CN103288966B - Fusion receptor and gene medicine thereof for treating colorectal cancer - Google Patents
Fusion receptor and gene medicine thereof for treating colorectal cancer Download PDFInfo
- Publication number
- CN103288966B CN103288966B CN201310184791.3A CN201310184791A CN103288966B CN 103288966 B CN103288966 B CN 103288966B CN 201310184791 A CN201310184791 A CN 201310184791A CN 103288966 B CN103288966 B CN 103288966B
- Authority
- CN
- China
- Prior art keywords
- gene
- strail
- edr4
- fusion
- ifas
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention provides a fusion receptor and a gene medicine thereof for treating colorectal cancer; the fusion receptor is formed by joining and fusing an eDR4 gene with an iFAS gene; the gene sequence of the fusion receptor is represented by SEQ ID NO.1; protein coded by the fusion receptor can be bonded to protein of a tumour related apoptosis inducing ligand TRAIL; the fusion acceptor gene and an sTRAIL gene are bonded to form the gene medicine capable of curing colorectal cancer; a use method of the gene medicine comprises the following steps of: driving sTRAIL gene expression by using a CAG constitutive promoter; driving fusion acceptor expression of the eDR4 gene and the iFAS gene by using a tumour specific Survivin promoter; carrying out signal transduction between the sTRAIL and iFAS fusion acceptor multiple target points through a DR acceptor and the eDR4 gene thereof; specifically inducing tumour cell apoptosis.
Description
[technical field]
The present invention relates to a kind of fusion receptors and be used for the treatment of the genomic medicine of large bowel cancer.
[background technology]
According to international cancer research institution statistics, in worldwide, large bowel cancer is in the cancer cause of the death the 3rd, and have the large bowel cancer new cases more than 1,000,000 every year, its occurrence probability is only second to lung cancer, mammary cancer.At present, the means of clinical treatment large bowel cancer have surgical operation (being applicable to early stage), chemotherapy, radiotherapy (side effect is large) etc., clinical existing medicine variety has taxol, gemcitabine (single variety result for the treatment of is limited) etc., for the deficiency of clinical treatment, solve clinical application problem in the urgent need to effective medicine.And therapy of tumor method day by day become the pharmacotherapy that continues, operative therapy and radiotherapy grow up treatment tumour the fourth-largest therapy.
Emerging gene therapy is one of advanced method of eradicate tumor cells, and its key obtains efficient gene to transmit carrier.The carrier of current gene therapy application mainly divides two classes: non-virus carrier and virus vector.Conventional non-virus carrier comprises polycation complexes carrier, nanoparticle vector, liposome etc., wherein comparatively efficient with liposome transfection cell.And conventional virus vector mainly comprises the carrier systems such as retrovirus (RV), adenovirus (AdV), adeno-associated virus (AAV), slow virus (LV) and hsv (HSV).AAV, because its no pathogenicity, reduced immunogenicity, pattern of infection are wide and can the advantage such as foreign gene-carrying expression steady in a long-term, is gene delivery vector ideal at present.Adopt the treatment of rAAV carrier mediated intestinal oncofetal gene to be a very promising treatment means, but the key that success is applied to clinical practice is how to improve targeting and the expression efficiency of therapeutic gene.
Tumour necrosis factor (tumor necrosis factor, TNF) relevant apoptosis induction ligand (TNF related apoptosis inducing ligand, TRAIL) be the antiapoptotic factors of the 3rd the TNF family found after TNF, FasL, cloned out by Wiley etc. from Autopsy Cases cDNA library.
TRAIL C holds extracellular region to be 114 ~ 281 amino acids that conservative property is strong, and can form typical β sandwich, be the position with receptors bind.Energy induced various types of tumors apoptosis after research confirmation TRAIL is combined with death receptor, and to most not normal cells effect; Find that T cell, NK cell, monocyte and the dendritic cell activated all can express TRAIL simultaneously.TRAIL biological activity when forming tripolymer is the strongest, and also in trimeric form during receptor activation, the zinc binding site of tripolymer near top plays an important role to the structure and stability that maintain TRAIL.Experiment in vitro shows, the TRAIL(sTRAIL of total length or soluble form) tripolymer that formed can rapid induction kinds of tumor cells apoptosis.Liu Xin wall academicians etc. adopt ZD55-TRAIL compound use also to have good result for the treatment of in Therapeutic cancer.This institute professors Xu Ruian etc. adopt mediated by adeno-associated virus vector sTRAIL to carry out the correlative study of Hepatoma therapy and Liver m etastases, the growth of its results show: sTRAIL energy Tumor suppression.
5 kinds of TRAIL acceptors are found so far: DR4, DR5, DcR1, DcR2 and OPG (osteoprotegerin, OPG).When TRAIL and DR4, DR5 in conjunction with time can inducing target cell apoptosis.Wherein DR4 is also known as TRAIL-RI, belongs to I type transmembrane receptor, containing 468 amino acid, is made up of DR4 extracellular region (eDR4), cross-film district and intracellular region 3 part.EDR4 can optionally in conjunction with TRAIL.
Fas has another name called CD95, and belong to TNFR/NGFR superfamily member, be I type transmembrane glycopeptide polymeric immunoglobulin receptor, be made up of 319 amino-acid residues, molecular weight is 36KD.People Fas has two kinds of forms: film mating type and soluble type, and its difference is with or without cross-film district, and solvable sFas is caused by translation of an alternately spliced transcript.In recent years, the research of Fas mediated apoptosis signal transduction mechanism makes great progress, mainly contain following approach: A) FasL and Fas combine after apoptotic signal is transduceed in cell, activate Caspase-8, cause Caspase cascade reaction finally to cause apoptosis; B) Bcl-2 family member Bid is cut into tBid by Caspase-8, and tBid promotes that plastosome release cells pigment C is to endochylema, activation Caspase-9, thus activation effect Caspase-3 and cause apoptosis; C) Zhenyue Hao etc. have found a kind of imperial albumen-Daxx that connects newly, after the death domain DD combination of Daxx and Fas, activate JNK signal path, finally cause apoptosis; D) FasL and Fas also can activated membrane sphingomyelinase after combining, and produces the ceramide of solubility and activates Caspase, cell death inducing.Nearest research finds, in liver cancer tissue, the expression of Fas albumen is significantly lower than Tumor-surrounding tissue, and this prompting promotes that liver cancer cell Fas expresses the treatment contributing to liver cancer.On the other hand, studies have found that, although TRAIL is had compared with the superiority of FasL in protection normal cell by the apoptosis of its DR acceptor to tumour, it still has unstable to the apoptosis-induced effect of tumour, and effect is not as Fas.
Survivin gene is that Ambrosini in 1997 etc. utilize effector cell's proteolytic enzyme acceptor-1cDNA to be separated in the screening by hybridization of human genomic library to obtain, be IAP newcomer first.Recent study find: Survivin finds the survivin that specificity is the strongest at present, and in most of malignant tumour specificity overexpression, tumour cell and tissue in there is stronger transcriptional activity.And Survivin promotor can mediate goal gene can be specific expressed in various tumour cell, and be not expressed in normal differentiated cells and static vascular endothelial cell, there is the tumor tissue specificity of height.Research shows: employing length is that the Survivin promoter targeting gene therapy of 980bp, 440bp, 260bp optionally kills tumour cell, on normal cell then without impact.
TRAIL is combined with its acceptor DR4 (death receptor4) selectivity efficient, with a kind of mode targeting mediate tumor cell apoptosis of high-efficiency low-toxicity, and to not normal cells side effect, has tumour cell targeting.FAS path is by multi-signal approach mediating apoptosis, and its intracellular region (intracellular FAS, iFAS) plays critical effect in transmission apoptotic signal, is the main path causing programmed cell death.Although iFas apoptosis induction effect is obviously better than TRAIL, specificity can not show a candle to TRAIL.
[summary of the invention]
One of the technical problem to be solved in the present invention, is to provide a kind of fusion receptors, can be applied in the genomic medicine of targeted therapy large bowel cancer, significantly can promote the apoptosis of colorectal cancer cells.
The present invention is one of the above-mentioned technical problem realized like this:
A kind of fusion receptors, described fusion receptors is connected fusion by eDR4 gene with iFAS gene to form, and the gene order of described fusion receptors is as shown in SEQ ID NO.1.
Further, the albumen coded by described fusion receptors can combine with the apoptosis induction ligand related trail protein of tumour.
The technical problem to be solved in the present invention two, is to provide a kind of genomic medicine being used for the treatment of large bowel cancer, significantly can promotes the apoptosis of colorectal cancer cells, can solve Partial tumors insensitive to TRAIL, the problem even tolerated.
The present invention is the above-mentioned technical problem two realized like this:
Be used for the treatment of a genomic medicine for large bowel cancer, described genomic medicine comprises a kind of fusion receptors gene and sTRAIL gene, and the gene order of described fusion receptors is as shown in SEQ ID NO.1.
Further, the using method of described genomic medicine is: use CAG constitutive promoter to drive sTRAIL destination gene expression, tumour-specific Survivin promoters driven eDR4 gene and iFAS gene fusion expression of receptor, sTRAIL carries out signal transduction, special inducing apoptosis of tumour cell by its DR acceptor and eDR4 gene and iFAS fusion receptors Mutiple Targets.
Further, described genomic medicine can carry out gene delivery by non-viral carrier systems or virus carrier system, treatment large bowel cancer.
Tool of the present invention has the following advantages:
1) utilize the advantage of both death receptor DR4 and acceptor FAS mediating apoptosis, design fusion receptors eDR4/iFAS.Utilize the feature that receptor-ligand combines, described fusion receptors is effectively combined with its ligand/TRAIL and reaches the object promoting target cell apoptosis.
2) use CAG constitutive promoter and tumour-specific Survivin promoters driven sTRAIL and the expression of described fusion receptors eDR4/iFAS in colorectal cancer cells respectively, thus reach the apoptosis of efficient, special induction colorectal cancer cells.Partial tumors can be solved insensitive to TRAIL, the problem even tolerated.
[accompanying drawing explanation]
The present invention is further illustrated in conjunction with the embodiments with reference to the accompanying drawings.
Fig. 1 is eDR4, iFAS and eDR4/iFAS gene fragment pcr amplification result of the present invention synthesis electrophorogram.
Fig. 2 is the electrophorogram of pAM-SVN-eDR4/iFAS recombinant plasmid of the present invention.
Fig. 3 is the qualification result electrophorogram of pAM-CAG-sTRAIL recombinant plasmid of the present invention.
Fig. 4 A is the cell survival rate histogram of the HEK293 cell recording 60h after transfection in the present invention with mtt assay.
Record the cell survival rate histogram of the HT-29 cell of 60h after transfection with mtt assay in Fig. 4 B the present invention.
Fig. 5 is that the present invention uses RT-PCR to detect the electrophorogram of the expression of eDR4/iFAS and sTRAIL gene in HT-29 cell.
Fig. 6 is that the present invention uses Western Blot to detect the electrophorogram of the expression of sTRAIL albumen in HT-29 cell.
Fig. 7 is that the present invention's fluorescent microscope observes the apoptosis situation microgram of HT29 cell from morphology.
Fig. 8 A is the apoptosis situation microgram of each group HT-29 cell after the present invention uses Hoechst33342 fluorescent dyeing to analyze transfection.
Fig. 8 B is each group HT-29 dyskaryosis rate histogram after the present invention uses Hoechst33342 fluorescent dyeing to analyze transfection.
Fig. 9 is after the present invention uses mtt assay to detect infection virus, the cell survival rate histogram of each group HT-29 cell.
Figure 10 is the eDR4/iFAS gene sequencing figure of the structure result of pAM-SVN-eDR4/iFAS carrier.
[embodiment]
Refer to shown in Fig. 1 ~ 10, embodiments of the invention are described in detail.
The present invention relates to a kind of fusion receptors, described fusion receptors is connected fusion by eDR4 gene with iFAS gene to form, and the gene order of described fusion receptors is as shown in SEQ ID NO.1.
Albumen coded by described fusion receptors can combine with the apoptosis induction ligand related trail protein of tumour.
The invention still further relates to a kind of genomic medicine being used for the treatment of large bowel cancer, described genomic medicine comprises fusion receptors gene and sTRAIL gene, and the gene order of described fusion receptors is as shown in SEQ ID NO.1.
The using method of described genomic medicine is: use CAG constitutive promoter to drive sTRAIL destination gene expression, tumour-specific Survivin promoters driven eDR4 gene and iFAS gene fusion expression of receptor, sTRAIL carries out signal transduction, special inducing apoptosis of tumour cell by its DR acceptor and eDR4 gene and iFAS fusion receptors Mutiple Targets.440bp Survivin promotor is adopted in the present invention.
Described genomic medicine can carry out gene delivery by non-viral carrier systems or virus carrier system, treatment large bowel cancer.
Below in conjunction with embodiment, the present invention is further illustrated.
Embodiment one, pAM-SVN-eDR4/iFAS and pAM-CAG-sTRAIL vector construction
1, the acquisition of eDR4/iFAS gene and vector construction
1) acquisition of eDR4/iFAS gene
Search the gene order analyzing death receptor DR4 extracellular region eDR4 at GenBank, and design corresponding Auele Specific Primer, together entrust the synthesis of Shanghai Sheng Gong biotechnology limited-liability company.
A) acquisition of eDR4 gene: the pUC57-eDR4/DH5 α glycerol stock of band eDR4 gene order is activated, plasmid pUC57-eDR4 is extracted according to plasmid Mini Kit (Beyotime), and with this plasmid for template uses Auele Specific Primer: Sense primer:CACGTGGGGATCCA CCATGGCGCCACCACCAGC; Antisense primer:
CTTCCTTTCTCTTACCTGAGCCGATGCAACAAC carries out PCR.The concrete reaction system of PCR is Pyrobest DNA Polymerase (Takara) 0.3 μ L, 10 × Pyrobest Buffer II5 μ L, dNTP Mixture (each 2.5mM) 4 μ L, plasmid pUC57-eDR40.2 μ L, primer S (20 μMs) 0.5 μ L, primer A (20 μMs) 0.5 μ L, ddH
2o39.5 μ L; Amplification condition is 94 DEG C of 5min → (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 90s) DEG C 10min → 4,30Cycles → 72 DEG C ∞.
Then, 2% agarose gel electrophoresis qualification PCR primer, qualification result is eDR4 gene, and rear use DNA gel reclaims test kit (Beyotime) and reclaims, and-20 DEG C save backup.Wherein qualification result is as shown in Fig. 1 swimming lane 3, and object clip size, between 750bp and 1000bp, is consistent with desired value 801bp.
B) acquisition of iFAS gene: pUC19-iFAS/DH5 α is activated, plasmid pUC19-iFAS is extracted according to plasmid Mini Kit (Beyotime), and with it for template uses Auele Specific Primer Sense primer:CGGCTCAGGTAAGAGAAAGGAAGTACAGAAAACATGC; Antisense primer:AATGAAATCCAAAGCTTGGTC carries out PCR, reaction system is Pyrobest DNA Polymerase (Takara) 0.3 μ L, 10 × Pyrobest Buffer II5 μ L, dNTP Mixture (each 2.5mM) 4 μ L, plasmid pUC19-iFAS0.2 μ L, primer S (20 μMs) 0.5 μ L, primer A (20 μMs) 0.5 μ L, ddH2O39.5 μ L; Amplification condition is 94 DEG C of 5min → (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 60s) DEG C 10min → 4,30Cycles → 72 DEG C ∞.
2% agarose gel electrophoresis qualification PCR primer, qualification result is iFAS gene, and rear use DNA gel reclaims test kit (Beyotime) and reclaims, and-20 DEG C save backup.Wherein qualification result is as shown in Fig. 1 swimming lane 2, and object clip size is positioned at 500bp slightly below, is consistent with desired value 435bp.
C) acquisition of eDR4 and iFAS gene fusion acceptor
After obtaining eDR4 gene and iFAS gene respectively, use the Sense primer of eDR4 gene order to carry out over-lap PCR with the Antisense primer of iFAS gene order these two gene fragments are connected, form fusion receptors gene eDR4/iFAS, over-lap PCR reaction system is as follows: Pyrobest DNA Polymerase (Takara) 0.3 μ L, 10 × Pyrobest Buffer II5 μ L, dNTP Mixture (each 2.5mM) 4 μ L, primer S, the each 0.5 μ L of primer A (20 μMs), eDR4PCR product 0.5 μ L, iFAS PCR primer 1 μ L, ddH
2o38.2 μ L, amplification condition is 94 DEG C of 5min → (94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 90s) DEG C 10min → 4,30Cycles → 72 DEG C ∞.
After 2% agarose electrophoresis qualification PCR primer is correct, the product namely obtained is eDR4 and iFAS fusion receptors, then reclaims.Wherein qualification result is as shown in Fig. 1 swimming lane 4, and object clip size is positioned at above 1000bp, is consistent with desired value 1235bp.
Fig. 1 is eDR4, iFAS and eDR4/iFAS gene fragment pcr amplification result of the present invention synthesis electrophorogram; Wherein swimming lane 1 is DNA molecular amount standard DL2000, and swimming lane 2 is the pcr amplified fragment of iFAS, and swimming lane 3 is the pcr amplified fragment of eDR4, and swimming lane 4 is the over-lap PCR amplified fragments of eDR4/iFAS.Electrophorogram shows: the data fit of eDR4, iFAS and eDR4/iFAS gene fragment size that pcr amplification obtains and expection.
2) structure of pAM-SVN-eDR4/iFAS carrier
Use BamH I and EcoR I restriction endonuclease to carry out enzyme eDR4 and the iFAS of acquisition fusion receptors to cut, the enzyme system of cutting is: eDR4/iFAS PCR primer 20 μ L, 10 × K3 μ L, EcoR I 0.5 μ L BamH I 0.5 μ L, ddH
2o6 μ L, reaction conditions is: 37 DEG C, 3h.After endonuclease reaction terminates, carry out DNA gel recovery to digestion products, recovery product is put-20 DEG C and is saved backup;
Use EcoR I and BamH I to carry out enzyme and cut pAM-SVN-sTRAIL plasmid.In 1.5mL centrifuge tube, be prepared as follows double digestion reaction system: 10 × K5 μ L, plasmid DNA (2 μ g/ μ L) 40 μ L, EcoR I 1 μ L, BamH I 1 μ L, ddH
2o3 μ L, reaction conditions is: 37 DEG C, 3h.Endonuclease reaction terminates rear recovery carrier segments pAM-SVN and sTRAIL fragment respectively;
Object fragment eDR4/iFAS after EcoR I, BamH I double digestion with carry out ligation through the carrier segments pAM-SVN of EcoR I, BamH I double digestion.In 1.5mL centrifuge tube, be prepared as follows ligation system: object fragment 8 μ L, carrier segments 0.5 μ L, 10 × T4 damping fluid 1 μ L, the precious biotechnology company limited in T4DNA ligase(Dalian) 0.5 μ L.Reaction conditions is 16 DEG C, spends the night, and obtains connecting product, i.e. pAM-SVN-eDR4/iFAS carrier.
By above-mentioned connection product conversion in E. coli DH5 α competent cell, coating LB/Amp+ is dull and stereotyped, obtain the engineering bacteria being with recombinant plasmid pAM-SVN-eDR4/iFAS, extraction pAM-SVN-eDR4/iFAS plasmid carries out enzyme and cuts qualification, and endonuclease reaction result as shown in Figure 2.
Fig. 2 is the electrophorogram of pAM-SVN-eDR4/iFAS recombinant plasmid of the present invention.Swimming lane 1 is DNA molecular amount standard DL15000, and swimming lane 2 is pAM empty plasmid, and swimming lane 3 is the collection of illustrative plates that Xho I/BamH I enzyme cuts pAM-SVN-eDR4/iFAS plasmid, and swimming lane 4 is the collection of illustrative plates that BamH I/EcoR I enzyme cuts pAM-SVN-eDR4/iFAS plasmid.Wherein, swimming lane 3 is Xho I/BamH I double digestion result, and wherein small segment is SVN promoter gene fragment, is presented at above 250bp, conforms to the SVN promoter gene size 440bp of expection.Swimming lane 4 is BamH I/EcoR I double digestion result, and wherein small segment is eDR4/iFAS gene fragment, is presented at above 1000bp, conforms to the eDR4/iFAS gene size of expection.Double digestion qualification result shows that pAM-SVN-eDR4/iFAS recombinant plasmid successfully builds.
Above-mentioned connection product is through Shanghai Sheng Gong biotechnology limited-liability company gene sequencing, and sequencing result (as shown in Figure 10) is completely the same with the eDR4/iFAS gene order of design, proves the success of pAM-SVN-eDR4/iFAS construction of recombinant plasmid further.
2, the structure of pAM-CAG-sTRAIL carrier
EcoR I and BamH I nucleic acid restriction endonuclease is used to carry out double digestion to pAM-CAG-eGFP plasmid, reclaim carrier segments pAM-CAG, and be connected with the sTRAIL fragment through EcoR I and BamH I double digestion, ligation process is, in 1.5mL centrifuge tube, be prepared as follows ligation system: object fragment 8 μ L, carrier segments 0.5 μ L, 10 × T4 damping fluid 1 μ L, the precious biotechnology company limited in T4DNA ligase(Dalian) 0.5 μ L.Reaction conditions is 16 DEG C, spends the night, and obtains connecting product.
By this connection product conversion in E. coli DH5 α competent cell, coating LB/Amp+ is dull and stereotyped, obtains the engineering bacteria being with recombinant plasmid pAM-CAG-sTRAIL, and extraction plasmid carries out enzyme and cuts qualification, and the electrophorogram of qualification result as shown in Figure 3.Fig. 3 is the qualification result electrophorogram of pAM-CAG-sTRAIL recombinant plasmid of the present invention.Swimming lane 1 is DNA molecular amount standard DL15,000; Swimming lane 2 is pAM-CAG-sTRAIL plasmid, and swimming lane 3 cuts pAM-CAG-sTRAIL plasmid for BamH I enzyme, and swimming lane 6 is DNA molecular amount standard DL2000.Wherein, swimming lane 4 is Xho I/BamH I double digestion pAM-CAG-sTRAIL plasmid, and restriction enzyme mapping small segment is CAG promotor, and size is positioned at about 1000bp, conforms to desired value; Swimming lane 5 is BamH I/EcoR I double digestion pAM-CAG-sTRAIL plasmid, and it is sTRAIL gene that enzyme cuts small segment, and size is between 500bp and 750bp, conforms to desired value 575bp.Electroresis appraisal result shows:
PAM-CAG-sTRAIL recombinant plasmid successfully builds.
Embodiment two, recombinant plasmid are on the impact of cell survival and apoptosis
1, a large amount of extraction, purification of Recombinant plasmid
Utilize QIAGEN plasmid Mega Kit reagent to carry out a large amount of extractions, the purifying of recombinant plasmid pAM-CAG-eGFP, pAM-SVN-eDR4/iFAS and pAM-CAG-sTRAIL, and use ultraviolet spectrophotometer to record the A of above-mentioned three kinds of recombinant plasmid nucleic acid DNAs respectively
260/ A
280ratio, and to be all in 1.8 ~ 2.0 normal ranges.
2, mtt assay measures cell survival rate
The cell that the present embodiment adopts is human embryonic kidney cell line HEK293 and Human Large Intestine Carcinoma Cells strain HT-29, all cells all containing 10% foetal calf serum (GIBCO), 100U/ml penbritin and 100 μ g/mL Vetstreps (Sigma) DMEM substratum (GIBCO) in, 37 DEG C, 5%CO
2, saturated humidity normal environment conditions under carry out cultured continuously.Day before transfection, cell is with 10
4the amount in individual/hole is inoculated in 96 orifice plates.Adopting Lipofectamine2000(Invitrogen) reagent carries out transient transfection cell, and operation is to specifications carried out, and transfection is respectively organized plasmid consumption and is 0.2 μ g, and wherein the plasmid ratio of cotransfection group is 1:1.After transfection, 60h adds MTT and detects.
Fig. 4 A is the cell survival rate histogram of the HEK293 cell recording 60h after transfection with mtt assay; Fig. 4 B is the cell survival rate histogram of the HT-29 cell recording 60h after transfection with mtt assay; In human embryonic kidney cell line HEK293 cell, there is not significant difference in each group of cell survival rate of transfected plasmids; And in HT-29 cell, the cell survival rate of sTRAIL group is 40.9%, and the cell survival rate that (eDR4/iFAS+sTRAIL) organizes is 21.6%, there is significant difference (p<0.05) between the two, namely illustrate that eDR4/iFAS and sTRAIL combination is than the apoptosis better effects if of sTRAIL to HT-29 cell.
3, the expression of RT-PCR testing goal gene
After transfection 48h, Trizol Reagent (Invitrogen) is adopted to carry out Total RNAs extraction (starting thus to operate on ice), carry out reverse transcription (related reagent is purchased from Zoman) at once: add Reaction Buffer (5 ×) 10 μ L, dNTP (10mM) 1 μ L, Rnasin (40U/ μ L) 1 μ L, M-MuLV ThermoScript II (RNase H-) 2 μ L, Random Primer1 μ L, total serum IgE 5 μ L, supplement ddH2O to the 50 μ L through DEPC process, latter 65 DEG C of abundant mixing, 5min; 4 DEG C, 10min; 25 DEG C, 10min; 42 DEG C, 50min; 70 DEG C of heating 15min inactivation M-MuLV ThermoScript II (RNase H-).(reverse transcription product can be directly used in follow-up PCR reaction, also can-20 DEG C of frozen preparing against use later.）
Take reverse transcription product as template, carry out common PCR reaction, reaction system and process are as described in the structure of the structure of pAM-SVN-eDR4/iFAS carrier in example one and the carrier construction of pAM-CAG-sTRAIL carrier.As shown in Figure 5, Fig. 5 is that the present invention uses RT-PCR to detect the electrophorogram of the expression of eDR4/iFAS and sTRAIL gene in HT-29 cell to detected result.Wherein swimming lane 1 is eGFP group, and swimming lane 2 is sTRAIL group, and swimming lane 3 is eDR4/iFAS group, and swimming lane 4 is eDR4/iFAS and sTRAIL cotransfection group; Result display sTRAIL and fusion receptors eDR4/iFAS can express in HT-29 cell.
4, the expression of Western Blot testing goal albumen
After plasmid 48h is respectively organized in transfection, with lysate cracking HT-29 cell (operating on ice), after abundant cracking, collecting cell fragment and lysate 4 DEG C, get supernatant after 14000rpm, 30min are centrifugal.Protein concentration is measured through BCA protein concentration detection kit (Beyotime), get 50 μ g albumen supernatants and carry out 12%SDS-PAGE electrophoresis, carry out transferring film afterwards, cut target protein band, close with 5% skim-milk and spend the night, correspondence primary antibodie (mouse anti human TRAIL primary antibodie is added by 1:500, Santa), hatch 2h for 37 DEG C, wash 3 times with TBST, hatch 2h with two anti-(goat anti-mouse IgG-HRP, the Beyotime) of 1:1000, wash 3 times with TBST again, develop by ECL detection kit (Beyotime).As shown in Figure 6, Fig. 6 is that the present invention uses Western Blot to detect the electrophorogram of the expression of sTRAIL albumen in HT-29 cell to detected result.Wherein swimming lane 1 is eGFP group, and swimming lane 2 is sTRAIL group, and swimming lane 3 is eDR4/iFAS and sTRAIL cotransfection group.As shown in Figure 6, the expression of sTRAIL albumen can be detected in HT-29 cell.
5, apoptotic detection
1) morphologic detection
After cell transient transfection 48h, use the cell state after the different plasmid of fluorescence microscope transfection, finishing analysis respectively organizes the change of morphocytology, the results are shown in Figure 7.Fig. 7 is the apoptosis situation of HT29 cell observed by the present invention's fluorescent microscope microgram from morphology, and can find out the cell shrinkage of sTRAIL group and eDR4/iFAS and sTRAIL cotransfection group from figure, become circle, cellular form is similar to positive controls.
2) Hochest staining examine
Open disposable sterilized cell cultures 6 orifice plate, drip 200 μ L PBS/ holes, the general cover glass through high pressure steam sterilization process is carefully put into successively and cultivates at the bottom of plate hole, every hole inoculation 10
5individual HT-29 cell, uses Lipofectamine2000 to carry out transfection for second day, often organizes 4 μ g plasmid DNA.After transfection 48h, discard culture supernatant, add cell dyeing damping fluid, Hoechst staining fluid (Beyotime) ice bath 20 ~ 30min successively according to the ratio of 1:200.After dyeing, precooling PBS washes twice, and directly at fluorescence microscopy Microscopic observation, the results are shown in Figure 8.Fig. 8 A is the microgram of the apoptosis situation of each group HT-29 cell after the present invention uses Hoechst33342 fluorescent dyeing to analyze transfection, and Fig. 8 B is each group HT-29 dyskaryosis rate histogram after the present invention uses Hoechst33342 fluorescent dyeing to analyze transfection.
Result shows, obvious than other control groups of the apoptosis of eDR4/iFAS and sTRAIL group.This further illustrates fusion receptors eDR4/iFAS and sTRAIL combination and really can induce HT-29 apoptosis.
The packaging of embodiment three, rAAV2, purifying and active checking thereof
1, the packaging of rAAV2
The present invention uses conventional calcium phosphate coprecipitation method transfected HEK 293, and utilize three pUC pUC packaging rAAV2, packaging rAAV2 comprises rAAV2.eGFP, rAAV2.sTRAIL and rAAV2.eDR4/iFAS, and wherein rAAV2.eGFP as a control group.
2, the purifying of rAAV2
Results virus after transfection 64h.After collecting cell, multigelation lysing cell, CsCl density gradient centrifugation purified virus, PBS dialyses three times.
3, mtt assay measures cell survival rate
24h before virus infection, inoculates HT-29 cell, 10 in 96 porocyte culture plates
4individual cells/well.RAAV2.eGFP, rAAV2.eDR4/iFAS, rAAV2.sTRAIL virus after purifying is through 0.22 μm of frit, if 3 parallel multiple holes.RAAV2.eGFP, rAAV2.eDR4/iFAS, rAAV2.sTRAIL tri-independent infected group, infection multiplicity is MOI=10
4vg/cell;
RAAV2.eDR4/iFAS and rAAV2.sTRAIL is infected group simultaneously, and often kind of virus infection plural number is MOI=5 × 10
3vg/cell.After virus infection, 4h is replaced with perfect medium, continues to cultivate 72h.Every hole adds 20 μ L MTT solution (5mg/mL, i.e. 0.5%MTT), continues to cultivate 4h.Stop cultivating, carefully suck nutrient solution in hole, every hole adds 150 μ LDMSO and dissolves the crystallisate generated, and puts 10min that cell plate vibrator vibrates, makes it fully dissolve.Microplate reader detects the light absorption value at OD490nm place, each hole.As shown in Figure 9, Fig. 9 is after the present invention uses mtt assay to detect infection virus to result, the cell survival rate histogram of each group HT-29 cell.Result shows: in HT-29 cell, the cell survival rate of sTRAIL group is 46.9%, and the cell survival rate that (eDR4/iFAS+sTRAIL) organizes is 27.9%, significant difference (p<0.05) is there is between the two, consistent with the result of liposome transfection plasmid, prove no matter (eDR4/iFAS+sTRAIL) this genomic medicine significantly can promote colon cancer cells apoptosis with non-virus carrier or with viral vector delivery.And coinfection group (rAAV2.eDR4/iFAS+rAAV2.sTRAIL) compares with rAAV2.sTRAIL infected group, coinfection group energy significance ground reduces the cell survival rate of HT-29 cell, and the expression demonstrating the fusion receptors eDR4/iFAS increased on cytolemma can promote cancer cell-apoptosis to significance.
The present invention utilizes the advantage of both death receptor DR4 and acceptor FAS mediating apoptosis, designs fusion receptors eDR4/iFAS.Utilize the feature that receptor-ligand combines, described fusion receptors is effectively combined with its ligand/TRAIL and reaches the object promoting target cell apoptosis.
Then, use CAG constitutive promoter and tumour-specific Survivin promoters driven sTRAIL and the expression of described fusion receptors eDR4/iFAS in colorectal cancer cells respectively, thus reach the apoptosis of efficient, special induction colorectal cancer cells.Partial tumors can be solved insensitive to TRAIL, the problem even tolerated.
Although the foregoing describe the specific embodiment of the present invention; but be familiar with those skilled in the art to be to be understood that; specific embodiment described by us is illustrative; instead of for the restriction to scope of the present invention; those of ordinary skill in the art, in the modification of the equivalence done according to spirit of the present invention and change, should be encompassed in scope that claim of the present invention protects.
In addition, the nucleotide sequence of involved in the present invention a kind of fusion receptors and the genomic medicine that is used for the treatment of large bowel cancer thereof is shown in appended Nucleotide or aminoacid sequence table.
Claims (5)
1. a fusion receptors, is characterized in that: described fusion receptors is connected fusion by DR4 Extracellular domain with FAS intracellular region gene to form, and the gene order of described fusion receptors is as shown in SEQ ID NO.1.
2. a kind of fusion receptors according to claim 1, is characterized in that: the albumen coded by described fusion receptors can combine with the apoptosis induction ligand related trail protein of tumour.
3. be used for the treatment of a genomic medicine for large bowel cancer, it is characterized in that: described genomic medicine comprises fusion receptors gene according to claim 1 and sTRAIL gene.
4. a kind of genomic medicine being used for the treatment of large bowel cancer as claimed in claim 3, it is characterized in that: the using method of described genomic medicine is: use CAG constitutive promoter to drive sTRAIL destination gene expression, tumour-specific Survivin promoters driven DR4 Extracellular domain according to claim 1 and FAS intracellular region gene fusion expression of receptor, sTRAIL carries out signal transduction, special inducing apoptosis of tumour cell by its DR acceptor and DR4 Extracellular domain according to claim 1 and FAS intracellular region fusion receptors Mutiple Targets.
5. a kind of genomic medicine being used for the treatment of large bowel cancer as described in claim 3 or 4, is characterized in that: described genomic medicine can carry out gene delivery by non-viral carrier systems or virus carrier system, treatment large bowel cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310184791.3A CN103288966B (en) | 2013-05-17 | 2013-05-17 | Fusion receptor and gene medicine thereof for treating colorectal cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310184791.3A CN103288966B (en) | 2013-05-17 | 2013-05-17 | Fusion receptor and gene medicine thereof for treating colorectal cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103288966A CN103288966A (en) | 2013-09-11 |
| CN103288966B true CN103288966B (en) | 2015-01-21 |
Family
ID=49090540
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310184791.3A Expired - Fee Related CN103288966B (en) | 2013-05-17 | 2013-05-17 | Fusion receptor and gene medicine thereof for treating colorectal cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103288966B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1552734A (en) * | 2003-05-28 | 2004-12-08 | 中国医学科学院基础医学研究所 | Recombination glant associated virus carrier induced TNF concerned cytonecrosis ligand peptide segment and its use |
| CN101076540A (en) * | 2004-07-29 | 2007-11-21 | 冬姆佩制药股份公司 | Tumor-homing cells engineered to produce tumor necrosis factor-related apoptosis-inducing ligand |
| CN101173299A (en) * | 2007-10-09 | 2008-05-07 | 浙江理工大学 | Construction and application of tumour targeting gonad correlation viral vectors |
-
2013
- 2013-05-17 CN CN201310184791.3A patent/CN103288966B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1552734A (en) * | 2003-05-28 | 2004-12-08 | 中国医学科学院基础医学研究所 | Recombination glant associated virus carrier induced TNF concerned cytonecrosis ligand peptide segment and its use |
| CN101076540A (en) * | 2004-07-29 | 2007-11-21 | 冬姆佩制药股份公司 | Tumor-homing cells engineered to produce tumor necrosis factor-related apoptosis-inducing ligand |
| CN101173299A (en) * | 2007-10-09 | 2008-05-07 | 浙江理工大学 | Construction and application of tumour targeting gonad correlation viral vectors |
Non-Patent Citations (2)
| Title |
|---|
| TRAIL受体在老年结肠癌中的表达及临床意义;刘亚民等;《中国老年学杂志》;20070831;第27卷;1597-1598 * |
| 死亡受体Fas在TRAIL联合三氧化二砷诱导人胃癌细胞凋亡中的作用;段晓秋等;《癌变·畸变·突变》;20121112;第24卷(第6期);422-426 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103288966A (en) | 2013-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104140974B (en) | Encode the nucleic acid of the Chimeric antigen receptor albumen of GPC 3 and express the T lymphocytes of the Chimeric antigen receptor albumen of GPC 3 | |
| Jia et al. | Cancer gene therapy targeting cellular apoptosis machinery | |
| ES2340400T3 (en) | CELLS LOCATED IN TUMORS MODIFIED BY GENETIC ENGINEERING TO PRODUCE BINDING APOPTOSIS INDUCTOR RELATED TO THE TUMOR NECROSIS FACTOR (TRAIL). | |
| WO2019062518A1 (en) | New dual chimeric antigen receptor-t cell which can be regulated, construction method therefor and use thereof | |
| CN110343665B (en) | CAR-T cell and application thereof | |
| CN111606999B (en) | Replicative oncolytic adenovirus with functions of activating immune co-stimulatory signaling pathway and blocking immune checkpoint and application thereof | |
| WO2018118967A1 (en) | Armed replication-competent oncolytic adenoviruses | |
| Yang et al. | A novel fiber chimeric conditionally replicative adenovirus-Ad5/F35 for tumor therapy | |
| CN101565718A (en) | Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof | |
| Stoff-Khalili et al. | Gene transfer to carcinoma of the breast with fiber-modified adenoviral vectors in a tissue slice model system | |
| CN103288966B (en) | Fusion receptor and gene medicine thereof for treating colorectal cancer | |
| CN104892770B (en) | It is a kind of that there is efficient infection to T cell and candidate stem cell and promote the slow virus carrier of multiplication capacity | |
| CN108285489A (en) | Target the Chimeric antigen receptor and application thereof of BCMA-BBz-tEGFR | |
| CN105367661B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, the NKT cell of engineering HER1 targeting and its application | |
| Du et al. | Apoptin-modified human mesenchymal stem cells inhibit growth of lung carcinoma in nude mice | |
| Mocellin | Targeting death receptors to fight cancer: from biological rational to clinical implementation | |
| Zhang et al. | Combination of Caspy2 and IP-10 gene therapy significantly improves therapeutic efficacy against murine malignant neoplasm growth and metastasis | |
| Kanerva et al. | Gene therapy of gynaecological diseases | |
| CN103933557B (en) | A kind of gliomatous two-ways regulation therapeutic vaccine and preparation method thereof | |
| Yamaguchi et al. | Adenovirus-mediated transfection of caspase-8 sensitizes hepatocellular carcinoma to TRAIL-and chemotherapeutic agent-induced cell death | |
| He et al. | Adeno-associated virus-mediated expression of recombinant CBD–HepII polypeptide of human fibronectin inhibits metastasis of breast cancer | |
| CN104788571B (en) | The fusion protein and its construction method and application that a kind of targeting antineoplastic vascular suppresses | |
| CN112996909B (en) | Oncolytic viruses expressing PD-1 binding proteins and uses thereof | |
| Xue et al. | Efficacy of recombinant adenovirus expressing a fusion gene from GM-CSF and Epstein-Barr virus LMP2A in a mouse tumor model | |
| Zhang et al. | Chimeric adenoviral vector Ad5F35L containing the Ad5 natural long-shaft exhibits efficient gene transfer into human T lymphocytes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150121 Termination date: 20150517 |
|
| EXPY | Termination of patent right or utility model |