CN101565718A - Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof - Google Patents
Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof Download PDFInfo
- Publication number
- CN101565718A CN101565718A CNA2009100996045A CN200910099604A CN101565718A CN 101565718 A CN101565718 A CN 101565718A CN A2009100996045 A CNA2009100996045 A CN A2009100996045A CN 200910099604 A CN200910099604 A CN 200910099604A CN 101565718 A CN101565718 A CN 101565718A
- Authority
- CN
- China
- Prior art keywords
- adcn205
- carrier
- adenovirus
- socs1
- socs3
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof, wherein the carrier uses a double-target oncolytic adenovirus carrier pCN103 and Pcn205 as the basis and the frame of 5 type adenovirus Ad5 is chimeric with the fibrin fiber of human 11 type adenovirus Ad11 and the human telomerase reverse transcriptase hTERT promoter is used for adjusting and controlling the E1A gene deleted with CR2 section and necessary for Rb protein binding and the carrier system is used for controlling the exogenous gene capable of killing and inhibiting various cancers, such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1, cpp-SOCS1 and the vivo and vitro experiment shows that the carrier has good anti-cancer effect. The three-target mosaic type oncolytic adenovirus, such as AdCN205-11-1l-24, AdCN205-11-TRAIL, AdCN205-11-SOCS3, AdCN205-11-cpp-SOCS3, AdCN205-11-SOCS1 and AdCN205-11-cpp-SOCS1 can be used for treating various cancer and developing new virus-gene anti-cancer medicine capable of effectively treating cancer.
Description
Technical field
The invention belongs to field of gene, the particularly a kind of people's of utilization 5 type adenovirus (Ad5) skeletons come the three-target mosaic type oncolytic adenovirus construction of carrier of chimeric people's 11 type adenovirus (Ad11) scleroproeins (fiber) and carry the application that all have killing and wounding, suppress foreign gene such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1 and the cpp-SOCS1 of cancer.
Background technology
Malignant tumour serious harm human health still lacks effective treatment means to most late tumor patients at present clinically.Obtain develop rapidly when Celluar and Molecular Biology is theoretical with technology, gene therapy tumour strategy arises at the historic moment.And along with virusology and oncology fast development, people attempt improved virus is used for the research work of oncotherapy again.
The target gene one viral therapy strategy of cancer is to utilize oncolytic virus to improve strong lethal effect or the restraining effect of antioncogene to cancer cells in specifically inside tumor cell cracking, propagation.This virus vector with the traditional tumour gene therapy has in essence different, and the latter is a kind of non-replicability virus, as just launch vehicle antioncogene is transported in tissue or the cell, and no target of carrier itself and replication does not have therapeutic action yet.Target gene one viral therapy makes full use of that viral volume is little, reproducible and the strong advantage of diffusibility, can at the tumour primary lesion and metastasis is local forms high concentration virus, and excites immunity system to reply to strengthen knurl effect extremely; Antioncogene target ground can also be transported in the tumour cell simultaneously, antioncogene can increase copy number along with duplicating of virus, improves the expression amount of antioncogene, thereby both act synergistically and further improve antineoplastic treatment
Be divided into virus type and non-virus type two big classes as Vectors in Gene Therapy at present.Virus vector comprises: adenovirus, adeno-associated virus, retrovirus, slow virus and simplexvirus etc.Virus vector transfection efficiency height, expression time is long, but immunogenicity is strong, and certain risk is arranged.Non-virus carrier comprises: the DNA of naked DNA, liposome and other material parcel.Non-virus carrier then immunogenicity is little and security good, but transfection efficiency is low, and gene stability is poor, and expression time is short.Use at most still virus vector at present.And adenovirus is wide with its host range in numerous virus vector, and pathogenic low, bale capacity is big, and producing the titre advantages of higher becomes most widely used gene therapy vector.According to the recent statistics of http://www.wiley.co.uk/genmed, the whole world has 1145 gene therapy schemes and enters clinically, and wherein 67% is used for treatment for cancer, and is that the research of carrier is the most extensively and up to 25% with the adenovirus.
