CN103233038B - Transgenic pest-resistant corn transformant specific plasmid molecule pMD-ESM, and construction method and application thereof - Google Patents
Transgenic pest-resistant corn transformant specific plasmid molecule pMD-ESM, and construction method and application thereof Download PDFInfo
- Publication number
- CN103233038B CN103233038B CN201310121580.5A CN201310121580A CN103233038B CN 103233038 B CN103233038 B CN 103233038B CN 201310121580 A CN201310121580 A CN 201310121580A CN 103233038 B CN103233038 B CN 103233038B
- Authority
- CN
- China
- Prior art keywords
- mir162
- pmd
- esm
- specificity
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a transgenic corn MIR162 transformant specific plasmid molecule pMD-ESM. A vacant vector thereof is a plasmid vector pMD19-T vector. The vector comprises a transgenic corn MIR162 transformant specific sequence and a corn internal standard gene sequence, represented by 1 in the sequence list. The construction method is that: specific PCR primers are designed; amplification is carried out upon transgenic corn MIR162 genome DNA, such that a target fragment is obtained; and with a molecular cloning technology, the target fragment is constructed into the pMD19-T vector, such that the plasmid molecule pMD-ESM is obtained. The plasmid molecule pMD-ESM provided by the invention can be used as an alternative of a transgenic corn MIR162 standard product, and can be used in transgenic corn MIR162 qualitative and quantitative detections. The plasmid molecule pMD-ESM has the advantages of good applicability and stability. With the plasmid molecule, actual sample analysis result is accurate. Therefore, a problem of the lack of positive standard substance during the detection process of the strain is solved. The plasmid molecule pMD-ESM has good application value and market prospect.
Description
Technical field
The present invention relates to a kind of plasmid molecule pMD-ESM detected for transgenic corns MIR162 specificity of transformant, and construction process, and its application in detection by quantitative, belong to biology field.
Background technology
Transgenic corns MIR162 is that Syngenta Co., Ltd of U.S. application modern molecular biology technique will form by cultivating in agrobacterium mediation converted to maize immature embryos containing anti-lepidopterous insects protein gene plasmid vector pNOV13000.It contains two foreign gene (Vip3Aa and manA) expression cassettes (Gene expression cassette), and insertion sequence is about 9.4kb.Vip3Aa expression casette comprises insect resistance protein Vip3Aa20 encoding gene, ZmUbiInt promotor and 35S terminator sequence; ManA expression casette comprises manA encoding gene, ZmUbiInt promotor and NOS terminator sequence.
Current transgenic corns MIR162 has obtained the approval of commercial growth in the U.S., Canada, Brazil and Argentina, Vietnam also have approved the field trial application of this transformed variety in the near future.Commercially produce because this corn strain has carried out big area, its product likely appears among China's import corn and processed goods thereof, according to China's " agriculture GMO bio-safety management rules " and " agriculture genetically modified organism identity management way " regulation, transgenic product must carry out necessary identity management.
New DNA reference material has easy acquisition to plasmid molecule (Plasmid Molecule), easy to use, purity is easy to control and the advantage such as good uniformity as a kind of, is more and more applied in transgenic product detection by quantitative.Research, building and turn phytase gene corn positive plasmid molecule, for strengthening the security control of this kind, Protection of consumer interests, eliminating the doubt of the public for safety of transgenic crops, it is significant to build good genetically modified crops industrialization atmosphere.
Summary of the invention
For above-mentioned prior art, the invention provides a kind of plasmid molecule pMD-ESM detected for transgenic corns MIR162 specificity of transformant, present invention also offers its construction process, and its application in detection by quantitative.
The present invention is achieved by the following technical solutions:
A kind of transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM, its empty vectors is plasmid vector pMD19-T carrier, include transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence, the specific sequence of this plasmid molecule is as follows:
ACACCAATGATGCAAATAGGCTGGGAATAGTCTGTCTAATAGTTTGAGTGAATCAT GTCACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAA TTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACTGA AGCCAGAGCCCGCAGGCCATCGCTGAACCGGTGGATGCTAAGGCTGATGCAGCTCC GGCTACAGATGCGGCGGCGAGTGCTCCTTATGACAGGGAGGATAATGAACCTGGCC CTTTGGCTGGGCCTAATGTGATGAACGTCGTCGT, as shown in sequence table 1.
