinula edodes)
 
<400> 1
1 GTAAGGCAAG CCTACGTTGC AGCTTACGAT CGCAGACTTA GGCATCCCGC TTGGACCGCA
61 GAGCACCTGA CTTTGGCTTC TCTGGGTAAA TCGCCCTTGG TTGCGCCTCC GGATGCAACT
121 GGAGATAGGT CAAAGAGTAC ATTCATGGAA GACGATACTA TCCCAATCCC ATTCCGAGCT
181 CGGTTGACAG ATTACCTGAG AAGTGGGTAT GACCGTGGAC ATATGGTTCC TGCAGCAGAT
241 GCCAAATTTT CCCAGGAAGC TATGAACGAG ACCTTCTATT TATCGAATAT GGCTCCTCAG
301 GTCGGCGAAG GTTTCAACCG ACATTATTGG GCATACTTGG AAGATTGGTG CCGTCGTCTT
361 ACAGGATCCT TCTCTGATGT CTACGTCTTC ACGGTTCCAC TCTATCTTCC CCGCCGAGAC
421 TCCGACGGGA AGTGGCGTAT CACTCACGAA GTGATCGGTT CTCCGCCGAA CGTTTCCGTC
481 CCAACACATT TTGCAAAAGT TGTGCTTACT TCGAAGCCCG CCTCACCGTC GACTCCGAAT
541 ATCCTTGAGC TCGCTATGGG CGCTTTTGTT CTACCTAATG CACCTATCCC CGACGACACG
601 CCATTGGAAA AGTTTGTTAT GCCAGTGGAA GCTGTGGAAC GCGCAGCTGG ACTAGCTCTC
661 TTCTCGGACG CAGTCAAGTC T 681
 
<210> 2
<211> 227
<212> PRT
<24> mushroom C91-3 bacterial strain ( lentinula edodes) expression product
 
<400> 2
1 VRQAYVAAYD RRLRHPAWTA EHLTLASLGK
31 SPLVAPPDAT GDRSKSTFME DDTIPIPFRA
61 RLTDYLRSGY DRGHMVPAAD AKFSQEAMNE
91 TFYLSNMAPQ VGEGFNRHYW AYLEDWCRRL
121 TGSFSDVYVF TVPLYLPRRD SDGKWRITHE
151 VIGSPPNVSV PTHFAKVVLT SKPASPSTPN
181 ILELAMGAFV LPNAPIPDDT PLEKFVMPVE
211 AVERAAGLAL FSDAVKS 227
 
<210> 3
<211> 35
<212> DNA
<24> artificial sequence
 
<220>
<223> primer
 
<400>3
GGCTGATATC GGATCCACCTCACTTCATGCACACT 35
 
<210> 4
<211> 35
<212> DNA
<24> artificial sequence
 
<220>
<223> primer
 
<400>4
GGTGGTGGTG CTCGAGCAAACATGCCATCGCACTT 35

Claims (5)

1. a mushroom C91-3 bacterial strain latcripin-5gene fragment, is characterized in that the nucleotide sequence of this gene is as shown in SEQ ID NO:1.
2. a mushroom C91-3 bacterial strain as claimed in claim 1 latcripin-5gene segment encodes albumen, is characterized in that the aminoacid sequence of this albumen is as shown in SEQ ID NO:2.
3. a mushroom C91-3 bacterial strain as claimed in claim 1 latcripin-5the preparation method of gene fragment, is characterized in that carrying out as follows successively:
A. the mycelium total serum IgE of mushroom C91-3 bacterial strain is extracted;
B. by mycelium total serum IgE reverse transcription synthesis cDNA;
C. pcr amplification target gene:
Be template with obtained cDNA, carry out PCR reaction with the PCR reaction primer with EcoR I and Xho I two restriction enzyme sites; It is as follows that described PCR reacts primer sequence:
Upstream primer EcoR I:
5'- ATCGGATCC GAATTCGTAAGGCAAGCCTACGTTG -3'
Downstream primer Xho I:
5'- GGTGGTGGTG CTCGAGAGACTTGACTGCGTCCGAG -3'
D. purifying DNA fragment is reclaimed:
Obtained PCR primer is carried out 1% agarose gel electrophoresis, the obvious band near purifying 681bpMarker, cut glue and reclaim DNA fragmentation.
4. mushroom C91-3 bacterial strain according to claim 3 latcripin-5the preparation method of gene fragment, is characterized in that described a step gets the mycelium of the cultivation mushroom C91-3 bacterial strain of 18 days, adds liquid nitrogen and fully grind in mortar, after adding Trizol, room temperature leaves standstill 30min, sample continues to be ground to lysate transparence after melting, after room temperature leaves standstill 5min, and the centrifugal 5min of 12000r/min, supernatant is transferred in new centrifuge tube, then 1/5 volume of chloroform is added, after gentle vibration, 4 C, 12000r/min is centrifugal, 15min; Draw upper strata aqueous phase solution and be transferred in another centrifuge tube, add equal-volume Virahol, the static 15min of room temperature after mixing, 4 C again, 12000r/min is centrifugal, 10min, abandon supernatant, then add 75% washing with alcohol and drying, finally by DEPC process water dissolution, obtain the mycelium total serum IgE of mushroom C91-3 bacterial strain.
5. mushroom C91-3 bacterial strain according to claim 4 latcripin-5the preparation method of gene fragment, it is characterized in that the PCR reaction system 50 μ l:cDNA template 1 μ l of described step c, upstream primer 0.5 μ l, downstream primer 0.5 μ l, dNTP Mixture 4 μ l, 5 × PrimeSTAR Buffer 10 μ l, PrimeSTAR HS DNA Polymerase(2.5 U/ μ l) 0.5 μ l, sterile purified water 33.5 μ l; Reaction conditions: 98 DEG C of sex change 10s, 55 DEG C of renaturation 10s, 72 DEG C extend 1min, 30 circulations; 72 DEG C extend 5min; 4 DEG C of cooling 10min.
CN201310411845.5A 2013-09-11 2013-09-11 Latcripin-5 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof Expired - Fee Related CN103484484B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310411845.5A CN103484484B (en) 2013-09-11 2013-09-11 Latcripin-5 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310411845.5A CN103484484B (en) 2013-09-11 2013-09-11 Latcripin-5 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof

Publications (2)

Publication Number Publication Date
CN103484484A CN103484484A (en) 2014-01-01
CN103484484B true CN103484484B (en) 2015-07-22

Family

ID=49825078

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310411845.5A Expired - Fee Related CN103484484B (en) 2013-09-11 2013-09-11 Latcripin-5 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof

Country Status (1)

Country Link
CN (1) CN103484484B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104878021B (en) * 2015-05-22 2018-01-16 大连医科大学 The genetic fragments of Latcripin 11 of the bacterial strains of mushroom C91 3, encoding proteins, Preparation method and use

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Ben Liu等.A Novel Apoptosis Correlated Molecule:Expression and Characterization of Protein Latcripin-1 from Lentinula edodes C91-3.《International Journal of Molecular Sciences》.2012,第13卷(第5期),摘要,第6247页最后1段-第6248页第1段,第6249页图2,第6252页图5,6259页第3.2-3.3节. *
香菇C91-3 cDNA文库的构建及鉴定;王晓丽等;《时珍国医国药》;20091231;第20卷(第12期);3162-3163 *

Also Published As

Publication number Publication date
CN103484484A (en) 2014-01-01

Similar Documents

Publication Publication Date Title
CN104524564B (en) A kind of crucian Simplex Virus combination vaccine preparation and preparation method and application
CN104611358A (en) Method for preparing Norovirus virus-like particles in escherichia coli
CN109402171B (en) Bursaphelenchus xylophilus RNAi regulation gene and application thereof
CN107267528A (en) A kind of tobacco axillary bud adjusting and controlling growth gene NtMOC1 and its cloning process and application
CN103421766B (en) Method for extracting anti-oxidant anti-tumor Latcripin-3 gene segment from mushroom C91-3 strain
CN103484484B (en) Latcripin-5 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof
CN109609524A (en) Protein and the application of a kind of lactobacillus plantarum nitrite reductase gene and its coding
CN108822195A (en) Dangshan pear has albumen, encoding gene PbrTTS1 and its application for promoting pollen tube growth function
CN105063016A (en) Method for extracting microorganism total DNA from yellow rice wine wheat koji
CN103484476B (en) Latcripin-13 gene segment of mushroom C91-3 strain, coded protein and preparation method
CN103484479B (en) Latcripin-4 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof
CN103484478B (en) The Latcripin-18 gene fragment of mushroom C91-3 bacterial strain, proteins encoded and preparation method
CN103484477B (en) Latcripin-15 gene segment of mushroom C91-3 strain, coded protein and preparation method
CN103484483B (en) Latcripin-2 gene fragment of mushroom C91-3 strain, encoding protein and preparation method thereof
CN107056908A (en) Soybean salt-tolerance gene GmCHS5 and its application
CN103898128B (en) The Latcripin-16 gene fragment of mushroom C91-3 bacterial strain, proteins encoded and preparation method
CN105349554A (en) Latcripin-9 gene segment of shiitake mushroom C91-3 strain, coding protein, preparation method and application
CN106367360A (en) Gene transformation method for agrobacterium-mediated paecilomyces cicadae
CN104878021A (en) Latcripin-11 gene fragment of lentinula edodes C91-3 strain, and encoding protein, preparation method and application of Latcripin-11 gene fragment
CN104357474A (en) Method for preparing in vitro expression and polyclonal antibody of porcine Sox6 protein
CN106755038A (en) A kind of construction method and its Expression and Application of cladodification type dextransucrase engineering bacteria high
CN102533628A (en) Strain of bacillus subtilis engineering bacteria and application thereof in producing heparinase I
CN106520787A (en) Latcripin-8 gene fragment of mushroom C91-3 strain, and coded protein, preparation method and application thereof
CN104497120A (en) Application of grouper translationally controlled tumor protein TCTP and encoding gene thereof on fish nervous necrosis virus resistance
CN103952431A (en) Agrobacterium tumefaciens mediated gene transformation method of botryosphaeria dothidea

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20150722

Termination date: 20190911