And carried out long time about the research of 5 type adenovirus (Ad5), to characteristics and all certain understanding and the understanding of security that it had, adenoviral gene treatment is at present still taken as the leading factor with Ad5.Because the efficiency of infection height of Ad5 pair cell depends on cell surface Coxsackie virus and adenovirus receptor (coxsakieand adenovirus receptor, CAR) expression level, but the tumor cell surface CAR of the epithelial cell source property nearly 50% lacks very much, even express hardly on the blood tumor cell surface, this just makes adenovirus low to these tumour cell efficiency of infection, even hematological system tumor is not had the infection ability.This characteristic limitations its application in the treatment of the tumour cell of epithelial cell source property and blood tumor cell.Therefore this basic upward development carrier system efficient, target transfection tumor cell is most important to present genetic treatment of tumor again.
Summary of the invention
The objective of the invention is at the deficiencies in the prior art, a kind of three-target mosaic type oncolytic adenovirus Ad5/F11 construction of carrier and application thereof are provided.
The objective of the invention is to be achieved through the following technical solutions: a kind of three-target mosaic type oncolytic adenovirus Ad5/F11 construction of carrier, this method be with two target oncolytic adenovirus carrier pCN103 and pCN205 as the basis, undertaken chimeric and utilize reverse transcriptase of telomere hTERT promotor to regulate and control to lack the e1a gene of CR2 district and the necessary 24bp of Rb protein binding by scleroproein fiber the skeleton of 5 type adenovirus Ad5 and people 11 type adenovirus Ad11.
Further, this method specifically may further comprise the steps:
(1) method by PCR is loaded into shuttle plasmid p11zf-ad5-ad11p with the Fiber gene of people's 11 type adenovirus.
(2) pass through the method for homologous recombination with 5 C-type virus C Fiber genes in people's 11 C-type virus C Fiber genes replacement pCN103 skeleton plasmid.
(3) cut the method structure E3 district disappearance 6.7K of connection and the vector plasmid pCN204 of gp19K gene with enzyme;
(4) foreign gene such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1 and the cpp-SOCS1 that all is had killing and wounding and suppress all kinds of cancers clones the into multiple clone site of pCN204, is built into plasmid pCN204-IL-24.
(5) with plasmid pCZ204-IL-24 by enzyme cut reclaim with fragment after, electricity transforms in the BJ5183 homologous recombination, obtains three-target mosaic type oncolytic adenovirus Ad5/F11 carrier, called after pCN205-11p carrier.
Make up three-target mosaic type oncolytic adenovirus such as AdCN205-11-IL-24, AdCN205-11-TRAIL, AdCN205-11-SOCS3, AdCN205-11-cpp-SOCS3 with the carrier pCN205-11p that obtains, AdCN205-11-SOCS1 and AdCN205-11-cpp-SOCS1 can be used for preparing the purposes of the medicine for the treatment of tumour.
The invention has the beneficial effects as follows:
1. the present invention combines the virus therapy and the gene therapy of tumour effectively, but efficiently expressing exogenous gene has strengthened kill capability to tumour with respect to simple virus therapy.
2. the present invention has adopted a kind of strategy of triple target tumors, has all accomplished specificity to virus intracellular duplicating from the infection of viral pair cell, target tumor cell effectively, and proliferated specifically therein.Thereby strengthened the security of adenoviral gene treatment carrier greatly.
3. the present invention adopts tumor-specific promoters and virus replication genes involved disappearance dual mode, has guaranteed that viral tumour internal specific duplicates, and has strengthened the security of adenoviral gene treatment carrier greatly.
4. the present invention makes all genes that kill and wound, suppress cancer such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1 and cpp-SOCS1 bring into play tumor-killing effect preferably by the novel three-target mosaic type oncolytic adenovirus gene therapy vector that makes up.