The construction process of described transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM is: first, design Specific PCR primers, from transgenic corns MIR162 genomic dna, amplification obtains transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence, then, molecule clone technology is utilized to be building up in pMD19-T carrier by this two segment DNAs fragment, obtain new plasmid molecule pMD-ESM(ordinary method, processing step is conventional, but PCR Auele Specific Primer and new plasmid molecule sequence are one of inventive point of the present invention).
Concrete construction step is as follows:
(1) design PCR Auele Specific Primer: utilize the databases such as GenBank to carry out bioinformatic analysis, obtain transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence, according to sequences Design PCR Auele Specific Primer;
(2) object fragment is obtained: utilize above-mentioned PCR Auele Specific Primer specific amplification object fragment: transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence; Reclaim this two object fragments, adopt primer C-MIR162-1F/C-zSSIIb-2R to carry out over-lap PCR amplification as template;
(3) structure of plasmid: PCR primer obtained above is connected on pMD19-T carrier (2692bp) by ligase enzyme after reclaiming; Product conversion after connection is to bacillus coli DH 5 alpha, and adopt gel electrophoresis qualification positive plasmid and sequence verification, what be accredited as positive plasmid is transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM.
In described step (1), PCR Auele Specific Primer is two right, and sequence is as follows:
C-MIR162-1F:5'-ACACCAATGATGCAAATAGGCT-3'；
C-MIR162-2R:5'-GCGGGCTCTGGCTTCAGTAAAACGGCTTGTCCCGC-3'；
C-zSSIIb-1F:5'-GCGGGACAAGCCGTTTTACTGAAGCCAGAGCCCGC-3'；
C-zSSIIb-2R:5'-ACGACGACGTTCATCACATTAGG-3', as shown in sequence table 2,3,4,5.
In described step (2), the concrete steps obtaining object fragment are as follows: amplification the primer is C-MIR162-1F/C-MIR162-2R and C-zSSIIb-1F/C-zSSIIb-2R, amplification system is PremixExTaq (Takara) 20 μ L, upstream and downstream primer (10 μm of ol/L) each 2.5 μ L, transgenic corns MIR162 template DNA (50ng/ μ L) 2 μ L, add water and complement to 50 μ L; Response procedures is: 95 DEG C of 5min; 95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 35 circulations; 72 DEG C of 7min.Amplification system and the response procedures of over-lap PCR amplification are as follows: amplification system is PremixrTaq (Takara) 15 μ L, upstream and downstream primer (10 μm of ol/L) each 1.5 μ L, and the object fragment 2 μ L of recovery, adds water and complement to 30 μ L; Response procedures is: 95 DEG C of 5min; 95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 45s, 35 circulations; 72 DEG C of 7min.
Plasmid molecule pMD-ESM constructed by the present invention, can be used as the substitute of transgenic corns MIR162 standard substance, for the qualitative and quantitative analysis of transgenic corns MIR162; Detection by quantitative comprises SYBR Green I real time fluorescent quantitative and detects and the detection of TaqMan probe real time fluorescent quantitative.
During qualitative detection, method is as follows:
First, extract the genomic dna of detected sample, as template, use MIR162 specificity of transformant primer to carry out pcr amplification, using transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM as positive control; Then, the pcr amplification product of detected sample is separated with agarose gel electrophoresis, and after EB dyeing, whether qualification exists amplified production, if there is amplified production, then contains transgenic corns MIR162 transformation event in detected sample; If there is not amplified production, then do not contain transgenic corns MIR162 transformation event in detected sample.
Described MIR162 specificity of transformant primer sequence following (namely number of patent application is 201210053592.4, publication number is Auele Specific Primer disclosed in the application for a patent for invention of 102586442A):
MIR162-F:5'-CTGTCTAATAGTTTGAGTGA-3'；
MIR162-R:5'-GTGACTCCCTTAATTCTC-3'。
When SYBRGreenI real time fluorescent quantitative detects, concrete grammar is as follows:
(1) the SYBR Green I real-time fluorescence quantitative PCR typical curve of MIR162 gene and the SYBR Green I real-time fluorescence quantitative PCR typical curve of zSSIIb gene is set up:
1. gradient dilution is carried out to plasmid molecule pMD-ESM, then in each diluent, add MIR162 specificity of transformant primer, and the national standard primer of zSSIIb gene, increase;
2. after amplification, measure the Ct value of fluorescence associated marker in each diluent, the natural logarithm of this Ct value and copy number is linear, draws the SYBR Green I real-time fluorescence quantitative PCR typical curve of MIR162 transformation event and the SYBR Green I real-time fluorescence quantitative PCR typical curve of zSSIIb gene accordingly;
(2) extract detected sample genomic dna, obtain extracting genome DNA liquid, then in extracting genome DNA liquid, add MIR162 specificity of transformant primer, and the national standard primer of zSSIIb gene, increase; After amplification, measure the Ct value of fluorescence associated marker in extracting genome DNA liquid, then according to the SYBR Green I real-time fluorescence quantitative PCR typical curve of the MIR162 gene of above-mentioned drafting and the SYBR Green I real-time fluorescence quantitative PCR typical curve of zSSIIb gene, calculate corresponding copy number, then the copy number of transgenic corns MIR162 gene and the ratio of the copy number of corn internal standard gene zSSIIb gene, be the percentage composition of transgenic corns MIR162 in detected sample.
Described step (1) is 1. with in (2), and zSSIIb primer sequence (national standard) is as follows:
zSSIIb-F:5'-CGGTGGATGCTAAGGCTGATG-3'；
zSSIIb-R:5'-AAAGGGCCAGGTTCATTATCCTC-3'。
Described step (1) is 1. with in (2), the parameter of amplification is as follows: amplified reaction volume is 20 μ L, 2 × Premix Ex Taq (Rox) 10 μ L, and concentration is the Forward primer0.4 μ L of 10 μm of ol/L, concentration is the Reverse primer0.4 μ L of 10 μm of ol/L, ddH
2o8.2 μ L, DNA profiling 1 μ L; Amplification reaction condition: 95 DEG C of 10min denaturations; 95 DEG C of 15s, 60 DEG C of 30s, collect fluorescent signal at 60 DEG C, amounts to 40 circulations.
Described step (1) is 1. and in (2), MIR162 specificity of transformant primer sequence following (namely number of patent application is 201210053592.4, publication number is Auele Specific Primer disclosed in the application for a patent for invention of 102586442A):
MIR162-F:5'-CTGTCTAATAGTTTGAGTGA-3'；
MIR162-R:5'-GTGACTCCCTTAATTCTC-3'。
When TaqMan probe real time fluorescent quantitative detects, method is as follows:
(1) the TaqMan probe real-time fluorescence quantitative PCR typical curve of transgenic corns MIR162 and the TaqMan probe real-time fluorescence quantitative PCR typical curve of zSSIIb gene is set up:
1. gradient dilution is carried out to plasmid molecule pMD-ESM, then in each diluent, add transgenic corns MIR162 specificity of transformant primer and fluorescence labeling probe, and the national standard primer of zSSIIb gene and fluorescence labeling probe, increase;
2. after amplification, measure the Ct value of fluorescence associated marker in each diluent, the natural logarithm of this Ct value and copy number is linear, draws the TaqMan probe real-time fluorescence quantitative PCR typical curve of transgenic corns MIR162 and the TaqMan probe real-time fluorescence quantitative PCR typical curve of zSSIIb gene accordingly;
(2) detected sample genomic dna is extracted, obtain extracting genome DNA liquid, then in extracting genome DNA liquid, transgenic corns MIR162 specificity of transformant primer and fluorescence labeling probe is added, and the national standard primer of zSSIIb gene and fluorescence labeling probe, increase; After amplification, measure the Ct value of fluorescence associated marker in extracting genome DNA liquid, then according to the transgenic corns MIR162 quantitative PCR typical curve of above-mentioned drafting and the quantitative PCR typical curve of zSSIIb gene, calculate corresponding copy number, then transgenic corns MIR162 copy number and the ratio of the copy number of corn internal standard gene zSSIIb gene, be the percentage composition of transgenic corns MIR162 in detected sample.
Described step (1) 1. and (2) in, zSSIIb primer and probe sequence (national standard) as follows:
zSSIIb-1F:5'-CGGTGGATGCTAAGGCTGATG-3'；
zSSIIb-2R:5'-AAAGGGCCAGGTTCATTATCCTC-3'；
zSSIIb-P:FAM-5'-TAAGGAGCACTCGCCGCCGCATCTG-3'-TAMRA。
Described step (1) is 1. with in (2), the parameter of amplification is as follows: amplified reaction volume is 20 μ L, 2 × PremixEx Taq (Rox) 12.5 μ L, concentration is the Forward primer1 μ L of 10 μm of ol/L, concentration is the Reverse primer1 μ L of 10 μm of ol/L, concentration is the TaqMan probe0.5 μ L of 10 μm of ol/L, ddH2O4 μ L, DNA profiling 1 μ L; Amplification reaction condition: 95 DEG C of 10min denaturations; 95 DEG C of 15s, 60 DEG C of 30s, collect fluorescent signal at 60 DEG C, amounts to 40 circulations.
Described step (1) is 1. and in (2), MIR162 specificity of transformant primer and probe sequence following (namely number of patent application is 201210053592.4, publication number is Auele Specific Primer and probe disclosed in the application for a patent for invention of 102586442A):
MIR162-1F:5'-CTGTCTAATAGTTTGAGTGA-3'；
MIR162-2R:5'-GTGACTCCCTTAATTCTC-3'；
MIR162-P:FAM-5'-CAGATTGTCGTTTCCCGCCTTC-3'-Eclipse。
The present invention utilizes the method for over-lap PCR and molecular subcloning to construct standard plasmid molecule pMD-ESM containing transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence first.The substitute that the plasmid molecule pMD-ESM that the present invention builds can be used as transgenic corns MIR162 standard substance detects transgenic corns MIR162 content in corn and related products thereof for SYBRGreenI real-time fluorescence quantitative PCR and TaqMan probe real time fluorescent quantitative, its suitability is strong, good stability, the results contrast analyzed actual sample is accurate, well solve the problem that the positives reference material of this strain testing process lacks, there are high using value and market outlook.
Accompanying drawing explanation
Fig. 1 is plasmid molecule pMD-ESM collection of illustrative plates constructed in embodiment 1.
Fig. 2 is the SYBR Green I real-time fluorescence quantitative PCR typical curve of internal standard gene zSSIIb in embodiment 2.
Fig. 3 is transgenic corns MIR162SYBR Green I real-time fluorescence quantitative PCR typical curve in embodiment 2.
Fig. 4 is the TaqMan probe real-time fluorescence quantitative PCR typical curve of internal standard gene zSSIIb in embodiment 3.
Fig. 5 is transgenic corns MIR162TaqMan probe for real-time fluorescence quantitative PCR typical curve in embodiment 3.
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated.
Embodiment 1 builds plasmid pMD-ESM
Step is as follows:
(1) design PCR Auele Specific Primer: utilize the databases such as GenBank to carry out bioinformatic analysis, obtain transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence, according to sequences Design PCR Auele Specific Primer, sequence is as follows:
C-MIR162-1F:5'-ACACCAATGATGCAAATAGGCT-3'；
C-MIR162-2R:5'-GCGGGCTCTGGCTTCAGTAAAACGGCTTGTCCCGC-3'；
C-zSSIIb-1F:5'-GCGGGACAAGCCGTTTTACTGAAGCCAGAGCCCGC-3'；
C-zSSIIb-2R:5'-ACGACGACGTTCATCACATTAGG-3'。
(2) object fragment is obtained: utilize above-mentioned PCR Auele Specific Primer specific amplification object fragment: transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence; Reclaim this two object fragments, adopt primer C-MIR162-1F/C-zSSIIb-2R to carry out over-lap PCR amplification as template;
The concrete steps obtaining object fragment are as follows: adopt DNA extraction kit (Omega) to extract transgenic corns MIR162 seed DNA, primer C-MIR162-1F/C-MIR162-2R and C-zSSIIb-1F/C-zSSIIb-2R is used to carry out pcr amplification, amplification system is PremixExTaq (Takara) 20 μ L, upstream and downstream primer (10 μm of ol/L) each 2.5 μ L, MIR162 template DNA (50ng/ μ L) 2 μ L, add water and complement to 50 μ L; Response procedures is: 95 DEG C of 5min; 95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 35 circulations; 72 DEG C of 7min.Amplification system and the response procedures of over-lap PCR amplification are as follows: amplification system is PremixrTaq (Takara) 15 μ L, upstream and downstream primer (10 μm of ol/L) each 1.5 μ L, and the object fragment 2 μ L of recovery, adds water and complement to 30 μ L; Response procedures is: 95 DEG C of 5min; 95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 45s, 35 circulations; 72 DEG C of 7min.
(3) structure of plasmid: PCR primer obtained above is connected on pMD19-T carrier (2692bp) by ligase enzyme after reclaiming; Product conversion after connection is to bacillus coli DH 5 alpha, and adopt gel electrophoresis qualification positive plasmid and sequence verification, what be accredited as positive plasmid is transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM, and through order-checking, its sequence is as follows:
ACACCAATGATGCAAATAGGCTGGGAATAGTCTGTCTAATAGTTTGAGTGAATCATGTCACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACTGAAGCCAGAGCCCGCAGGCCATCGCTGAACCGGTGGATGCTAAGGCTGATGCAGCTCCGGCTACAGATGCGGCGGCGAGTGCTCCTTATGACAGGGAGGATAATGAACCTGGCCCTTTGGCTGGGCCTAATGTGATGAACGTCGTCGT。
Constructed plasmid molecule collection of illustrative plates as shown in Figure 1.
The application of embodiment 2 plasmid molecule pMD-ESM in transgenic corns MIR162SYBR Green I real-time fluorescence quantitative PCR detects
Plasmid molecule pMD-ESM is diluted to 25000,5000,1000,200 and 40copies/ μ L respectively by 5 times of multiple proportions, and each concentration establishes 3 repetitions, detects the repeatability of amplification.
Primer and probe are synthesized by Dalian Takara company, are diluted to 10 μm of ol/L for subsequent use.
The transgenic corns MIR162 specificity of transformant primer sequence of synthesis is as follows:
MIR162-1F:5'-CTGTCTAATAGTTTGAGTGA-3'；
MIR162-2R:5'-GTGACTCCCTTAATTCTC-3'。
Corn interior label primer and probe (zSSIIb) adopt national standard primer, and its sequence is as follows:
zSSIIb-F:5'-CGGTGGATGCTAAGGCTGATG-3'；
zSSIIb-R:5'-AAAGGGCCAGGTTCATTATCCTC-3'。
Amplified reaction volume is 20 μ L, and amplified reaction volume is 20 μ L, 2 × Premix Ex Taq (Rox) 10 μ L, and concentration is the Forward primer0.4 μ L of 10 μm of ol/L, and concentration is the Reverse primer0.4 μ L of 10 μm of ol/L, ddH
2o8.2 μ L, DNA profiling 1 μ L.Amplification reaction condition: 95 DEG C of 10min denaturations; 95 DEG C of 15s, 50 DEG C of 30s, 72 DEG C of 30s, collect fluorescent signal at 72 DEG C, amounts to 40 circulations.Each sample repeats 3 times, sets up aseptic double-distilled water (ddH simultaneously
2o, blank) and non-transgenic sample (Zheng Dan 958, negative) contrast.
Result: carry out the amplification of SYBR Green I real-time fluorescence quantitative PCR by the DNA being 25000,5000,1000,200 and 40 to different plasmid molecule pMD-ESM copy number, computer software generates typical curve automatically, ordinate zou is Ct, and X-coordinate is the natural logarithm of starting copy number.According to the Linearity Formula of typical curve gained, by the transgenic corns MIR162 standard substance (3% to different transgenosis content, 1%, 0.5%, 0.1%), the mensuration of positive, negative sample and blank, the Ct value of sample is substituted into formula, the percentage composition of testing sample transgene component can be obtained.
The amplification of SYBR GreenI real-time fluorescence quantitative PCR is carried out to the transgenic corns DNA of Auele Specific Primer to same group of standard substance DNA and different percentage composition of corn internal standard gene zSSIIb and transgenic corns MIR162, obtain pcr amplification curve respectively, and automatically generate typical curve by system software.As shown in Figure 2, this slope of a curve is-3.375 coefficients R to the typical curve of corn internal standard gene zSSIIb
2be 0.998, turn the typical curve of phytase gene corn gene-specific primer as shown in Figure 3, this slope of a curve is-3.485, coefficient R
2be 0.999; Article two, the standard deviation (SD) of typical curve is all less than 0.08, and relative standard deviation (RSD) is all less than 0.21%, therefore according to the Ct value of unknown sample, can calculate the starting copy number of this sample from typical curve.According to formula:
Transgenic corns MIR162 content in sample=(MIR162 specificity of transformant copy number/internal standard gene zSSIIb copy number) × 100%
The percentage composition of transgenic corns MIR162 in testing sample can be calculated.The quantitative result being the biased sample of 3%, 1%, 0.5% to transgenic corns MIR162 content is 3.17%, 1.03% and 0.47%, percentage deviation is respectively 5.6%, 3% and 6%, the standard deviation (SD) repeated for three times is all less than 0.049, and relative standard deviation (RSD) is all less than 10.4%; Above-mentioned quantitative result accuracy and precision is higher, all meets the quantitative measurement standard of European Union.
The application of embodiment 3 plasmid molecule pMD-ESM in transgenic corns MIR162TaqMan probe for real-time fluorescence quantitative PCR detection
Plasmid molecule pMD-ESM is diluted to 25000,5000,1000,200 and 40copies/ μ L respectively by 5 times of multiple proportions, and each concentration establishes 3 repetitions, detects the repeatability of amplification.
Primer and probe are synthesized by Dalian Takara company, are diluted to 10 μm of ol/L for subsequent use.
Transgenic corns MIR162 specificity of transformant primer and the probe sequence of synthesis are as follows:
MIR162-1F:5'-CTGTCTAATAGTTTGAGTGA-3'；
MIR162-2R:5'-GTGACTCCCTTAATTCTC-3'；
MIR162-P:FAM-5'-CAGATTGTCGTTTCCCGCCTTC-3'-Eclipse。
Corn interior label primer and probe (zSSIIb) adopt national standard primer and probe, and its sequence is as follows:
zSSIIb-F:5'-CGGTGGATGCTAAGGCTGATG-3'；
zSSIIb-R:5'-AAAGGGCCAGGTTCATTATCCTC-3'；
zSSIIb-P:FAM-5'-TAAGGAGCACTCGCCGCCGCATCTG-3'-TAMRA。
Amplified reaction volume is 20 μ L, amplified reaction volume is 20 μ L, 2 × Premix Ex Taq (Rox) 12.5 μ L, concentration is the Forward primer1 μ L of 10 μm of ol/L, concentration is the Reverse primer1 μ L of 10 μm of ol/L, concentration is the TaqMan probe0.5 μ L of 10 μm of ol/L, ddH
2o4 μ L, DNA profiling 1 μ L.Amplification reaction condition: 95 DEG C of 10min denaturations; 95 DEG C of 15s, 60 DEG C of 30s, collect fluorescent signal at 60 DEG C, amounts to 40 circulations.Each sample repeats 3 times, sets up aseptic double-distilled water (ddH simultaneously
2o, blank) and non-transgenic sample controls.
Result: carry out the amplification of TaqMan real-time fluorescence quantitative PCR by the DNA being 25000,5000,1000,200 and 40 to different plasmid molecule pMD-ESM copy number, computer software generates typical curve automatically, ordinate zou is Ct, and X-coordinate is the natural logarithm of starting copy number.According to the Linearity Formula of typical curve gained, by the transgenic corns MIR162 standard substance (3% to different transgenosis content, 1%, 0.5%), the mensuration of positive, negative sample and blank, the Ct value of sample is substituted into formula, the percentage composition of testing sample transgene component can be obtained.
The amplification of TaqMan real-time fluorescence quantitative PCR is carried out to corn internal standard gene zSSIIb and the transgenic corns DNA of gene-specific primer to same group of standard substance DNA and different percentage composition turning phytase gene corn, obtain pcr amplification curve respectively, and automatically generate typical curve by system software.Repeat the typical curve of experiment gained corn internal standard gene zSSIIb for three times as shown in Figure 4, this slope of a curve is-3.572 coefficients R
2be 0.998, turn the typical curve of phytase gene corn gene-specific primer as shown in Figure 5, this slope of a curve is-3.483, coefficient R
2be that the standard deviation (SD) of 0.999, two typical curves is all less than 0.11, relative standard deviation (RSD) is all less than 0.34%, therefore according to the Ct value of unknown sample, can calculate the starting copy number of this sample from typical curve.According to formula:
Transgenic corns MIR162 content in sample=(MIR162 specificity of transformant copy number/internal standard gene zSSIIb copy number) × 100%
The percentage composition of transgenic corns MIR162 in testing sample can be calculated.The quantitative result being the biased sample of 3%, 1%, 0.5% to transgenic corns MIR162 content is 3.12%, 1.06% and 0.56%, percentage deviation is respectively 4%, 6% and 12%, the standard deviation (SD) repeated for three times is all less than 0.106, and relative standard deviation (RSD) is all less than 10.9%; Above-mentioned quantitative result accuracy and precision is higher, all meets the quantitative measurement standard of European Union.
Above result can prove, the present invention is that transgenic corns MIR162SYBR Green I real-time fluorescence quantitative PCR and TaqMan probe real-time fluorescence quantitative PCR detect and provide that suitability is strong, the Positive substitute of good stability.For transgenic labeling provides a kind of strong technical support, the control for transgenic product provides necessary means.
Claims (4)
1., for a transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM for detection by quantitative, it is characterized in that: this transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence as follows:
ACACCAATGATGCAAATAGGCTGGGAATAGTCTGTCTAATAGTTTGAGTGAATCATGTCACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACTGAAGCCAGAGCCCGCAGGCCATCGCTGAACCGGTGGATGCTAAGGCTGATGCAGCTCCGGCTACAGATGCGGCGGCGAGTGCTCCTTATGACAGGGAGGATAATGAACCTGGCCCTTTGGCTGGGCCTAATGTGATGAACGTCGTCGT；
Build by the following method and obtain:
(1) PCR Auele Specific Primer is designed: according to transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequences Design PCR Auele Specific Primer;
(2) object fragment is obtained: utilize above-mentioned PCR primer amplified object fragment: transgenic corns MIR162 specificity of transformant sequence and corn internal standard gene sequence; Reclaim this two object fragments, adopt primer C-MIR162-1F/C-zSSIIb-2R to carry out over-lap PCR amplification as template;
(3) structure of plasmid: PCR primer obtained above is connected on pMD19-T carrier 2692bp by ligase enzyme after reclaiming; Product conversion after connection is to bacillus coli DH 5 alpha, and adopt gel electrophoresis qualification positive plasmid and sequence verification, what be accredited as positive plasmid is transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM;
In described step (1), PCR Auele Specific Primer is two right, and sequence is as follows:
C-MIR162-1F:5'-ACACCAATGATGCAAATAGGCT-3'；
C-MIR162-2R:5'-GCGGGCTCTGGCTTCAGTAAAACGGCTTGTCCCGC-3'；
C-zSSIIb-1F:5'-GCGGGACAAGCCGTTTTACTGAAGCCAGAGCCCGC-3'；
C-zSSIIb-2R:5'-ACGACGACGTTCATCACATTAGG-3'。
2. transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM according to claim 1, it is characterized in that: in described step (2), the concrete steps obtaining object fragment are as follows: amplification the primer is C-MIR162-1F/C-MIR162-2R and C-zSSIIb-1F/C-zSSIIb-2R, amplification system is Premix Ex Taq Takara 20 μ L, upstream and downstream primer 10 μm of ol/L, each 2.5 μ L, phytase corn template DNA 50ng/ μ L, 2 μ L, add water and complement to 50 μ L; Response procedures is: 95 DEG C of 5min; 95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 35 circulations; 72 DEG C of 7min.
3. the application of transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM according to claim 1 in SYBRGreen I real time fluorescent quantitative detects.
4. the application of transgenic corns MIR162 specificity of transformant plasmid molecule pMD-ESM according to claim 1 in TaqMan probe real time fluorescent quantitative detects.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310121580.5A CN103233038B (en) | 2013-04-09 | 2013-04-09 | Transgenic pest-resistant corn transformant specific plasmid molecule pMD-ESM, and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310121580.5A CN103233038B (en) | 2013-04-09 | 2013-04-09 | Transgenic pest-resistant corn transformant specific plasmid molecule pMD-ESM, and construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103233038A CN103233038A (en) | 2013-08-07 |
| CN103233038B true CN103233038B (en) | 2015-06-17 |
Family
ID=48881103
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310121580.5A Active CN103233038B (en) | 2013-04-09 | 2013-04-09 | Transgenic pest-resistant corn transformant specific plasmid molecule pMD-ESM, and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103233038B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676674A (en) * | 2012-05-10 | 2012-09-19 | 海康生物科技（北京）有限公司 | Plasmid reference molecule for genetically modified maize detection and preparation method thereof |
-
2013
- 2013-04-09 CN CN201310121580.5A patent/CN103233038B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676674A (en) * | 2012-05-10 | 2012-09-19 | 海康生物科技（北京）有限公司 | Plasmid reference molecule for genetically modified maize detection and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| 转基因作物检测阳性质粒分子的研制及应用;李俊;《中国优秀硕士学位论文全文数据库》;20121225;全文 * |
| 转基因玉米特异性检测阳性标准分子的构建与应用;沈雨萌等;《玉米科学》;20101231;第18卷(第4期);摘要、第53页第1.2.1节-第54页第1.2.4节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103233038A (en) | 2013-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Duan et al. | Natural variation in the promoter of GSE5 contributes to grain size diversity in rice | |
| Kou et al. | Selection and validation of suitable reference genes for miRNA expression normalization by quantitative RT-PCR in citrus somatic embryogenic and adult tissues | |
| CN104087576B (en) | Molecular marker related to color property of tomato fruit and application thereof | |
| CN102206632A (en) | Para-gene for exogenous insertion vector of transgenic maize transformation event MON88017 and application thereof | |
| CN105316329A (en) | Flammulina velutipes SSR molecular marker and corresponding primers and application thereof | |
| Wen et al. | Estimating transgene copy number in precocious trifoliate orange by TaqMan real-time PCR | |
| CN102586442A (en) | Specific primer and probe for assaying genetically modified corn MIR162 and application thereof | |
| CN112159858B (en) | Molecular marker closely linked with purple cauliflower gene and application thereof | |
| CN104032007A (en) | Method for detecting exogenous gene copy number in transgenic tobacco | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN105087759A (en) | Method for identifying target gene copy number in transgenic plant and for selecting low-copy plants | |
| CN107022646A (en) | Primer sets, kit and method for detecting cotton MON1445 transformant | |
| CN102559854B (en) | Standard plasmid molecular used for detecting transgenic soybean, corn and cotton and construction of the standard plasmid molecular | |
| CN102409082B (en) | Five-gene standard plasmid molecule for transgenic soybean detection and construction thereof | |
| CN103233038B (en) | Transgenic pest-resistant corn transformant specific plasmid molecule pMD-ESM, and construction method and application thereof | |
| CN103276097B (en) | PCR detection method for identifying germplasms of four populations of Pelodiscus sinensis, primer group and kit | |
| CN105631245B (en) | A kind of primer special and its identification method for identifying eastern cottonwood choiceness | |
| CN104561313B (en) | The internal standard gene of a kind of applicable Semen Sesami copy number of foreign gene detection and construction method and application | |
| CN103451185A (en) | Propylaea Japonica specific COI primers, kit containing primer and detection method thereof | |
| CN103205446B (en) | Construction and application of plasmid molecule pPZ used for phyA2 gene detection of phytase maize | |
| CN105543238A (en) | Transgenic maize IE 034 exogenous insertion element 3'-end flanking sequence and detection method | |
| CN104830857A (en) | Primer, probe and method for specific quantitative PCR accurate detection of genetically modified corn MON88017 strain | |
| CN102586242A (en) | Transgenic soybean BPS-CV127-9 transformation event exogenous insertion carrier flanking gene and application thereof | |
| Sun et al. | Development of Molecular Markers for the Determination of the New Cultivar ‘Chunpoong’in Panax ginseng CA M EYER Associated with a Major Latex-Like Protein Gene | |
| CN112899388B (en) | InDel marked fingerprint of shiitake mushroom like strain and construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |