CN103288966A - Fusion receptor and gene medicine thereof for treating colorectal cancer - Google Patents
Fusion receptor and gene medicine thereof for treating colorectal cancer Download PDFInfo
- Publication number
- CN103288966A CN103288966A CN2013101847913A CN201310184791A CN103288966A CN 103288966 A CN103288966 A CN 103288966A CN 2013101847913 A CN2013101847913 A CN 2013101847913A CN 201310184791 A CN201310184791 A CN 201310184791A CN 103288966 A CN103288966 A CN 103288966A
- Authority
- CN
- China
- Prior art keywords
- gene
- edr4
- ifas
- strail
- fusion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a fusion receptor and a gene medicine thereof for treating colorectal cancer; the fusion receptor is formed by joining and fusing an eDR4 gene with an iFAS gene; the gene sequence of the fusion receptor is represented by SEQ ID NO.1; protein coded by the fusion receptor can be bonded to protein of a tumour related apoptosis inducing ligand TRAIL; the fusion acceptor gene and an sTRAIL gene are bonded to form the gene medicine capable of curing colorectal cancer; a use method of the gene medicine comprises the following steps of: driving sTRAIL gene expression by using a CAG constitutive promoter; driving fusion acceptor expression of the eDR4 gene and the iFAS gene by using a tumour specific Survivin promoter; carrying out signal transduction between the sTRAIL and iFAS fusion acceptor multiple target points through a DR acceptor and the eDR4 gene thereof; specifically inducing tumour cell apoptosis.
Description
[technical field]
The present invention relates to a kind of fusion receptors and be used for the treatment of the genomic medicine of large bowel cancer.
[background technology]
According to international cancer research institution statistics, in worldwide, large bowel cancer is in the 3rd of the cancer cause of the death, has every year to surpass 1,000,000 the newly-increased case of large bowel cancer, and its occurrence probability is only second to lung cancer, mammary cancer.At present, the means of clinical treatment large bowel cancer have surgical operation (being applicable to early stage), chemotherapy, radiotherapy (side effect is big) etc., clinical existing medicine variety has taxol, gemcitabine (the single variety result for the treatment of is limited) etc., at the deficiency of clinical treatment, press for effective medicine and solve the clinical application problem.And the therapy of tumor method day by day become the pharmacotherapy that continues, operative therapy and radiotherapy grow up the treatment tumour the fourth-largest therapy.
Emerging gene therapy is to eradicate one of advanced method of tumour cell, and its key is to obtain efficient gene to transmit carrier.The gene therapy application carrier is mainly divided two classes at present: non-virus carrier and virus vector.Non-virus carrier commonly used comprises polycation complexes carrier, nano particle carrier, liposome etc., and is wherein comparatively efficient with the liposome transfection cell.And virus vector commonly used mainly comprises retrovirus (RV), adenovirus (AdV), adeno-associated virus (AAV), slow virus (LV) and hsv carrier systems such as (HSV).AAV because of its no pathogenicity, reduced immunogenicity, pattern of infection extensively and can carry advantage such as foreign gene expressions steady in a long-term, be present comparatively desirable gene delivery vector.Adopting the carrier mediated intestinal oncofetal gene treatment of rAAV is a very promising treatment means, but can the key that be successfully applied to clinical practice be how to improve targeting and the expression efficiency of therapeutic gene.
Tumour necrosis factor (tumor necrosis factor, TNF) Xiang Guan apoptosis induction ligand (TNF related apoptosis inducing ligand, TRAIL) be the antiapoptotic factors of the 3rd TNF family after TNF, FasL, finding, come out by clone from people's cardiac muscle cDNA library such as Wiley.
TRAIL C end extracellular region is 114～281 strong amino acids of conservative property, and it is sandwich to form typical β, is the position with receptors bind.Studies confirm that TRAIL can induce the kinds of tumor cells apoptosis after death receptor is combined, and to most normal cell free of toxic effects; Find that simultaneously activated T cells, NK cell, monocyte and dendritic cell all can express TRAIL.TRAIL biological activity when forming tripolymer is the strongest, also is trimeric form during receptor activation, and near the zinc binding site the tripolymer top plays an important role to structure and the stability of keeping TRAIL.Experiment in vitro shows, the TRAIL(sTRAIL of total length or soluble form) tripolymer that forms can rapid induction kinds of tumor cells apoptosis.The compound uses of employing ZD55-TRAIL such as Liu Xin wall academician also have good result for the treatment of in the treatment cancer.Employing mediated by adeno-associated virus vector sTRAIL such as professor Xu Ruian of this institute have carried out the correlative study for the treatment of liver cancer and hepatic metastases tumour, and its experimental result proves: sTRAIL can suppress growth of tumor.
5 kinds of TRAIL acceptor: DR4, DR5, DcR1, DcR2 and OPG (osteoprotegerin protects ossein) have been found so far.When TRAIL with DR4, can induce the target cell apoptosis when DR5 is combined.Wherein DR4 claims TRAIL-RI again, belongs to I type transmembrane receptor, contains 468 amino acid, by DR4 extracellular region (eDR4), stride the film district and 3 parts of intracellular region are formed.EDR4 can be optionally in conjunction with TRAIL.