Description of drawings
Fig. 1 is that shuttle plasmid pllzf-ad5-ad11p makes up schema;
Fig. 2 is that plasmid pCN103-11p, plasmid pCN205-EGFP-11p and plasmid pCN205-IL24-11p make up schema;
Fig. 3 is that mosaic type oncolytic adenovirus Ad5/F11 (AdCN205-11-EGFP) is to CD46+ tumour cell and normal blood cell infection duplicating efficiency synoptic diagram;
Fig. 4 is the survival rate synoptic diagram that mtt assay detected CD46+ tumour cell and normal cell after different virus is handled 4 days;
Fig. 5 is that mtt assay detects AdCN205-EGFP and the AdCN205-11-IL-24 toxicity comparison diagram to solid tumor cell;
Fig. 6 is mosaic type virus AdCN205-11-EGFP and the replication synoptic diagram of AdCN205-11-IL-24 in blood tumor cell;
Fig. 7 is the expression synoptic diagram of mosaic type virus AdCN205-11-EGFP and AdCN205-11-IL-24 anticancer factor IL-24 in blood tumor cell.
Embodiment
The present invention with chimeric people's 11 type adenovirus (Ad11) scleroproeins (fiber) of 5 type adenovirus (Ad5) skeletons but construct the mosaic type oncolytic adenovirus carrier of efficiently expressing exogenous gene, this virus also has the fiber of Ad11 except that having the Ad5 skeleton.This adenovirus carrier also utilizes human telomerase reverse transcriptase (hTERT) promoter regulation adenovirus e1a gene, simultaneously with the necessary 24bp disappearance of this gene product CR2 district and Rb protein binding on the E1A sequence, therefore the security of the existing Ad5 of this virus vector has the tumour cell of epithelial cell source property of Ad11 target CD46+ and the characteristic of blood tumor cell again.Thereby has a tumour proliferated specifically inside ability efficiently.The invention provides a kind of strategy of triple target tumors, thereby make virus can in tumour cell, duplicate the security that improves human body specifically.These characteristics have proved by experiment that this virus vector has target and genetic expression effect more efficiently.The present invention is efficient more and join together to make it to have more the big effect of killing tumor cell efficiently gene therapy and viral therapy safely, the cancer therapy drug that comes further exploitation to make new advances on this basis.
Three-target mosaic type oncolytic adenovirus Ad5/F11 construction of carrier of the present invention is made up on the basis of pCN103 with target and pCN205, and utilizes human telomerase reverse transcriptase (hTERT) promotor to regulate and control to lack the e1a gene of CR2 district and the necessary 24bp of Rb protein binding.It may further comprise the steps:
1, the method by PCR is loaded into shuttle plasmid p11zf-ad5-ad11p with the Fiber gene of 11 type adenovirus.
2, pass through the method for homologous recombination with 5 C-type virus C Fiber genes in the 11 C-type virus C Fiber genes replacement pCN103 skeleton plasmid.
3, cut the method structure E3 district disappearance 6.7K of connection and the vector plasmid pCN204 of gp19K gene with enzyme;
4, foreign gene such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1 and the cpp-SOCS1 that all is had killing and wounding and suppress all kinds of cancers clones the into multiple clone site of pCN204, be built into plasmid pCN204-IL-24,
5, all are had killing and wounding and suppress the foreign gene of all kinds of cancers such as pCZ204-IL-24 by enzyme cut reclaim with fragment after, electricity transforms in the BJ5183 homologous recombination, obtains pCN205-IL-24-11p; And make to use the same method and to obtain all pCN205-foreign gene recombinant plasmids such as pCZ205-RAIL-11p, pCZ205-SOCS3-11p, pCZ205-pp-SOCS3-11p, pCZ205-SOCS1-11p and pCZ205-cpp-SOCS1-11p.
6, respectively the described plasmid of step 5 is carried out enzyme and cut digestion, in 293 cells, pack, to express and all kinds ofly to kill and wound and suppress the adenovirus of foreign gene of all kinds of cancers such as AdCN205-11-IL-24, AdCN205-11-TRAIL, AdCN205-11-SOCS3, AdCN205-11-cpp-SOCS3, AdCN205-11-SOCS1 and AdCN205-11-cpp-SOCS1.
The three-target mosaic type oncolytic adenovirus that three-target mosaic type oncolytic adenovirus gene therapy vector pCN205-11p makes up such as AdCN205-11-IL-24, AdCN205-11-TRAIL, AdCN205-11-SOCS3, AdCN205-11-cpp-SOCS3, AdCN205-11-SOCS1 and AdCN205-11-cpp-SOCS1 are used to prepare the purposes of the medicine for the treatment of tumour.
The invention provides a kind of human telomerase reverse transcriptase of utilization (hTERT) promotor come regulating and expressing lacked CR2 district and the necessary 24bp of Rb protein binding e1a gene inserted that all have killing and wounding, suppress construction process and the application of the three-target mosaic type oncolytic adenovirus gene therapy vector pCN205-11 of the foreign gene of cancer such as SOCS1, cpp-SOCS1, SOCS3, cpp-SOCS3, TRAIL and IL-24.
This invention provides for example construction process of pCN205-IL-24-11p, pCN205-TRAIL-11p, pCN205-SOCS3-11p, pCN205-cpp-SOCS3-11p, pCN205-SOCS1-11p and pCN205-cpp-SOCS1-11p of carrier.
The invention will be further described below in conjunction with specific embodiment, should understand following examples and only be used to the present invention is described and be not used in the scope of the present invention that limits.(with cancer suppressor gene IL-24 is example, illustrates three-target mosaic type oncolytic adenovirus pCN205-11p construction of carrier and is used to prepare the structure flow process and the result of treatment of the medicine for the treatment of tumour.)
Embodiment 1: the structure of the mosaic type oncolytic adenovirus carrier pCN205-IL-24-11p of the cancer target of portability foreign gene and the acquisition of virus of A dCN205-11-IL-24
One, make up shuttle plasmid p11zf-ad5-ad11p:
1.SacI EcoR I double digestion 3602 plasmids reclaim the 1706bp band, called after L1; Sac I, EcoR I double digestion pGEM-11ZF (+) plasmid, called after J1.
2. connect L1, J1 obtains the 4925bp plasmid, called after J2.
3.PCR 3602 plasmids (32788-33105), called after L2.Primer is Primer L2up:5〉aactcccccttaaggcatgcact＜3 (adding restriction enzyme site Sph I); Primer L2down:5〉agggcccagaatcgtttgtgt＜3.
4.Apa I, Sph I double digestion J2 plasmid obtains J3; Apa I, Sph I double digestion L2 fragment obtains L2-1.
5. connect J3 and L2-1, obtain plasmid J4 (5233bp).
6.Hind III, Af1 II double digestion 3602 reclaims 1826bp fragment L3; Hind III obtains J5 behind the Af1 II double digestion J4, and is connected with L3 and obtains J6.
7. common PCR 3602 plasmids and wild malicious wtAd11 genome.Primer is Primer L4 Ad5 up:
5>tagaattctttaattatgaaattt<3；Primer?L4?Ad5/11：
5>aatgggtttcaagagagtccccctggagttcttactttaaaatgtttaacccca<3；PrimerL4?Ad11?down：5>gttatgtttcaacgtgtttat<3。Obtain a 2015bp fragment.Called after L4
8.EcoR I, Apa I double digestion L4, J6, the two is connected to J7 after reclaiming fragment.(8985bp)
9.Mlu I, Not I double digestion 3602 plasmids reclaim 5188bp fragment called after L5.
10.Sac I, Not I double digestion pGEM-11ZF (+) reclaim fragment and be connected with L5, Srf I identifies correct plasmid called after pGEM-11zf-L5.
11.Sac I, Not I double digestion pGEM-11zf-L5, the two reclaims fragment connection back called after J8, i.e. p11zf-ad5-adllp J7.(making up collection of illustrative plates as shown in Figure 1)
Two, make up skeleton plasmid pCN103-11p:
1.pCN103 singly cut with Srf I, reclaim 30000bp left and right sides fragment; J8 plasmid Sph I, BamH I is two to be cut, and reclaims the 9082bp band.
2. reclaim band and recombinate in intestinal bacteria Ecoli.BJ5183 competence, PCR and enzyme cutting method are identified correct recon.
