CN103305638B - Dual real-time fluorescence PCR (Polymerase Chain Reaction) detection primer pair, probes, kit and detection method for type 1 and type 2 porcine circovirus - Google Patents
Dual real-time fluorescence PCR (Polymerase Chain Reaction) detection primer pair, probes, kit and detection method for type 1 and type 2 porcine circovirus Download PDFInfo
- Publication number
- CN103305638B CN103305638B CN201310275996.2A CN201310275996A CN103305638B CN 103305638 B CN103305638 B CN 103305638B CN 201310275996 A CN201310275996 A CN 201310275996A CN 103305638 B CN103305638 B CN 103305638B
- Authority
- CN
- China
- Prior art keywords
- type
- porcine circovirus
- seq
- primer pair
- nucleotide sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a dual real-time fluorescence PCR (Polymerase Chain Reaction) detection primer pair, probes, a kit and a detection method for type 1 and type 2 porcine circovirus. The dual real-time fluorescence PCR detection primer pair for type 1 and type 2 porcine circovirus is characterized in that the nucleotide sequence of the type 1 specific porcine circovirus is as shown in SEQ ID NO: 9 and SEQ ID NO: 11. The probe comprises the nucleotide sequence as shown in SEQ ID NO: 14. The nucleotide sequence of the type 2 specific porcine circovirus is as shown in SEQ ID NO: 2 and SEQ ID NO: 6. The probe comprises the nucleotide sequence as shown in SEQ ID NO: 7. The kit provided by the invention has the characteristics of rapidness, simpleness and convenience, strong specificity, high sensitivity and good reliability, and can be used for analyzing samples in batches at the same time, and differentiating whether the sample is type 1 porcine circovirus infection or type 2 porcine circovirus infection or not by reaction at one time, or common infection of type 1 and type 2 porcine circovirus infection, thereby, providing a powerful technical support for monitoring and preventing porcine circovirus epidemic situation. The kit has good application prospect.
Description
Technical field
The invention belongs to biological technical field, relate to dual real-time fluorescence PCR and detect, be specifically related to porcine circovirus types 1 and 2 dual real-time fluorescence PCR and detect primer, probe, test kit and detection method.
Background technology
Pig circular ring virus (porcine circovirus, PCV) belongs to PCV-II section, Circovirus.This virus is a kind of little and without cyst membrane, icosahedral symmetry, covalence closed, ring-type, Single-stranded DNA virus, virus particle diameter average out to 17nm, copies to roll ring mode, is the minimum animal virus found at present.Brain, Allan etc. think and PCV can be divided into PCV1 and PCV2 two kinds of genotype according to pathogenic, the antigenicity of PCV and nucleotide sequence.It is generally acknowledged PCV1 no pathogenicity at present, comprise PCV-PK15 and other is popular in the strain isolated of swinery but no pathogenicity, experiment proves that it is extensively present in pig primary cell line and swinery; PCV2 has pathogenic, with the pandemic pmws in countries in the world (Post Weaning Multisystemic Wasting Syndrome in recent years, PMWS) closely related, this disease mainly with progressive emaciation and multisystem pathology damage for feature, cause quite serious financial loss to global pig industry.PCV1 and PCV2 nucleotide homology is 68%.Between each PCV2 strain that GenBank logs in, sequence homology all has more than 95%.Therefore PCV1 and PCV2 has certain sibship, but also there occurs larger variation.The nucleotide homology rate of PCV1 and PCV2ORF2 gene is lower, is 65% ~ 67%.Previously In the view of most scholar, although PCV1 be extensively present in do not have in pig body pathogenic, thus to the research of PCV also always based on PCV2.But the PCV1, PCV2 and the PPV that go down to posterity with cell in vitro such as Krakowka are separately and the newborn piglet of simultaneous inoculation 1 age in days, all not there is not clinical symptom in the piglet of all single virus infectiones of result, but wherein there is the PPV viremia reaching 2 weeks in the piglet of inoculation PCV1 and PPV, and colon loop is with granulomatous poradenolymphitis; Rosell etc. carry out immunofluorescence experiment to the piglet infecting PCV1 and find have PCV1 antigen to exist at Lymphoid tissue, lung and enteron aisle, therefore, can not get rid of PCV1 to immune damaging action.In production practice simultaneously, the infection rate of PCV1 is also very high, all likely there is PCV1 in pig body and pig source sexual cell.
The conventional detection method of current detection PCV mainly contains virus purification, Serologic detection and PCR and detects.But these ordinary methods waste time and energy, susceptibility is low and easily occur false positive.At present in PCV detection method, the real-time fluorescence PCR detection method mainly for PCV2 of foundation, or PCV1 real-time fluorescence PCR detection method, detection PCV2 or PCV1 that can only be single, can not carry out dual real-time fluorescence PCR detection to PCV2 and PCV1.
Therefore, a kind of fast and convenient, that high specificity, susceptibility are high, PCV1 and PCV2 of good reliability differentiates detection method is set up significant.