Fas has another name called CD95, belongs to the TNFR/NGFR superfamily member, is I type transmembrane glycopeptide polymeric immunoglobulin receptor, is made up of 319 amino-acid residues, and molecular weight is 36KD.People Fas has two kinds of forms: film mating type and solvable type, its difference are to have or not strides the film district, and soluble sFas is because due to the translation of an alternately spliced transcript.In recent years, the research of Fas mediated apoptosis signal transduction mechanism has obtained very big progress, mainly contain following approach: A) FasL and Fas in conjunction with after apoptotic signal is transduceed in the cell, activate Caspase-8, cause that the Caspase cascade reaction finally causes apoptosis; B) Caspase-8 cuts into tBid with Bcl-2 family member Bid, and tBid promotes plastosome to discharge cytochrome C to endochylema, activation Caspase-9, thereby activation effect Caspase-3 and cause apoptosis; C) Zhenyue Hao etc. has found a kind of new imperial albumen-Daxx that connects, and Daxx is with the death domain DD of Fas is combined after, and activation JNK signal path finally causes apoptosis; D) but FasL and Fas in conjunction with after activated membrane sphingomyelinase also, produce the ceramide of solubility and activate Caspase, cell death inducing.Discover that recently the expression of Fas albumen significantly is lower than cancer week tissue in the liver cancer tissue, this prompting promotes liver cancer cell Fas to express the treatment that helps liver cancer.On the other hand, discover that although TRAIL has than FasL in the superiority aspect the protection normal cell the apoptosis of tumour by its DR acceptor, its apoptosis-induced effect to tumour still has unstable, effect is not as Fas.
The Survivin gene is that Ambrosini in 1997 etc. utilize effector cell's proteolytic enzyme acceptor-1cDNA to separate in human genomic library's screening by hybridization to obtain, be the IAP newcomer first.Recent study is found: Survivin finds the survivin that specificity is the strongest at present, and in most of malignant tumours specificity overexpression, in tumour cell and tissue, have stronger transcriptional activity.And the Survivin promotor can mediate goal gene can be specific expressed in various tumour cells, and be not expressed in normal differentiation cell and static vascular endothelial cell, have the tumor tissues specificity of height.Studies show that: employing length is the Survivin promoter targeting gene therapy kill tumor cell optionally of 980bp, 440bp, 260bp, and normal cell is not then had influence.
TRAIL is combined with its acceptor DR4 (death receptor4) selectivity efficient, with a kind of mode targeting mediation apoptosis of tumor cells of high-efficiency low-toxicity, and normal cell is had no side effect, and has the tumour cell targeting.The FAS path can pass through multiple signal pathway mediating apoptosis, and (intracellular FAS iFAS) is bringing into play critical effect to its intracellular region in transmitting apoptotic signal, be the main path that causes programmed cell death.Though iFas apoptosis induction effect obviously is better than TRAIL, specificity can not show a candle to TRAIL.
[summary of the invention]
One of the technical problem to be solved in the present invention is to provide a kind of fusion receptors, can be applied in the genomic medicine of targeted therapy large bowel cancer, can significantly promote the apoptosis of colorectal cancer cells.
The present invention is one of above-mentioned technical problem of realization like this:
A kind of fusion receptors, described fusion receptors are to be connected with the iFAS gene to merge by the eDR4 gene to form, and the gene order of described fusion receptors is shown in SEQ ID NO.1.
Further, the coded albumen of described fusion receptors can combine with the apoptosis induction ligand related trail protein of tumour.
Two of the technical problem to be solved in the present invention is to provide a kind of genomic medicine that is used for the treatment of large bowel cancer, can significantly promote the apoptosis of colorectal cancer cells, and it is insensitive to TRAIL to solve the part tumour, even the problem of tolerance.
The present invention is two of the above-mentioned technical problem that realizes like this:
A kind of genomic medicine that is used for the treatment of large bowel cancer, described genomic medicine comprise a kind of fusion receptors gene and sTRAIL gene, and the gene order of described fusion receptors is shown in SEQ ID NO.1.
Further, the using method of described genomic medicine is: use the CAG constitutive promoter to drive the sTRAIL destination gene expression, tumour-specific Survivin promoters driven eDR4 gene and iFAS gene fusion expression of receptor, sTRAIL carries out signal transduction, special inducing apoptosis of tumour cell by its DR acceptor and eDR4 gene and the many target spots of iFAS fusion receptors.
Further, described genomic medicine can carry out the gene transmission by non-virus carrier system or virus carrier system, the treatment large bowel cancer.
The present invention has following advantage:
1) utilizes the advantage of death receptor DR4 and both mediating apoptosis of acceptor FAS, design fusion receptors eDR4/iFAS.Utilize the characteristics of receptor-ligand combination, with described fusion receptors and its ligand/TRAIL effectively in conjunction with and reach the purpose that promotes the target cell apoptosis.
2) use CAG constitutive promoter and tumour-specific Survivin promoters driven sTRAIL and the expression of described fusion receptors eDR4/iFAS in colorectal cancer cells respectively, thereby reach efficient, special apoptosis of inducing colorectal cancer cells.It is insensitive to TRAIL to solve the part tumour, even the problem of tolerance.