3. correct recon is changeed in intestinal bacteria Top10 competence, picking mono-clonal bacterium, PCR method and enzyme cutting method are identified correct recon, called after pCN103-11p.(making up collection of illustrative plates as shown in Figure 2)
Three, make up plasmid pCN205-IL24-11p:
1.pCN103-11p plasmid is singly cut with SrfI, reclaims 30000bp left and right sides fragment; PCN204-IL24 plasmid Mlu I, Nde I is two to be cut, and reclaims the 6514bp band.
2. reclaiming band recombinates in intestinal bacteria Ecoli.BJ5183 competence.
3. correct recon is changeed in intestinal bacteria Top10 competence, picking mono-clonal bacterium, PCR method and enzyme cutting method are identified correct recon, called after pCN205-IL24-11p.(making up collection of illustrative plates as shown in Figure 2)
Four, packaging virus AdCN205-11-IL-24:
1. with restriction enzyme Pac I linearizing virus particle.37 ℃ of water-baths 2 hours, product runs 1% agarose gel electrophoresis, reclaims test kit (QIAq μ ick Gel Extraction) with gel and reclaims 30000bp left and right sides band.
2.HEK293 packaging virus in the cell.
Operate by test kit (Effectene) specification sheets according to cell transfecting, will reclaim back fragment transfection to the HEK293 cell.Concrete steps are as follows:
Preceding 12 hours of transfection is in 6 orifice plate middle berths, 1 * 106HEK293 cell.The line style plasmid that will be total to about 1 μ g after 12 hours is added EC buffer to 150 μ l, adds 8 μ l Enhancer buffer again, vibrates for 1 second, and room temperature left standstill 5 minutes.In said mixture, add 25 μ l Effectene, put upside down mixing five times, room temperature incubation 10 minutes.HEK293 cell in the 2ml PBS wash orifice plate once, add the 1ml fresh culture then, add the 1ml fresh culture simultaneously based in the said mixture, turn upside down and be added in the Tissue Culture Dish after twice, in 37 ℃, 5%CO2 cultivates to inhale after 6-18 hour and goes substratum, PBS to wash once, adds the fresh culture that 2ml contains 2%FBS.Occurred virus plaque in 9-14 days, receive virus and increase in a large number.
Embodiment 2: virus is to CD46+ tumour cell and the experiment of normal blood cell infection efficient
Cell growth rate according to trial test mensuration, marrow series leukemia cell strain K562, Kasumi-1 with logarithmic phase, T is that leukemia cell line 6T-CEM and peripheral blood lymphocyte (normal cell) PBMC implant 6 well culture plates with 5 * 105/hole, cultivates 6h in 37 ℃ of 5%CO2 incubators.Above-mentioned cell is divided into 2 groups, infect with non-replicating adenovirus Ad5-EGFP, Ad11-EGFP and replication type adenovirus AdCN205-EGFP, AdCN205-11-EGFP respectively, after cultivating 24h in 37 ℃ of 5%CO2 incubators, collect above-mentioned cell, wash 2 times with the PBS that contains 2%FBS, be resuspended in the PBS of 500 μ l 2%FBS, flow cytometer detects the EGFP positive rate.More than experiment use 1,10 respectively, the virus infection of three concentration gradients of 100MOI, the cell of virus-free infection compares (Control).
The result as shown in Figure 3, mosaic type oncolytic adenovirus AdCN205-11-EGFP has significantly improved the infection duplication efficient to the CD46+ blood tumor cell, normal blood cell is not shown to invade have a liking for, and illustrates to have tumour-specific.
Embodiment 3: virus of A dCN205-11-IL-24 detects in external kill capability to normal cell and tumour cell
With marrow series leukemia cell strain K562, the Kasumi-1 of logarithmic phase, cervical cancer cell strain Hela, lung cancer cell line H460 and colon cancer cell line Sw620 inoculate into 96 orifice plates with the amount in 1 * 104/ hole; With the T of logarithmic phase is that leukemia cell line 6T-CEM and peripheral blood lymphocyte (normal cell) PBMC inoculate into 96 orifice plates with the amount in 2 * 104/ holes, every hole adds 10MOI virus after cultivating 24h, not add viral cell in contrast, do the zeroing hole with the sample that does not add virus and cell, respectively do 6 multiple holes.In 37 ℃ of 5%CO2 incubators, continue to cultivate.Behind virus infected cell 24,48,72,96,120h, every hole adds MTT solution (5mg/ml) 20 μ l, after 4h is cultivated in 37 ℃ of continuation, appends three liquid (10%SDS, 5% Virahol, 0.01M HCl), 100 μ l.Detect the absorption value (A595) in every hole under the 595nm after spending the night in the incubator with microplate reader.With time is transverse axis, and it is longitudinal axis drafting cell growth curve that experimental port deducts the photoabsorption ratio that zeroing hole and control wells deduct the zeroing hole.
The result is as shown in Figure 5: 1. compare with control group, virus of A dCN205-11-IL-24 has stronger lethal effect to marrow series leukemia cell; 2. AdCN205-11-IL-24 has significant solid tumor resisting characteristic equally, and embodies certain superiority; 3. AdCN205-11-IL-24 is very little to normal cytotoxicity.
Embodiment 4: virus of A dCN205-11-IL-24 is the replication analysis in blood tumor cell
(K562, Kasumi-1 6T-CEM) use AdCN205-EGFP, AdCN205-IL-24, AdCN205-11-EGFP and the AdCN205-11-IL-24 virus infected cell of 10MOI respectively to the every hole of 6 orifice plates inoculation 5 * 105 tumour cells behind the 24h.Behind the 4h, the exhaustion substratum is washed 2 times with PBS, adds the 2ml fresh culture again.Collect virus infection liquid behind the virus infection 48h ,-20 ℃ with 37 ℃ of multigelations 3 times with releasing virus, the centrifugal 5min of 12000rpm draws supernatant extracting viral DNA and detects virus titer (result is as shown in Figure 6) by Real-Time PCR method.
Embodiment 5: virus of A dCN205-11-IL-24 is the expression alien gene capability analysis in blood tumor cell
(K562, Kasumi-1 6T-CEM) use AdCN205-IL-24 and the AdCN205-11-IL-24 virus infected cell of 10MOI respectively to the every hole of 6 orifice plates inoculation 5 * 105 tumour cells behind the 24h.Behind the 4h, the exhaustion substratum is washed 2 times with PBS, adds the 2ml fresh culture again.Collect virus infection liquid behind the virus infection 72h, the centrifugal 3min of 2000rpm, the collecting precipitation cell adds 100 μ l, 1 * loading buffer with lysing cell, with cell lysate at 100 ℃ of water-bath 10min to obtain total protein.Every hole adds equivalent total protein sample and carries out the SDS-PAGE electrophoresis.Electrophoresis finishes the back and by semidrying the electrophoresis product is transferred on the NC film.5% skim-milk room temperature sealing 2h drips one anti-(dilution in 1: 1000) and hatches 2h for 37 ℃, and TPBS washes film 5min * 3 time, drips fluorescently-labeled two anti-(dilutions in 1: 2000) and hatches 1h for 37 ℃, and PBS washes film 5min * 3 time.OdysseyInfrared Imaging System scanning detects (result as shown in Figure 7).
Claims (3)
1. three-target mosaic type oncolytic adenovirus Ad5/F11 construction of carrier, it is characterized in that, this method be with two target oncolytic adenovirus carrier pCN103 and pCN205 as the basis, undertaken chimeric and utilize reverse transcriptase of telomere hTERT promotor to regulate and control to lack the e1a gene of CR2 district and the necessary 24bp of Rb protein binding by scleroproein fiber the skeleton of 5 type adenovirus Ad5 and people 11 type adenovirus Ad11.
2. the described three-target mosaic type oncolytic adenovirus of claim 1 Ad5/F11 construction of carrier is characterized in that this method specifically may further comprise the steps:
(1) method by PCR is loaded into shuttle plasmid p11zf-ad5-ad11p with the Fiber gene of people's 11 type adenovirus.
(2) pass through the method for homologous recombination with 5 C-type virus C Fiber genes in people's 11 C-type virus C Fiber genes replacement pCN103 skeleton plasmid.
(3) cut the method structure E3 district disappearance 6.7K of connection and the vector plasmid pCN204 of gp19K gene with enzyme;
(4) foreign gene such as IL-24, TRAIL, SOCS3, cpp-SOCS3, SOCS1 and the cpp-SOCS1 that all is had killing and wounding and suppress all kinds of cancers clones the into multiple clone site of pCN204, is built into plasmid pCN204-IL-24.
(5) with plasmid pCZ204-IL-24 by enzyme cut reclaim with fragment after, electricity transforms in the BJ5183 homologous recombination, obtains three-target mosaic type oncolytic adenovirus Ad5/F11 carrier, called after pCN205-11p carrier.
3. the purposes of the described three-target mosaic type oncolytic adenovirus of claim 2 an Ad5/F11 construction of carrier, it is characterized in that, obtain three-target mosaic type oncolytic adenovirus that carrier pCN205-11p makes up such as AdCN205-11-IL-24, AdCN205-11-TRAIL, AdCN205-11-SOCS3, AdCN205-11-cpp-SOCS3 with this method, AdCN205-11-SOCS1 and AdCN205-11-cpp-SOCS1 are used to prepare the purposes of the medicine for the treatment of tumour.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100996045A CN101565718A (en) | 2009-06-11 | 2009-06-11 | Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100996045A CN101565718A (en) | 2009-06-11 | 2009-06-11 | Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101565718A true CN101565718A (en) | 2009-10-28 |
Family
ID=41282083
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2009100996045A Pending CN101565718A (en) | 2009-06-11 | 2009-06-11 | Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101565718A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102002483A (en) * | 2010-07-19 | 2011-04-06 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Hematopoietic targeted helper adenovirus and application thereof |
| CN103038343A (en) * | 2010-03-23 | 2013-04-10 | 英特瑞克斯顿股份有限公司 | Vectors conditionally expressing therapeutic proteins, host cells comprising the vectors, and uses thereof. |
| CN106591247A (en) * | 2016-12-31 | 2017-04-26 | 兰州大学 | Bladder-cancer specific oncolytic adenovirus independent of CAR and establishment method |
| CN106591368A (en) * | 2016-10-12 | 2017-04-26 | 郑州大学 | B subgroup adenovirus 11 vector carrying IL-15R/IL-15 fusion genes and construction and application of the same |
| CN108715863A (en) * | 2018-05-30 | 2018-10-30 | 吉林大学 | A kind of tumor-targeting carrier pcTERT and its construction method and its application |
| CN110272917A (en) * | 2019-06-24 | 2019-09-24 | 苏英晗 | A set of fast and accurately three plasmid oncolytic adenovirus recombination packaging system Ad5MixPlus and its application |
-
2009
- 2009-06-11 CN CNA2009100996045A patent/CN101565718A/en active Pending
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103038343A (en) * | 2010-03-23 | 2013-04-10 | 英特瑞克斯顿股份有限公司 | Vectors conditionally expressing therapeutic proteins, host cells comprising the vectors, and uses thereof. |
| US10584351B2 (en) | 2010-03-23 | 2020-03-10 | Intrexon Corporation | Vectors conditionally expressing therapeutic proteins, host cells comprising the vectors, and uses thereof |
| CN102002483A (en) * | 2010-07-19 | 2011-04-06 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Hematopoietic targeted helper adenovirus and application thereof |
| CN102002483B (en) * | 2010-07-19 | 2013-04-17 | 中国人民解放军军事医学科学院放射与辐射医学研究所 | Hematopoietic targeted helper adenovirus and application thereof |
| CN106591368A (en) * | 2016-10-12 | 2017-04-26 | 郑州大学 | B subgroup adenovirus 11 vector carrying IL-15R/IL-15 fusion genes and construction and application of the same |
| CN106591247A (en) * | 2016-12-31 | 2017-04-26 | 兰州大学 | Bladder-cancer specific oncolytic adenovirus independent of CAR and establishment method |
| CN108715863A (en) * | 2018-05-30 | 2018-10-30 | 吉林大学 | A kind of tumor-targeting carrier pcTERT and its construction method and its application |
| CN108715863B (en) * | 2018-05-30 | 2020-09-11 | 吉林大学 | Tumor targeting vector pcTERT and construction method and application thereof |
| CN110272917A (en) * | 2019-06-24 | 2019-09-24 | 苏英晗 | A set of fast and accurately three plasmid oncolytic adenovirus recombination packaging system Ad5MixPlus and its application |
| WO2020258825A1 (en) * | 2019-06-24 | 2020-12-30 | 江苏万戎生物医药科技有限公司 | Fast and accurate three-plasmid oncolytic adenovirus recombinant packaging system ad5mixplus and application thereof |
| CN110272917B (en) * | 2019-06-24 | 2023-08-22 | 江苏万戎生物医药科技有限公司 | Rapid and accurate three-plasmid oncolytic adenovirus recombination packaging system Ad5MixPlus and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hemminki et al. | Adenoviruses in oncology: a viable option? | |
| CN103614416B (en) | A kind of recombination oncolytic adenovirus of carrier's cell-penetrating peptide p53 and GM-CSF gene and application thereof | |
| CN107252438A (en) | Oncolytic adenovirus for treating cancer | |
| CN101128593A (en) | Method for reversing multiple resistance in animal cells | |
| CN101381742A (en) | Late promoter targeting regulation oncolytic adenovirus pCN305 vector and construction method and application thereof | |
| CN101565718A (en) | Construction method of three-target mosaic type oncolytic adenovirus Ad5/F11 carrier and use thereof | |
| CN111606999A (en) | Replicative oncolytic adenovirus with functions of activating immune co-stimulatory signal pathway and blocking immune check point and application thereof | |
| CA2449013C (en) | Viral mutants that selectively replicate in targeted human cancer cells | |
| Kangasniemi et al. | Effects of capsid‐modified oncolytic adenoviruses and their combinations with gemcitabine or silica gel on pancreatic cancer | |
| CN105755043A (en) | Double-copy human p53 gene recombinant adenovirus and preparation method thereof | |
| CN1328372C (en) | Tumor target gene-virus ZD55-IL-24, construction method and application thereof | |
| AU2002346084A1 (en) | Viral mutants that selectively replicate in targeted human cancer cells | |
| CN103055325A (en) | Specific gene-virus therapeutic drug for colorectal cancer | |
| JP4354814B2 (en) | Recombinant adenovirus having improved disease treatment effect and pharmaceutical composition containing the same | |
| US20060275262A1 (en) | Conditionally replicating viruses and methods for cancer virotherapy | |
| CN102229962B (en) | Oncolytic adenovirus vector for modifying and expressing two exogenous genes by fibrin, construction method and application of vector | |
| WO1999044423A1 (en) | Amplification of gene transfer and gene therapy by controlled replication | |
| Shan et al. | Experimental studies on treatment of pancreatic cancer with double-regulated duplicative adenovirus AdTPHre-hEndo carrying human endostatin gene | |
| Hemminki et al. | Oncolytic adenoviruses in the treatment of cancer in humans | |
| CN101649328A (en) | Ad5 D24 conditional reproduction type adenovirus carrier for expressing multiple exogenous genes, constructing method and application thereof | |
| CN111500632A (en) | Construction and application of oncolytic adenovirus expressing ST13 and TRAI L | |
| KR100993881B1 (en) | Compositions for Enhancing Gene Delivery Efficiency of Gene Delivery Systems and for Preserving Viruses | |
| CN101928696A (en) | Preparation and application of prostate cancer targeting adenovirus | |
| CN101864400B (en) | Specific recombinant adenoviruses, preparation thereof and use thereof | |
| CN101219222B (en) | Application of PDCD4 recombined expression vector in preparing medicament for treating gonad cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20091028 |