Summary of the invention
According to demand and the deficiency in above-mentioned field, the invention provides porcine circovirus types 1 and 2 dual real-time fluorescence PCR and detect primer, probe, test kit and detection method.Test kit of the present invention only needs one-time detection just can judge, and whether sample is containing PCV1 or containing PCV2, or both co-infection are sensitive, convenient, high specificity, susceptibility are high, good reliability, large batch of sample analysis can be carried out simultaneously, have good application prospect.
The present invention is achieved through the following technical solutions:
Nucleotide sequence listed herein, all has 5 ' end to write to 3 ' extreme direction.
One aspect of the invention relates to two kinds of primer pairs (comprising four primers), wherein pig circular ring virus 1 type primer pair comprises the nucleotide sequence as shown in SEQ ID NO:9 and SEQ ID NO:11, and porcine circovirus 2 type primer pair comprises the nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:6.Another aspect of the present invention relates to two kinds of probes, and pig circular ring virus 1 type probe comprises the nucleotide sequence shown in SEQ ID NO:14, and porcine circovirus 2 type probe comprises the nucleotide sequence shown in SEQ ID NO:7.
The invention still further relates to a kind of Oligonucleolide primers for detecting PCV1 and PCV2 simultaneously to the composition with probe, comprise above-mentioned primer pair and probe.
In addition, the present invention also provides the test kit comprising above-mentioned composition.
Two kinds of probes of mentioned reagent box use the fluorescein-labelled of different sense channel respectively, and described fluorescein is selected from the one in FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5.
Further, the invention still further relates to the purposes that test kit detects PCV1 and PCV2 at the same time, probe is wherein fluorescein-labelled with any one, and two kinds of probe marks must be the fluorescein using different sense channel, all can be selected from FAM(Fluoresceincarboxylic acid), VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5.
Utilize above-mentioned two kinds of primer pairs and two kinds of probes to detect a dual real-time fluorescence PCR method of PCV1 and PCV2 simultaneously, comprising:
For the Auele Specific Primer differentiating PCV1 and PCV2 and the probe sequence of PCV ORF2 gene design.With the probe of fluorescein-labeled PCV1, and the probe of the fluorescein-labeled PCV2 of another kind detected by different sense channel; Probe is wherein fluorescein-labelled with any one, and two kinds of probe marks must be the fluorescein detected by different sense channel, all can be selected from FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5.To the primer and the probe sequence that detect PCV1 or PCV2 be used for, or for the primer of differentiating PCV1 and PCV2 and probe sequence, be placed in same reaction tubes, use fluorescent PCR amplification instrument to carry out real-time fluorescence PCR reaction.
Distinguishing feature of the present invention is: the quick susceptibility fully using the efficient amplification of round pcr, the good specificity of hybridization techniques and detection technique of fluorescence, the discriminating detection that one-time detection operation can complete PCV1 and PCV2 is carried out to same sample, can determine that sample is that PCV1 infects, or PCV2 infects, or both co-infection.Have fast and convenient, high specificity, susceptibility are high, good reliability, reduction testing cost, improve the advantage such as detection efficiency.
Namely Multiple experiments carries out quantitative experiment by the multiple target of amplification in a reaction tubes, in a reaction tubes, the amplification of any one target can affect the amplification of other targets, so careful experimental design and the optimization of reaction conditions will be carried out, instead of in same reaction tubes, all primers and template are simply mixed.Multiple fluorescence PCR tests all targets that ubiquitous problem is concentration notable difference in amplified sample, when increasing in same reaction tubes, during if there is a kind of gene amplification efficiency higher than another kind of gene, wherein a kind of amplification of gene may be suppressed, and finally causes the amplification efficiency of two kinds of genes in sample inconsistent.The present invention is by the design of primer and probe, and the optimization of reaction conditions, making the amplification efficiency of two kinds of genes in sample consistent, is consistent with the sensitivity that each substance reacts.
Distinguishing feature of the present invention is: the quick susceptibility fully using the efficient amplification of round pcr, the good specificity of hybridization techniques and detection technique of fluorescence, the discriminating detection that one-time detection operation can complete PCV1 and PCV2 is carried out to same sample, can determine that sample is that PCV1 infects, or PCV2 infects, or both co-infection.Have fast and convenient, high specificity, susceptibility are high, good reliability, reduction testing cost, improve the advantage such as detection efficiency.
Accompanying drawing explanation
Fig. 1 is PCV1 specific outcome schematic diagram
Fig. 2 is PCV2 specific outcome schematic diagram
Embodiment:
Following embodiment is provided to be to understand the present invention further better; be not limited to described preferred forms; content of the present invention and protection domain are not construed as limiting; anyone is under enlightenment of the present invention or any and the present invention the present invention being carried out combining with the feature of other prior aries and draw is identical or akin method and product, all drops within protection scope of the present invention.