[description of drawings]
The present invention is further illustrated in conjunction with the embodiments with reference to the accompanying drawings.
Fig. 1 is the synthetic electrophorogram of eDR4 of the present invention, iFAS and eDR4/iFAS gene fragment pcr amplification result.
Fig. 2 is the electrophorogram of pAM-SVN-eDR4/iFAS recombinant plasmid of the present invention.
Fig. 3 is the qualification result electrophorogram of pAM-CAG-sTRAIL recombinant plasmid of the present invention.
Fig. 4 A is the cell survival rate histogram that records the HEK293 cell of 60h after the transfection among the present invention with mtt assay.
Record the cell survival rate histogram of the HT-29 cell of 60h after the transfection among Fig. 4 B the present invention with mtt assay.
Fig. 5 is that the present invention uses RT-PCR to detect the electrophorogram of eDR4/iFAS and the expression of sTRAIL gene in the HT-29 cell.
Fig. 6 is that the present invention uses Western Blot to detect the electrophorogram of the expression of sTRAIL albumen in the HT-29 cell.
Fig. 7 is the present invention observes the HT29 cell from morphology with fluorescent microscope apoptosis situation microgram.
Fig. 8 A is that the present invention uses the Hoechst33342 fluorescent dyeing to analyze the apoptosis situation microgram of respectively organizing the HT-29 cell after the transfection.
Fig. 8 B respectively organizes HT-29 dyskaryosis rate histogram after the present invention uses the Hoechst33342 fluorescent dyeing to analyze transfection.
Fig. 9 is that each organized the cell survival rate histogram of HT-29 cell after the present invention used mtt assay to detect infection virus.
Figure 10 is the structure result's of pAM-SVN-eDR4/iFAS carrier eDR4/iFAS gene sequencing figure.
[embodiment]
See also shown in Fig. 1～10, embodiments of the invention are described in detail.
The present invention relates to a kind of fusion receptors, described fusion receptors is to be connected with the iFAS gene to merge by the eDR4 gene to form, and the gene order of described fusion receptors is shown in SEQ ID NO.1.
The coded albumen of described fusion receptors can combine with the apoptosis induction ligand related trail protein of tumour.
The invention still further relates to a kind of genomic medicine that is used for the treatment of large bowel cancer, described genomic medicine comprises fusion receptors gene and sTRAIL gene, and the gene order of described fusion receptors is shown in SEQ ID NO.1.
The using method of described genomic medicine is: use the CAG constitutive promoter to drive the sTRAIL destination gene expression, tumour-specific Survivin promoters driven eDR4 gene and iFAS gene fusion expression of receptor, sTRAIL carries out signal transduction, special inducing apoptosis of tumour cell by its DR acceptor and eDR4 gene and the many target spots of iFAS fusion receptors.Adopt 440bp Survivin promotor among the present invention.
Described genomic medicine can carry out the gene transmission by non-virus carrier system or virus carrier system, the treatment large bowel cancer.
The present invention is further illustrated below in conjunction with embodiment.
Embodiment one, pAM-SVN-eDR4/iFAS and pAM-CAG-sTRAIL vector construction
1, the eDR4/iFAS gene obtains and vector construction
1) the eDR4/iFAS gene obtains
Search the gene order that analyzes death receptor DR4 extracellular region eDR4 at GenBank, and design corresponding Auele Specific Primer, together entrust Shanghai to give birth to worker's biotechnology limited-liability company and synthesize.
A) obtaining of eDR4 gene: will activate with the pUC57-eDR4/DH5 α glycerol stock of eDR4 gene order, extract test kit (Beyotime) in a small amount according to plasmid and extract plasmid pUC57-eDR4, and be that template is used Auele Specific Primer: Sense primer:CACGTGGGGATCCA CCATGGCGCCACCACCAGC with this plasmid; Antisense primer:
CTTCCTTTCTCTTACCTGAGCCGATGCAACAAC carries out PCR.The concrete reaction system of PCR is Pyrobest DNA Polymerase (Takara) 0.3 μ L, 10 * Pyrobest Buffer II5 μ L, dNTP Mixture (each 2.5mM) 4 μ L, plasmid pUC57-eDR40.2 μ L, primer S (20 μ M) 0.5 μ L, primer A (20 μ M) 0.5 μ L, ddH
2O39.5 μ L; Amplification condition is 94 ℃ of 5min → (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 90s) 30Cycles → 72 ℃ 10min → 4 ℃ of ∞.
Then, 2% agarose gel electrophoresis is identified the PCR product, and qualification result is the eDR4 gene, and the back is used dna gel to reclaim test kit (Beyotime) and reclaimed, and-20 ℃ of preservations are standby.Wherein qualification result is shown in Fig. 1 swimming lane 3, and the purpose clip size is between 750bp and 1000bp, and 801bp is consistent with desired value.
B) obtaining of iFAS gene: pUC19-iFAS/DH5 α is activated, extract test kit (Beyotime) in a small amount according to plasmid and extract plasmid pUC19-iFAS, and be template use Auele Specific Primer Sense primer:CGGCTCAGGTAAGAGAAAGGAAGTACAGAAAACATGC with it; Antisense primer:AATGAAATCCAAAGCTTGGTC carries out PCR, reaction system is Pyrobest DNA Polymerase (Takara) 0.3 μ L, 10 * Pyrobest Buffer II5 μ L, dNTP Mixture (each 2.5mM) 4 μ L, plasmid pUC19-iFAS0.2 μ L, primer S (20 μ M) 0.5 μ L, primer A (20 μ M) 0.5 μ L, ddH2O39.5 μ L; Amplification condition is 94 ℃ of 5min → (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 60s) 30Cycles → 72 ℃ 10min → 4 ℃ of ∞.
2% agarose gel electrophoresis is identified the PCR product, and qualification result is the iFAS gene, and the back is used dna gel to reclaim test kit (Beyotime) and reclaimed, and-20 ℃ of preservations are standby.Wherein qualification result is shown in Fig. 1 swimming lane 2, and the purpose clip size is positioned at 500bp below slightly, and 435bp is consistent with desired value.
C) eDR4 and iFAS gene fusion acceptor obtains
After obtaining eDR4 gene and iFAS gene respectively, the Sense primer of use eDR4 gene order and the Antisense primer of iFAS gene order carry out overlapping PCR these two gene fragments are connected, form fusion receptors gene eDR4/iFAS, overlapping PCR reaction system is as follows: Pyrobest DNA Polymerase (Takara) 0.3 μ L, 10 * Pyrobest Buffer II5 μ L, dNTP Mixture (each 2.5mM) 4 μ L, each 0.5 μ L of primer S, primer A (20 μ M), eDR4PCR product 0.5 μ L, iFAS PCR product 1 μ L, ddH
2O38.2 μ L; Amplification condition is 94 ℃ of 5min → (94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 90s) 30Cycles → 72 ℃ 10min → 4 ℃ of ∞.
After 2% agarose electrophoresis identified that the PCR product is correct, namely the product of Huo Deing was eDR4 and iFAS fusion receptors, reclaims then.Wherein qualification result is shown in Fig. 1 swimming lane 4, and the purpose clip size is positioned at the 1000bp top, and 1235bp is consistent with desired value.
Fig. 1 is the synthetic electrophorogram of eDR4 of the present invention, iFAS and eDR4/iFAS gene fragment pcr amplification result; Wherein swimming lane 1 is dna molecular amount standard DL2000, and swimming lane 2 is the pcr amplified fragment of iFAS, and swimming lane 3 is the pcr amplified fragment of eDR4, and swimming lane 4 is the overlapping pcr amplified fragment of eDR4/iFAS.Electrophorogram shows: eDR4, the iFAS that pcr amplification obtains and eDR4/iFAS gene fragment size and the data fit of expecting.
2) structure of pAM-SVN-eDR4/iFAS carrier
The eDR4 that obtains is carried out enzyme with iFAS fusion receptors use BamH I and EcoR I restriction endonuclease cut, the enzyme system of cutting is: eDR4/iFAS PCR product 20 μ L, 10 * K3 μ L, EcoR I 0.5 μ L BamH I 0.5 μ L, ddH
2O6 μ L, reaction conditions is: 37 ℃, 3h.After endonuclease reaction finishes, enzyme is cut product carry out the dna gel recovery, it is standby that the recovery product is put-20 ℃ of preservations;
Use EcoR I and BamH I to carry out enzyme and cut the pAM-SVN-sTRAIL plasmid.In the 1.5mL centrifuge tube, be prepared as follows the double digestion reaction system: 10 * K5 μ L, plasmid DNA (2 μ g/ μ L) 40 μ L, EcoR I 1 μ L, BamH I 1 μ L, ddH
2O3 μ L, reaction conditions is: 37 ℃, 3h.Endonuclease reaction reclaims carrier segments pAM-SVN and sTRAIL fragment respectively after finishing;
Purpose fragment eDR4/iFAS behind EcoR I, BamH I double digestion with carry out ligation through the carrier segments pAM-SVN of EcoR I, BamH I double digestion.In the 1.5mL centrifuge tube, be prepared as follows the ligation system: purpose fragment 8 μ L, carrier segments 0.5 μ L, 10 * T4 damping fluid, 1 μ L, the precious biotechnology in T4DNA ligase(Dalian company limited) 0.5 μ L.Reaction conditions is 16 ℃, spends the night, and obtains connecting product, i.e. the pAM-SVN-eDR4/iFAS carrier.
Above-mentioned connection product is transformed in the intestinal bacteria E.coli DH5 α competent cell, coating LB/Amp+ flat board, obtain the engineering bacteria with recombinant plasmid pAM-SVN-eDR4/iFAS, extraction pAM-SVN-eDR4/iFAS plasmid carries out enzyme and cuts evaluation, and the endonuclease reaction result as shown in Figure 2.
Fig. 2 is the electrophorogram of pAM-SVN-eDR4/iFAS recombinant plasmid of the present invention.Swimming lane 1 is dna molecular amount standard DL15000, and swimming lane 2 is the pAM empty plasmid, and swimming lane 3 is cut the collection of illustrative plates of pAM-SVN-eDR4/iFAS plasmid for Xho I/BamH I enzyme, and swimming lane 4 is cut the collection of illustrative plates of pAM-SVN-eDR4/iFAS plasmid for BamH I/EcoR I enzyme.Wherein, swimming lane 3 is Xho I/BamH I double digestion result, and wherein small segment is SVN promoter gene fragment, is presented at the 250bp top, conforms to the SVN promoter gene size 440bp of expection.Swimming lane 4 is BamH I/EcoR I double digestion result, and wherein small segment is the eDR4/iFAS gene fragment, is presented at the 1000bp top, conforms to the eDR4/iFAS gene size of expection.The double digestion qualification result shows that the pAM-SVN-eDR4/iFAS recombinant plasmid successfully makes up.
Above-mentioned connection product is given birth to worker's biotechnology limited-liability company gene sequencing through Shanghai, sequencing result (as shown in figure 10) is in full accord with the eDR4/iFAS gene order of design, further proves the success of pAM-SVN-eDR4/iFAS construction of recombinant plasmid.
2, the structure of pAM-CAG-sTRAIL carrier
Use EcoR I and BamH I nucleic acid restriction endonuclease that the pAM-CAG-eGFP plasmid is carried out double digestion, reclaim carrier segments pAM-CAG, and be connected through the sTRAIL fragment of EcoR I with BamH I double digestion, the ligation process is, in the 1.5mL centrifuge tube, be prepared as follows the ligation system: purpose fragment 8 μ L, carrier segments 0.5 μ L, 10 * T4 damping fluid, 1 μ L, the precious biotechnology in T4DNA ligase(Dalian company limited) 0.5 μ L.Reaction conditions is 16 ℃, spends the night, and obtains connecting product.
Should connect product and be transformed in the intestinal bacteria E.coli DH5 α competent cell, coating LB/Amp+ flat board obtains the engineering bacteria with recombinant plasmid pAM-CAG-sTRAIL, and the extraction plasmid carries out enzyme and cuts evaluation, and the electrophorogram of qualification result as shown in Figure 3.Fig. 3 is the qualification result electrophorogram of pAM-CAG-sTRAIL recombinant plasmid of the present invention.Swimming lane 1 is dna molecular amount standard DL15,000; Swimming lane 2 is the pAM-CAG-sTRAIL plasmid, and swimming lane 3 is cut the pAM-CAG-sTRAIL plasmid for BamH I enzyme, and swimming lane 6 is dna molecular amount standard DL2000.Wherein, swimming lane 4 is Xho I/BamH I double digestion pAM-CAG-sTRAIL plasmid, and the restriction enzyme mapping small segment is the CAG promotor, and size is positioned at about 1000bp, conforms to desired value; Swimming lane 5 is BamH I/EcoR I double digestion pAM-CAG-sTRAIL plasmid, and it is the sTRAIL gene that enzyme is cut small segment, and size is between 500bp and the 750bp, and 575bp conforms to desired value.The electrophoresis qualification result shows:
The pAM-CAG-sTRAIL recombinant plasmid successfully makes up.
Embodiment two, recombinant plasmid are to the influence of cell survival and apoptosis
1, a large amount of extractions, purification of Recombinant plasmid
Utilize QIAGEN plasmid Mega Kit reagent to carry out a large amount of extractions, the purifying of recombinant plasmid pAM-CAG-eGFP, pAM-SVN-eDR4/iFAS and pAM-CAG-sTRAIL, and use ultraviolet spectrophotometer to record the A of above-mentioned three kinds of recombinant plasmid nucleic acid DNAs respectively
260/ A
280Ratio, and all be in 1.8～2.0 normal ranges.
2, mtt assay is measured cell survival rate
The cell that present embodiment adopts is human embryonic kidney cell line HEK293 and human large intestine cancer cell strain HT-29, all cells all in the DMEM substratum (GIBCO) that contains 10% foetal calf serum (GIBCO), 100U/ml penbritin and 100 μ g/mL Vetstreps (Sigma), 37 ℃, 5%CO
2, saturated humidity the standard environment condition under carry out cultured continuously.Transfection the day before yesterday, cell is with 10
4The amount in individual/hole is inoculated in 96 orifice plates.Employing Lipofectamine2000(Invitrogen) reagent carries out the transient transfection cell, and operation is to specifications carried out, and transfection is respectively organized the plasmid consumption and is 0.2 μ g, and wherein the plasmid ratio of cotransfection group is 1:1.60h adding MTT detects after the transfection.
Fig. 4 A is for recording the cell survival rate histogram of the HEK293 cell of 60h after the transfection with mtt assay; Fig. 4 B is for recording the cell survival rate histogram of the HT-29 cell of 60h after the transfection with mtt assay; In human embryonic kidney cell line HEK293 cell, there is not significant difference in the cell survival rate of respectively organizing of transfection plasmid; And in the HT-29 cell, the cell survival rate of sTRAIL group is 40.9%, the cell survival rate of group is 21.6% and (eDR4/iFAS+sTRAIL), there is significant difference (p＜0.05) in the two, and eDR4/iFAS and the apoptosis better effects if of sTRAIL combination than the HT-29 cell of sTRAIL namely are described.
3, RT-PCR testing goal expression of gene
Behind the transfection 48h, adopt Trizol Reagent (Invitrogen) to carry out total RNA and extract (beginning thus to operate on ice), carry out reverse transcription (related reagent is available from Zoman) at once: add Reaction Buffer (5 *) 10 μ L, dNTP (10mM) 1 μ L, Rnasin (40U/ μ L) 1 μ L, M-MuLV ThermoScript II (RNase H-) 2 μ L, Random Primer1 μ L, total RNA5 μ L replenishes ddH2O to the 50 μ L that handled through DEPC, fully behind the mixing 65 ℃, 5min; 4 ℃, 10min; 25 ℃, 10min; 42 ℃, 50min; 70 ℃ of heating 15min inactivation M-MuLV ThermoScript II (RNase H-).(reverse transcription product can be directly used in subsequent P CR reaction, also can-20 ℃ of frozen preparing against later on use.）
Be template with the reverse transcription product, carry out common PCR reaction, reaction system and process are as described in the structure of the carrier construction of the structure of pAM-SVN-eDR4/iFAS carrier in the example one and pAM-CAG-sTRAIL carrier.Detected result as shown in Figure 5, Fig. 5 is that the present invention uses RT-PCR to detect the electrophorogram of eDR4/iFAS and the expression of sTRAIL gene in the HT-29 cell.Wherein swimming lane 1 is the eGFP group, and swimming lane 2 is the sTRAIL group, and swimming lane 3 is the eDR4/iFAS group, and swimming lane 4 is eDR4/iFAS and sTRAIL cotransfection group; The result shows that sTRAIL and fusion receptors eDR4/iFAS can express in the HT-29 cell.
4, the expression of Western Blot testing goal albumen
After plasmid 48h is respectively organized in transfection, with lysate cracking HT-29 cell (operation on ice), after the abundant cracking, 4 ℃ of collecting cell fragment and lysates, 14000rpm gets supernatant after 30min is centrifugal.Measure protein concentration through BCA protein concentration detection kit (Beyotime), get 50 μ g albumen supernatants and carry out the 12%SDS-PAGE electrophoresis, change film afterwards, cut the target protein band, spend the night with the sealing of 5% skim-milk, press 1:500 and add correspondence primary antibodie (mouse anti human TRAIL primary antibodie, Santa), hatch 2h for 37 ℃, wash 3 times with TBST, with 1:1000 two anti-(goat anti-mouse IgG-HRP Beyotime) is hatched 2h, wash 3 times with TBST again, develop with ECL detection kit (Beyotime).Detected result as shown in Figure 6, Fig. 6 is that the present invention uses Western Blot to detect the electrophorogram of the expression of sTRAIL albumen in the HT-29 cell.Wherein swimming lane 1 is the eGFP group, and swimming lane 2 is the sTRAIL group, and swimming lane 3 is eDR4/iFAS and sTRAIL cotransfection group.As shown in Figure 6, in the HT-29 cell, can detect the expression of sTRAIL albumen.
5, apoptotic detection
1) morphologic detection
Behind the cell transient transfection 48h, the cell state behind the different plasmids of use fluorescence microscope transfection, finishing analysis is respectively organized the variation of morphocytology, the results are shown in Figure 7.To be the present invention observe the microgram of the apoptosis situation of HT29 cell with fluorescent microscope from morphology to Fig. 7, and from scheming to go up the cell shrinkage that can find out sTRAIL group and eDR4/iFAS and sTRAIL cotransfection group, becoming and justify, cellular form is similar to positive controls.
2) Hochest dyeing detects
Open disposable sterilized cell cultures 6 orifice plates, drip 200 μ L PBS/ holes, will through the general cover glass that high pressure steam sterilization is handled carefully put into successively cultivate plate hole at the bottom of, every hole inoculation 10
5Individual HT-29 cell used Lipofectamine2000 to carry out transfection, every group of 4 μ g plasmid DNA in second day.Behind the transfection 48h, discard culture supernatant, add cell dyeing damping fluid, Hoechst staining fluid (Beyotime) ice bath 20～30min successively according to the ratio of 1:200.After the dyeing, precooling PBS washed twice is directly observed under fluorescent microscope, the results are shown in Figure 8.Fig. 8 A is that the present invention uses the Hoechst33342 fluorescent dyeing to analyze the microgram of respectively organizing the apoptosis situation of HT-29 cell after the transfection, and Fig. 8 B respectively organizes HT-29 dyskaryosis rate histogram after the present invention uses the Hoechst33342 fluorescent dyeing to analyze transfection.
The result shows that the apoptosis of eDR4/iFAS and sTRAIL group is more obvious than other control groups.This further illustrates fusion receptors eDR4/iFAS and the sTRAIL combination can be induced the HT-29 apoptosis really.
The packing of embodiment three, rAAV2, purifying and active checking thereof
1, the packing of rAAV2
The present invention uses conventional coprecipitation of calcium phosphate method transfection HEK293 cell, utilizes three pUC pUCs packing rAAV2, and the rAAV2 of packaging comprises rAAV2.eGFP, rAAV2.sTRAIL and rAAV2.eDR4/iFAS, and wherein rAAV2.eGFP organizes in contrast.
2, the purifying of rAAV2
Results virus behind the transfection 64h.Behind the collecting cell, multigelation lysing cell, CsCl density gradient centrifugation purified virus, PBS dialysis three times.
3, mtt assay is measured cell survival rate
24h before the virus infection, inoculation HT-29 cell in 96 porocyte culture plates, 10
4Individual cells/well.RAAV2.eGFP behind the purifying, rAAV2.eDR4/iFAS, rAAV2.sTRAIL virus are filtered through 0.22 μ m filter, establish 3 parallel multiple holes.RAAV2.eGFP, rAAV2.eDR4/iFAS, three independent infected group of rAAV2.sTRAIL, infection multiplicity is MOI=10
4Vg/cell;
RAAV2.eDR4/iFAS and rAAV2.sTRAIL be infected group simultaneously, and every kind of virus infection plural number is MOI=5 * 10
3Vg/cell.4h is replaced with perfect medium behind the virus infection, continues to cultivate 72h.Every hole adds 20 μ L MTT solution (5mg/mL, i.e. 0.5%MTT), continues to cultivate 4h.Stop cultivating, the careful suction goes nutrient solution in the hole, every hole to add the crystallisate that 150 μ LDMSO dissolving generates, and puts the 10min that vibrates on the cell plate vibrator, and it is fully dissolved.Detect the light absorption value at each OD490nm place, hole in microplate reader.The result as shown in Figure 9, Fig. 9 is that each organized the cell survival rate histogram of HT-29 cell after the present invention used mtt assay detect to infect virus.The result shows: in the HT-29 cell, the cell survival rate of sTRAIL group is 46.9%, the cell survival rate of group is 27.9% and (eDR4/iFAS+sTRAIL), there is significant difference (p＜0.05) in the two, consistent with the result of liposome transfection plasmid, prove no matter (eDR4/iFAS+sTRAIL) this genomic medicine is still sent with virus vector with non-virus carrier and can both significantly promote the colorectal cancer cells apoptosis.And coinfection group (rAAV2.eDR4/iFAS+rAAV2.sTRAIL) compares with the rAAV2.sTRAIL infected group, the coinfection group can reduce to significance the cell survival rate of HT-29 cell, has proved that the expression that increases the fusion receptors eDR4/iFAS on the cytolemma can promote cancer cell-apoptosis in significance ground.
The present invention utilizes the advantage of death receptor DR4 and both mediating apoptosis of acceptor FAS, designs fusion receptors eDR4/iFAS.Utilize the characteristics of receptor-ligand combination, with described fusion receptors and its ligand/TRAIL effectively in conjunction with and reach the purpose that promotes the target cell apoptosis.
Then, use CAG constitutive promoter and tumour-specific Survivin promoters driven sTRAIL and the expression of described fusion receptors eDR4/iFAS in colorectal cancer cells respectively, thereby reach efficient, special apoptosis of inducing colorectal cancer cells.It is insensitive to TRAIL to solve the part tumour, even the problem of tolerance.
Though more than described the specific embodiment of the present invention; but being familiar with those skilled in the art is to be understood that; our described specific embodiment is illustrative; rather than for the restriction to scope of the present invention; those of ordinary skill in the art are in modification and the variation of the equivalence of doing according to spirit of the present invention, all should be encompassed in the scope that claim of the present invention protects.
In addition, related a kind of fusion receptors and the nucleotide sequence that is used for the treatment of the genomic medicine of large bowel cancer thereof are seen appended Nucleotide or aminoacid sequence table among the present invention.
Claims (5)
1. fusion receptors is characterized in that: described fusion receptors is to be connected with the iFAS gene to merge by the eDR4 gene to form, and the gene order of described fusion receptors is shown in SEQ ID NO.1.
2. a kind of fusion receptors according to claim 1, it is characterized in that: the coded albumen of described fusion receptors can combine with the apoptosis induction ligand related trail protein of tumour.
3. genomic medicine that is used for the treatment of large bowel cancer, it is characterized in that: described genomic medicine comprises the described fusion receptors gene of claim 1 and sTRAIL gene.
4. a kind of genomic medicine that is used for the treatment of large bowel cancer as claimed in claim 3, it is characterized in that: the using method of described genomic medicine is: use the CAG constitutive promoter to drive the sTRAIL destination gene expression, tumour-specific Survivin promoters driven eDR4 gene and iFAS gene fusion expression of receptor, sTRAIL carries out signal transduction, special inducing apoptosis of tumour cell by its DR acceptor and eDR4 gene and the many target spots of iFAS fusion receptors.
5. as claim 3 or 4 described a kind of genomic medicines that are used for the treatment of large bowel cancer, it is characterized in that: described genomic medicine can carry out the gene transmission by non-virus carrier system or virus carrier system, the treatment large bowel cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310184791.3A CN103288966B (en) | 2013-05-17 | 2013-05-17 | Fusion receptor and gene medicine thereof for treating colorectal cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310184791.3A CN103288966B (en) | 2013-05-17 | 2013-05-17 | Fusion receptor and gene medicine thereof for treating colorectal cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103288966A true CN103288966A (en) | 2013-09-11 |
| CN103288966B CN103288966B (en) | 2015-01-21 |
Family
ID=49090540
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310184791.3A Expired - Fee Related CN103288966B (en) | 2013-05-17 | 2013-05-17 | Fusion receptor and gene medicine thereof for treating colorectal cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103288966B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1552734A (en) * | 2003-05-28 | 2004-12-08 | 中国医学科学院基础医学研究所 | Recombination glant associated virus carrier induced TNF concerned cytonecrosis ligand peptide segment and its use |
| CN101076540A (en) * | 2004-07-29 | 2007-11-21 | 冬姆佩制药股份公司 | Tumor-homing cells engineered to produce tumor necrosis factor-related apoptosis-inducing ligand |
| CN101173299A (en) * | 2007-10-09 | 2008-05-07 | 浙江理工大学 | Construction and application of tumour targeting gonad correlation viral vectors |
-
2013
- 2013-05-17 CN CN201310184791.3A patent/CN103288966B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1552734A (en) * | 2003-05-28 | 2004-12-08 | 中国医学科学院基础医学研究所 | Recombination glant associated virus carrier induced TNF concerned cytonecrosis ligand peptide segment and its use |
| CN101076540A (en) * | 2004-07-29 | 2007-11-21 | 冬姆佩制药股份公司 | Tumor-homing cells engineered to produce tumor necrosis factor-related apoptosis-inducing ligand |
| CN101173299A (en) * | 2007-10-09 | 2008-05-07 | 浙江理工大学 | Construction and application of tumour targeting gonad correlation viral vectors |
Non-Patent Citations (2)
| Title |
|---|
| 刘亚民等: "TRAIL受体在老年结肠癌中的表达及临床意义", 《中国老年学杂志》, vol. 27, 31 August 2007 (2007-08-31), pages 1597 - 1598 * |
| 段晓秋等: "死亡受体Fas在TRAIL联合三氧化二砷诱导人胃癌细胞凋亡中的作用", 《癌变·畸变·突变》, vol. 24, no. 6, 12 November 2012 (2012-11-12), pages 422 - 426 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103288966B (en) | 2015-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhao et al. | Oncolytic adenovirus: prospects for cancer immunotherapy | |
| Jia et al. | Cancer gene therapy targeting cellular apoptosis machinery | |
| CN104140974B (en) | Encode the nucleic acid of the Chimeric antigen receptor albumen of GPC 3 and express the T lymphocytes of the Chimeric antigen receptor albumen of GPC 3 | |
| Diaz Arguello et al. | Apoptosis-inducing TNF superfamily ligands for cancer therapy | |
| ES2340400T3 (en) | CELLS LOCATED IN TUMORS MODIFIED BY GENETIC ENGINEERING TO PRODUCE BINDING APOPTOSIS INDUCTOR RELATED TO THE TUMOR NECROSIS FACTOR (TRAIL). | |
| WO2009065292A1 (en) | Fusion protein comprising tumor necrosis factor related apoptosis inducing ligand and integrin ligand and use thereof | |
| EP3565578A1 (en) | Armed replication-competent oncolytic adenoviruses | |
| CN111606999B (en) | Replicative oncolytic adenovirus with functions of activating immune co-stimulatory signaling pathway and blocking immune checkpoint and application thereof | |
| CN102844329A (en) | Hexon isolated from simian adenovirus serotype 19, hypervariable region thereof and chimeric adenovirus using the same | |
| CN1181422A (en) | Gene transfer carrier structured by polypeptide in conjunction with growth factor receptor | |
| Yang et al. | A novel fiber chimeric conditionally replicative adenovirus-Ad5/F35 for tumor therapy | |
| CN105218682B (en) | The tumor therapeutic agent and its preparation method and purposes being transformed through IL-12/CD62L fusion protein | |
| CN105367661B (en) | Chimeric antigen receptor and its gene and recombinant expression carrier, the NKT cell of engineering HER1 targeting and its application | |
| CN101565718A (en) | Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof | |
| CN103288966A (en) | Fusion receptor and gene medicine thereof for treating colorectal cancer | |
| WO2024060422A1 (en) | Double-targeting car-t cell targeting mesothelin and nkg2d ligand and use thereof | |
| WO2023104168A1 (en) | Chimeric antigen receptor and chimeric antigen receptor t cell targeting both gpc3 and cd276, preparation method therefor and use thereof | |
| RU2016142370A (en) | NEW MEDICAL AGENTS AND THEIR APPLICATION | |
| Kanerva et al. | Gene therapy of gynaecological diseases | |
| CN107502596A (en) | Express T cell and its application of the specificity TCRs of NY ESO 1 | |
| CN102114239A (en) | Application of cell factor-super-antigen fusion protein in preparation of anti-cancer drugs | |
| CN112996909B (en) | Oncolytic viruses expressing PD-1 binding proteins and uses thereof | |
| CN101683518B (en) | Application of FHL 1 in preparing medicament for treating tumour | |
| CN101575380A (en) | Tumor target and recombined human Fas ligand fusion protein and preparation method thereof | |
| CN108103106A (en) | A kind of pFTM3GW recombinant vectors and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150121 Termination date: 20150517 |
|
| EXPY | Termination of patent right or utility model |