Fluorescein is introduced:
Corresponding 1 passage of general instrument FAM, corresponding 2 passages of VIC, HEX, JOE, corresponding 3 passages of NED, TAMRA, corresponding 4 passages of CY3, ROX, corresponding 5 passages of CY5.
FAM: Fluoresceincarboxylic acid, Carboxyfluorescein, it is the one of fluorescein derivative, extensively be present in fluorescent labeling reagent box, also the 488nm spectral line of Argon-ion Laser is applicable to, Abs/Em=492/518nm(pH=9.0), there is the universal feature of fluorescein derivative, stable in water.
VIC: green fluorescent protein, Greenfluorescent protein, GFP are a kind of luminescent proteins coming from marine organisms multitube Medusa (AequoriaVictoria).
HEX: chlordene fluorescein, Hexachloro fluorescein are the one of fluorescein derivative.Be applicable to Argon-ionLaser excitation light source, Abs/Em=535/556nm.
JOE: carboxyl-4', 5'-bis-chloro-2', 7'-dimethoxyfluorescein, Carboxy-4', 5'-dichloro-2', JOE fluorescence quantum yield is high, and pH susceptibility is weak, is suitable for labelled protein.
TAMRA: full name carboxyl tetramethylrhodamine, i.e. Carboxytetramethylrhodamine are rhodamine fluorescein derivatives, and TAMRA is that a few can be used for labelled protein.
ROX:5-and 6-carboxy-X-rhodamine, correction dye.
Cy3 or Cy5, Modification are new fluorescence molecules, have good light stability, highly water-soluble and high fluorescence efficiency.Their excitation spectrum and Emission Spectrum Peals are respectively 548/562nm and 646/664nm.The molecular structure of Cy3 and Cy5 and molecular weight are all closely similar, but spectrum is between the two very open, and therefore, Cy3 and Cy5 is often used in a lot of double-colored experiment, as being widely used in gene chip and protein chip field.
NED:2 '-chloro-5 '-fluoro-7 ', the chloro-6-Fluoresceincarboxylic acid of 8 '-benzene-Isosorbide-5-Nitrae-two.
When above fluorescein detects, corresponding sense channel is the sense channel of the present invention in experimentation corresponding to FTC-3000 instrument used, those skilled in the art are repeating in process of the present invention, the different passage likely corresponding to fluorescein of instrument is different, two or more fluoresceins corresponding sense channel when using the first instrument is different simultaneously, and when using the second instrument, corresponding sense channel is likely identical.Aim of the present invention is, no matter uses which kind of instrument to carry out repetition the present invention, as long as when using same instrument, just can realize the present invention for the fluorescein marking the probe of porcine circovirus types 1 and 2 at different sense channels.
The source of experiment material of the present invention:
Biomaterial:
The source of the biological reagent used by the present invention and specification:
Pig circular ring virus 1 type (PCV1), porcine circovirus 2 type (PCV2), Pestivirus suis (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), Japanese B encephalitis virus (JEV), PRV (Pseudorabies virus) (PRV) and pig parvoviral (PPV), be so kind as to give by China Animal Disease Control And Prevention Center.
Applicant states, above biomaterial all has preservation in applicant laboratory, can provide for proof test from the applying date in Two decades years to the public.
The source of reagent of the present invention and specification:
RealMasterMix(Probe) test kit is purchased from Tian Gen biochemical technology company limited.
PCV1 and PCV2TaqMan probe and primer are synthesized by Jikang Biotechnology Co Ltd, Shanghai.
Biospin tissue gene group DNA extraction kit is purchased from Hangzhou BIOER Technology Co., Ltd.
Normal experiment method below in embodiment, see " Molecular Cloning: A Laboratory guide " third edition (Beijing: Science Press, 2002) that Sambrook etc. writes, the use of instrument is with reference to instrumentation specification sheets.
Embodiment 1. porcine circovirus types 1 and 2 dual real-time fluorescence PCR method Auele Specific Primer and probe screening
(1) primer of pig circular ring virus and probe design
The Auele Specific Primer of porcine circovirus PCV 1 and PCV2, refers to: the oligonucleotide chain about length 20 bases, the specific nucleotide acid fragment of pig circular ring virus ORF2 gene high conservative;
The specific probe of porcine circovirus PCV 1 and PCV2, refers to: length is the oligonucleotide chain between 13 to 30 bases, group such as fluorescence excitation such as its 5 ' end flag F AM or HEX etc., 3 ' self non-luminous quenching group of end mark.
According to the ORF2 gene specific high conservative region obtained, utilize Primer Express3.0 software design for multiple real-time fluorescent PCR amplification primer of porcine circovirus PCV 1 and PCV2 and TaqMan probe, the concrete sequence of primer pair and probe is in table 1.
The primer that table 1 screens for porcine circovirus types 1 and 2 dual real-time fluorescence and probe
Title | Sequence (5 '-3 ') | SEQ ID NO: |
PCV2-F1 | ATCCACTCCCCTGTCACCCT | 1 |
PCV2-F2 | CCCTGTCACCCTGGGTGAT | 2 |
PCV2-F3 | ATCCCCTGTCACCCTGGGT | 3 |
PCV2-R1 | CCGCTCTGTGCCCTTTGA | 4 |
PCV2-R2 | TCGTGCCCTTTGAATACTACAGAATA | 5 |
PCV2-R3 | CCTGTGCCCTTTGAATACTACAGA | 6 |
PCV2-P | FAM-TTAAGGTTGAATTCTGGCCCTGCTCCC-BHQ1 | 7 |
PCV1-F1 | TGTGGCGGGAGGAGTAGTTAAT | 8 |
PCV1-F2 | CGGGAGGAGTAGTTAATATAGGGGT | 9 |
PCV1-F3 | TGTGGCGGGAGGAGTAGTTAATATA | 10 |
PCV1-R1 | ACTGTTGTTATCTTGGATGCCAACT | 11 |
PCV1-R2 | CCACTGTTGTTATCTTGGATGCC | 12 |
PCV1-R3 | AGGGTCCACTGTTGTTATCTTGGA | 13 |
PCV1-P | HEX-TAACCCCCTCCACCAACTTGGCCTA-BHQ1 | 14 |
(2) reaction system of porcine circovirus types 1 and 2 dual real-time fluorescence PCR method and condition
The reaction system of porcine circovirus types 1 and 2 dual real-time fluorescence PCR method is in table 2, and reaction conditions is in table 3.
Table 2 porcine circovirus types 1 and 2 dual real-time fluorescence PCR method reaction system
Reaction reagent | Final concentration |
Reaction buffer is (containing MgCl 2, dNTP and TaqE) | 1× |
10pmoL/ μ L primer pair | 400nM |
10pmoL/ μ L probe | 200nM |
ROX dyestuff | 1× |
Template | 2μL |
Moisturizing extremely | 25μL |
The reaction conditions of table 3 porcine circovirus types 1 and 2 dual real-time fluorescence PCR method
(3) result judges
1. interpretation of result condition sets
2. detected result is read.Threshold setting principle, with the vertex of threshold line just above normal negative control amplification curve, is as the criterion to show result.
3. result describes and qualification
The amplification situation of contrast different primers pair and probe combinations, follows specificity principle, susceptibility principle and the highest amplification principle, and select specificity good, susceptibility is high, the porcine circovirus types 1 and 2 detection primer pair of good reliability and probe best of breed.(4) shaker test method and result
The optimal screening method of primer and probe is as follows:
Any selection pair of primers and a probe carry out combining and (as primer pair PCV1-F1/PCV1-R1, add probe PCV1-P; Primer pair PCV1-F2/PCV1-R2, adds probe PCV1-P; Primer pair PCV2-F1/PCV2-R1, adds probe PCV2-P; Etc.), can obtain minimum Ct value and the highest amplification efficiency for screening criteria simultaneously, select best primer and probe combinations.
By repeatedly repeating, simultaneous test, the best of breed of selected porcine circovirus types 1 and 2 detections primer pair and probe, combined sorting result figure summary, concrete sequence is in table 4
The best of breed sequence of table 4 porcine circovirus types 1 and 2 detection primer pair and probe
The optimization of embodiment 2. pig circular ring virus 1 type real-time fluorescence PCR detection method
(1) primer of pig circular ring virus 1 type real time fluorescent PCR method and probe design
The primer of pig circular ring virus 1 type real time fluorescent PCR method and probe design are see embodiment 1, and concrete sequence is in table 4.
(2) reaction system of pig circular ring virus 1 type real time fluorescent PCR method and condition
The optimization principles of pig circular ring virus 1 type real time fluorescent PCR method is: make same sample obtain maximum amplification efficiency and minimum Ct value by optimizing each condition following.
The determination of a, best fluorescent primer concentration: fluorescent primer concentration is screened between 300nM to 800nM.
The determination of b, best concentration and probe concentration: concentration and probe concentration is screened between 100nM to 500nM.
Through optimizing, the reaction system of pig circular ring virus 1 type real time fluorescent PCR method is in table 5, and reaction conditions is in table 6.
Table 5 pig circular ring virus 1 type real-time PCR detection system
Table 6 pig circular ring virus 1 type real-time PCR detection amplification condition
(3) result judges
1. interpretation of result condition sets
Read detected result.Threshold setting principle, with the vertex of threshold line just above normal negative controls amplification curve, is as the criterion to show result.
2. quality control standard
Negative control is without Ct value and without specific amplification curve;
The Ct value of positive control answers≤30, and occurs specific amplification curve.Otherwise it is invalid that this time experiment is considered as.
3. result describes and judges
Negative sample, without Ct value and without specific amplification curve, represents in sample without pig circular ring virus 1 type.
Positive sample Ct value≤30, and there is specific amplification curve, represent in sample have pig circular ring virus 1 type.
Effective principle: need to carry out revision test when sample Ct value is between 30 < Ct < 37.During revision test result Ct < 37, sample is positive, otherwise is negative.
(4) pattern detection test and result
Test is increased to Pestivirus suis (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), Japanese B encephalitis virus (JEV), PRV (Pseudorabies virus) (PRV) and pig parvoviral (PPV), and result only has pig circular ring virus 1 type (PCV1) to obtain specific amplified fluorescence curve.
The optimization of embodiment 3. porcine circovirus 2 type real-time fluorescence PCR detection method
(1) primer of porcine circovirus 2 type real time fluorescent PCR method and probe design
The primer of porcine circovirus 2 type real time fluorescent PCR method and probe design are see embodiment 1, and concrete sequence is in table 4.
(2) reaction system of porcine circovirus 2 type real time fluorescent PCR method and condition
The optimization principles of porcine circovirus 2 type real time fluorescent PCR method is: make same sample obtain maximum amplification efficiency and minimum Ct value by optimizing each condition following.
The determination of a, best fluorescent primer concentration: fluorescent primer concentration is screened between 300nM to 800nM.
The determination of b, best concentration and probe concentration: concentration and probe concentration is screened between 100nM to 500nM.
Through optimizing, the reaction system of porcine circovirus 2 type real time fluorescent PCR method is in table 7, and reaction conditions is in table 8.
Table 7 porcine circovirus 2 type real-time PCR detection system
Table 8 porcine circovirus 2 type real-time PCR detection amplification condition
(3) result judges
4. interpretation of result condition sets
Read detected result.Threshold setting principle, with the vertex of threshold line just above normal negative controls amplification curve, is as the criterion to show result.
5. quality control standard
Negative control is without Ct value and without specific amplification curve;
The Ct value of positive control answers≤30, and occurs specific amplification curve.Otherwise it is invalid that this time experiment is considered as.
6. result describes and judges
Negative sample, without Ct value and without specific amplification curve, represents in sample without porcine circovirus 2 type.
Positive sample Ct value≤30, and there is specific amplification curve, represent in sample have porcine circovirus 2 type.
Effective principle: need to carry out revision test when sample Ct value is between 30 < Ct < 37.During revision test result Ct < 37, sample is positive, otherwise is negative.
(4) pattern detection test and result
Test is increased to Pestivirus suis (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), Japanese B encephalitis virus (JEV), PRV (Pseudorabies virus) (PRV) and pig parvoviral (PPV), and result only has porcine circovirus 2 type (PCV2) to obtain specific amplified fluorescence curve.
Embodiment 4. porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection kit forms
1, PCR reaction solution: each reaction comprises reaction buffer (containing MgCl
2, dNTP and TaqE) 12.5 μ L, point be filled to 1mL serum tube, 750 μ L/ manage ,-20 DEG C of preservations;
2, fluorescent probe: each reaction comprises 10 μMs of probe PCV10.6 μ L, 10 μMs of probe PCV20.6 μ L and ROX dyestuff 0.5 μ L and forms, totally 1.7 μ L, divide and be filled to the brown serum tube of 0.5mL, 100 μ L/ manage ,-20 DEG C of preservations;
3, primer: each reaction comprises composition 10 μMs of PCV1 primer pair 1.8 μ L, 10 μMs of PCV2 primer pair 1.8 μ L, totally 3.6 μ L, divide and be filled to 0.5mL serum tube, 220 μ L/ manage ,-20 DEG C of preservations;
4, aseptic nuclease free water: divide and be filled to 0.5mL serum tube, 600 μ L/ manage ,-20 DEG C of preservations;
5, PCV1 positive control: the PCV1 virus liquid adding lysate, Ct value <30,600 μ L/ manage ,-20 DEG C of preservations.
6, PCV2 positive control: the PCV2 virus liquid adding lysate, Ct value <30,600 μ L/ manage ,-20 DEG C of preservations.
7, negative control: sterilizing deionized water, 600 μ L/ manage ,-20 DEG C of preservations.
8, Digestive system: 11ml/ bottle, divides and is filled in the white lid Plastic Bottle of white clear, room temperature preservation.
9, DNA is in conjunction with liquid: 16mL/ bottle, divides and is filled in the white lid Plastic Bottle of white clear, room temperature preservation.
10, DNA washings: 52mL/ bottle, divides and is filled in the white lid Plastic Bottle of white clear, room temperature preservation.
11, DNA elutriant: 4mL/ bottle, divides and is filled in the white lid Plastic Bottle of white clear, room temperature preservation.
12, DNA adsorption column and collection tube: 50 covers/bag, room temperature preservation.
The using method of embodiment 5. porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection kit
1 sample preparation
1.1 sample collectings: the pig dying of illness or slaughter, get the pathology such as lung, lymphoglandula portion and healthy portion intersection tissue; Live hog to be checked, gets blood 5mL with syringe.2 ~ 8 DEG C of preservations, send test in laboratory.(require that censorship pathological material of disease is fresh, forbid multigelation.)
1.2 sample preparation: every increment product process respectively.
1.2.1 tissue sample process: organize for every part and take sample from three different positions respectively and be about 1g, get 0.02g after shredding mixing with operating scissors to grind in mill, add 1.5mL physiological saline and continue grinding, go in 1.5mL sterile centrifugation tube after homogenate, the centrifugal 2min of 8000rpm, gets supernatant liquor 100 μ L in 1.5mL sterile centrifugation tube, then adds 200 μ L Digestive systems and 20 μ L Proteinase Ks, after vibration mixing, put in 56 DEG C of water-baths and digest 1 hour.
1.2.2 whole blood sample process: get serum 100 μ L after blood clotting, put in 1.5mL sterile centrifugation tube.
1.2.3 positive control process: get positive control 100 μ L, put in 1.5mL sterile centrifugation tube.
1.2.4 negative control process: get negative control 100 μ L, put in 1.5mL sterile centrifugation tube.
2 operation stepss
2.1 the extraction of viral DNA
2.1.1 take out sample hose, after being down to room temperature, adding 300 μ L DNA in conjunction with liquid (Biospin tissue gene group DNA extraction kit), put upside down mixing, moved in adsorption column by whole liquid, room temperature leaves standstill 3min, the centrifugal 30s of 10000rpm.
2.1.2 discard liquid in collection tube, add 500 μ L DNA washingss, the centrifugal 30s of 10000rpm.
2.1.3 repeating step 2.1.2.
2.1.4 liquid in collection tube is discarded, the centrifugal 30s of 10000rpm, to remove residual DNA washings.
2.1.5 adsorption column is put into new 1.5mL centrifuge tube, add the DNA elutriant 50 μ L of 56 DEG C of preheatings to post central authorities, room temperature places the centrifugal 30s of 2min, 10000rpm, and in centrifuge tube, liquid is template DNA.
3 real-time fluorescence PCR operations
3.2.1 reaction system preparation
If test sample, negative control and positive control summation are N, then reaction system is formulated as follows:
After the reaction system prepared above is fully mixed, each 23 μ L in each reaction tubes of packing.
3.2.2 amplification
Get the viral DNA 2 μ L dissolved in 2.1.5 respectively, add in respective reactor, mix and perform mark, wherein PCV-2 fluorescent reporter group is FAM, PCV-1 is Hex, and quenching group is None, and fluorescent PCR instrument carries out following reaction: 95 DEG C of 30s; 95 DEG C of 5s, 60 DEG C of 35s, 40 circulations, the second step of each circulation collects fluorescent signal respectively.
4 results judge
4.1 interpretation of result condition settings
Threshold setting principle: threshold line is set in the vertex just above negative control amplification curve.
4.2 results describe and judge
Also there is specific amplification curve in positive control Ct value≤30, negative control is without Ct value and without specific amplification curve, and experimental result is set up; If test sample FAM fluorescent signal Ct value≤30 also occur that specific amplification curve is that PCV-2 is positive; If test sample Hex fluorescent signal Ct value≤30 also occur that specific amplification curve is that PCV-1 is positive; Also there is specific amplification curve in test sample 30 < Ct < 37, carries out result judgement, as two times result is identical, be then judged to be the positive after need again trying again; During test sample Ct value >=37, exceed present method detection sensitivity scope, be judged to be feminine gender.
The compliance test result of embodiment 6. test kit of the present invention
1. specific test
Method provided by the invention is adopted to prepare 20120809, 20120811, the porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection kit of 20120816 3 lot numbers is respectively to porcine reproductive and respiratory syndrome virus (PRRSV), Japanese B encephalitis virus (JEV), PRV (Pseudorabies virus) (PRV), Pestivirus suis (CSFV), pig parvoviral (PPV), PK-15 cell and the negative pig lungs of pig circular ring virus, lymphoglandula, cardiac muscle carries out specific test, PCV1 detected result is negative (Fig. 1), PCV, 2 detected results are negative (Fig. 2), above this test kit of result sufficient proof has good specificity.
Detect porcine circovirus types 1 and 2 cell toxicant and other 2 strain 2 types and 1 strain 1 type, detected result is the positive.It is good that preliminary proof the method detects adaptability to pig circular ring virus.
2. sensitivity test
To PCV1 cell toxicant, extract according to embodiment 5DNA extracting method, 10 are carried out to the DNA obtained
-1to 10
-5gradient dilution, detects its sensitivity, the results are shown in Table 7.
To PCV2 cell toxicant, extract according to embodiment 5DNA extracting method, 10 are carried out to the DNA obtained
-1to 10
-6gradient dilution, detects its sensitivity, the results are shown in Table 9.
Table 9 porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection kit sensitivity results
The logarithm of Ct value and template copy numbers is linear, and the Ct value difference about 3.3 between adjacent two template concentrations, differ 10 times with the template concentrations calculated in theory, Ct value difference 3.3 conforms to.
3. replica test
Use the porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection kit of 20120809,20120811,20,120,816 3 lot numbers, 3 duplicate detection are carried out respectively, to determine batch interior repeatability of this method according to the DNA of using method to pig annulus 1 type and the 10 times of serial dilutions of 2 type cell culture fluids of embodiment 5; 3 batches of test kits detect same dilute sample, with determine this method batch between repeatability.The results are shown in Table 10.
Table 10 three batches of test kit replica test results
Detected result shows: variation within batch coefficient and interassay coefficient of variation are respectively 0.39% ~ 2.50% and 0.65% ~ 2.00%, are all less than 5%, illustrates that 20120809,20120811,20120816 these 3 batches of reagent have between good batch repeatable.
4. stability test
Use the porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection kit of 20120809,20120811,20,120,816 3 lot numbers, according to the using method of embodiment 5 to 3 samples, monthly carry out one-time detection, often criticize and do 3 repetitions, continue 6 months, the stability of detection kit.Result shows: 20120809, the porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection kit of 20120811,20,120,816 3 lot numbers, Ct value change in 6 months is little, illustrates that porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection kit had good stability in 6 months.
Claims (5)
1. porcine circovirus types 1 and 2 dual real-time fluorescence PCR detects a primer pair, it is characterized in that, specificity pig circular ring virus 1 type primer pair is the such as nucleotide sequence shown in SEQ ID NO:9 and SEQ ID NO:11;
Specificity porcine circovirus 2 type primer pair is the such as nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:6.
2. a porcine circovirus types 1 and 2 dual real-time fluorescence PCR detection probes and primer pair, it is characterized in that, described pig circular ring virus 1 type probe is the nucleotide sequence shown in SEQ ID NO:14, and described porcine circovirus 2 type probe is the nucleotide sequence shown in SEQ ID NO:7; Described pig circular ring virus 1 type primer pair is the such as nucleotide sequence shown in SEQ ID NO:9 and SEQ ID NO:11;
Specificity porcine circovirus 2 type primer pair is the such as nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:6.
3. comprise the composition of probe according to claim 2 and primer pair.
4. a test kit, is characterized in that, comprises composition described in claim 3.
5. test kit according to claim 4, is characterized in that, two kinds of probes use the fluorescein-labelled of different sense channel respectively, and described fluorescein is selected from the one in FAM, VIC, HEX, JOE, NED, TAMRA, CY3, ROX or CY5.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310275996.2A CN103305638B (en) | 2013-02-21 | 2013-07-02 | Dual real-time fluorescence PCR (Polymerase Chain Reaction) detection primer pair, probes, kit and detection method for type 1 and type 2 porcine circovirus |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2013100554192 | 2013-02-21 | ||
CN201310055419.2 | 2013-02-21 | ||
CN201310055419 | 2013-02-21 | ||
CN201310275996.2A CN103305638B (en) | 2013-02-21 | 2013-07-02 | Dual real-time fluorescence PCR (Polymerase Chain Reaction) detection primer pair, probes, kit and detection method for type 1 and type 2 porcine circovirus |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103305638A CN103305638A (en) | 2013-09-18 |
CN103305638B true CN103305638B (en) | 2015-06-24 |
Family
ID=49131354
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310275996.2A Active CN103305638B (en) | 2013-02-21 | 2013-07-02 | Dual real-time fluorescence PCR (Polymerase Chain Reaction) detection primer pair, probes, kit and detection method for type 1 and type 2 porcine circovirus |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103305638B (en) |
Families Citing this family (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106148564A (en) * | 2015-03-12 | 2016-11-23 | 四川出入境检验检疫局检验检疫技术中心 | A kind of method utilizing digital pcr detection circovurus type 2 viral level |
CN105274256A (en) * | 2015-10-30 | 2016-01-27 | 中国农业科学院兰州兽医研究所 | Taqman Real-time PCR kit for detecting porcine circovirus (PCV1) and using method of kit |
CN105648118B (en) * | 2016-03-14 | 2019-09-10 | 扬州大学 | A kind of method of TaqMan fluorescence quantitative PCR detection chimeric porcine circovirus type 1-2 |
CN109593883B (en) * | 2017-09-30 | 2022-06-21 | 洛阳普泰生物技术有限公司 | Porcine circovirus multiplex real-time fluorescent PCR detection primer pair, probe and prepared kit |
CN108456747A (en) * | 2018-05-14 | 2018-08-28 | 湖北省农业科学院畜牧兽医研究所 | A kind of multiple PCR detection kit differentiating pig circular ring virus |
CN110042166A (en) * | 2019-04-10 | 2019-07-23 | 山东省滨州畜牧兽医研究院 | Primer, kit and its application for double PCR detection pig Foxp3, IL-10 gene |
CN111676247A (en) * | 2020-06-30 | 2020-09-18 | 扬州大学 | Infectious clone construction, rescue and application of porcine reproductive and respiratory syndrome virus type 1 isolate |
CN111961761A (en) * | 2020-09-03 | 2020-11-20 | 扬州大学 | Primer probe group and kit for detecting different genotypes of porcine circovirus |
CN113025755B (en) * | 2021-03-30 | 2023-06-13 | 广东省农业科学院动物卫生研究所 | Reagent for detecting porcine circovirus type 2e and application thereof |
CN115478118A (en) * | 2022-06-28 | 2022-12-16 | 四川农业大学 | Taqman multiplex fluorescence quantitative PCR (polymerase chain reaction) detection method for porcine circovirus |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102277455A (en) * | 2011-08-22 | 2011-12-14 | 浙江省农业科学院 | Primer, probe and assay kit used for detecting porcine circovirus, porcine pseudorabies virus and porcine parvovirus |
CN102676698A (en) * | 2012-05-17 | 2012-09-19 | 贵州省畜牧兽医研究所 | PRV, PCV-2, PPV multiple PCR (Polymerase Chain Reaction) detection kit |
-
2013
- 2013-07-02 CN CN201310275996.2A patent/CN103305638B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102277455A (en) * | 2011-08-22 | 2011-12-14 | 浙江省农业科学院 | Primer, probe and assay kit used for detecting porcine circovirus, porcine pseudorabies virus and porcine parvovirus |
CN102676698A (en) * | 2012-05-17 | 2012-09-19 | 贵州省畜牧兽医研究所 | PRV, PCV-2, PPV multiple PCR (Polymerase Chain Reaction) detection kit |
Non-Patent Citations (1)
Title |
---|
王东方 等.猪圆环病毒1、2型多重PCR诊断方法建立及应用.《中国畜牧兽医学会家畜传染病学分会第七届全国会员代表大会暨第十三次学术研讨会论文集(上册)》.2009,518-521. * |
Also Published As
Publication number | Publication date |
---|---|
CN103305638A (en) | 2013-09-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103305638B (en) | Dual real-time fluorescence PCR (Polymerase Chain Reaction) detection primer pair, probes, kit and detection method for type 1 and type 2 porcine circovirus | |
CN110229932B (en) | African swine fever virus nucleic acid extraction-free fluorescent isothermal amplification detection kit | |
CN111172321B (en) | Fluorescent PCR detection kit for identifying African swine fever infection and immunity | |
CN111455107A (en) | Primer group, product, method and application for detecting feline respiratory pathogens | |
CN107955839A (en) | For detecting double PCR primer, detection method and the kit of 3 type of porcine circovirus 2 type and circovirus | |
CN109593883B (en) | Porcine circovirus multiplex real-time fluorescent PCR detection primer pair, probe and prepared kit | |
CN106399588B (en) | kit for detecting avian leukosis virus J subgroup | |
CN106399585A (en) | Universal PCR primers and method for detecting group I aviadenovirus and detection kit | |
CN107653348A (en) | For detecting the primer and probe of the type of pig circular ring virus 3, PCR kit for fluorescence quantitative and method, application | |
CN108504778A (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
CN111321248A (en) | African swine fever virus MGF-505R gene fluorescence PCR detection reagent, kit and application thereof | |
CN103352088B (en) | For detecting the primer pair of avian influenza virus H7 hypotype, probe, test kit and detection method | |
CN102212617B (en) | Primer pair, probe and kit for detecting classical swine fever virus wild strain | |
CN114790490A (en) | Molecular marker capable of distinguishing Brucella melitensis and detection method | |
CN107419034A (en) | Five boar diarrhea virus multiplex PCR quick diagnosis reagent kits and its application | |
CN110592278A (en) | Multiplex RT-PCR kit for PRoV, PoSaV and PAStV | |
CN110358864A (en) | The one-step method multiple real time fluorescence quantifying PCR detection primer and probe of SVA, FMDV, SVDV and VSV | |
CN110257561B (en) | Reagent for detecting deer epidemic hemorrhagic fever virus, detection method and application | |
CN116004922B (en) | Dual fluorescence PCR kit for detecting PCV2 and PCV3 of pigs | |
CN109355434B (en) | Fluorescent quantitative PCR kit for quantitatively detecting chicken Marek's virus (McV) Meq gene deletion vaccine strain and wild strain and application thereof | |
Takahagi et al. | Genotypic change of porcine circovirus type 2 on Japanese pig farms as revealed by restriction fragment length polymorphism analysis | |
AU2021101623A4 (en) | Dual-fluorescent pcr primer and detection kit for porcine circovirus type 2 and porcine circovirus type 3, and use thereof | |
CN105907894B (en) | Taqman real-time fluorescence PCR kit for detecting circovirus type II in piglet umbilical cord blood and application thereof | |
CN107574263A (en) | A kind of kit and method for the type of PCR quick detections pig circular ring virus 3 | |
CN104450969B (en) | Method for detecting porcine bocavirus type 1, type 2 and type 3 by multiple PCR |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |