CN103233028B - Specie limitation-free eucaryote gene targeting method having no bio-safety influence and helical-structure DNA sequence - Google Patents

Abstract

The invention discloses a eukaryotic gene targeting method and a helical structure DNA sequence without species limitation and without biological safety problems, belonging to the field of genetic engineering. The steps of the method are: (1) Design and construction of CRISPR/Cas9 and chimeric RNA; (2) Cas9 mRNA is translated in vivo to form a Cas9 nuclease that binds to the chimeric RNA to achieve fixed-point shearing and generate DNA double strands after shearing Fragmentation, by inducing the cell's own natural DNA repair process "non-homologous end joining" to introduce foreign DNA, thereby modifying the cell's endogenous genes. The method has simple steps, flexible recognition sites and low consumption.

Description

A eukaryotic gene targeting method and helical DNA sequence without species limitation and without biosafety problems

technical field

The invention belongs to the field of genetic engineering, and more specifically relates to a eukaryotic gene targeting method and a helical structure DNA sequence without species limitation and without biological safety problems.

Background technique

Gene targeting technology is an experimental method to directional change the genetic information of organisms. In recent years, with the development of biotechnology, zinc finger nuclease (ZFN) technology and transcription activator-like effector nuclease (TALEN) technology have been applied in gene targeting, and these two technologies have greatly improved the specificity of targeted modification. ZFN is composed of a DNA recognition domain and a non-specific endonuclease. The DNA recognition domain is composed of a series of Cys2-His2 zinc-finger proteins (zinc-fingers) in series (generally 3-4), and each zinc-finger protein recognizes and binds a specific triplet base. Multiple zinc finger proteins can be connected in series to form a zinc finger protein group to recognize a specific base sequence, and the non-specific endonuclease connected to the zinc finger protein group is a DNA clipper consisting of 96 amino acid residues from the C-terminal of FokI. cut domain. FokI is a restriction endonuclease from Flavobacterium seabed. It has enzyme cutting activity only in the dimer state. Each FokI monomer is connected with a zinc finger protein group to form a ZFN, which recognizes a specific site , when the two recognition sites are at an appropriate distance (6-8 bp), the two monomeric ZFNs interact to produce enzyme cutting function. In order to achieve the purpose of DNA site-specific shearing. After shearing, DNA double-strand breaks are generated, and exogenous DNA is introduced by inducing the cell's own natural DNA repair process "homologous-directed repair" or "non-homologous end joining", thereby modifying the endogenous genes of the cell.

Zinc finger nuclease technology breaks through the limiting factor of gene targeting - targeting efficiency, and increases the efficiency of gene targeting from the original 10-6 to 10-7 to 10-1 to 10-2. However, zinc finger nucleases will produce off-target phenomena during the genetic modification process, causing cell dose-dependent toxicity. Gupta et al. used different zinc finger nucleases to study the targeted modification of the zebrafish kdrl locus, and used Illumina sequencing to evaluate 141 potential off-target sites in zebrafish, and found that only a few off-target sites caused cumulative damage to cells. For this reason, in-depth research on zinc finger nuclease-gene targeting technology is still needed.

TALEN technology uses the protein naturally secreted by the plant pathogen Xanthomonas (TAL effectors, TALEs) to recognize the function of specific DNA base pairs, and designs a string of suitable TALEs to Recognize and bind to any specific sequence, and then attach a non-specific endonuclease FokI to TALEs to construct a TALEN, thereby realizing the cutting of the DNA double strand at a specific site, and by inducing the cell's own natural DNA repair process, in the cell The introduction of new genetic material into the genome. Compared with zinc finger nuclease technology, TALEN can target longer gene sequences and is easier to construct.

But so far, whether it is ZFN or TALEN, there are many requirements for its recognition sequence, and it is impossible to target every possible DNA sequence, and it is not easy to simultaneously target two or more sites and assemble ZFN ZFNs or TALENs are also a time-consuming, labor-intensive and expensive process, and there has been no low-cost and publicly available method to rapidly produce large quantities of ZFNs or TALENs.

Contents of the invention

1. The technical problem to be solved by the invention

Aiming at the problems of large limitations, time-consuming, labor-intensive and high cost in realizing specific genome modification through ZFNs or TALENs in the prior art, the present invention provides a kind of eukaryotic gene targeting without species limitation and without biological safety problems The method and the helical structure DNA sequence, the method has simple steps, flexible recognition sites and low consumption.

2. Technical solution

Invention principle: Utilizing the directional recognition and cutting functions of the clustered regularly interspaced short palindromic repeat (CRISPR/Cas) system of prokaryotes, the method of the present invention realizes the recognition of eukaryotes by increasing the nuclear localization of this system in eukaryotes. In nuclear organisms, the cleavage of specific sites targeting DNA will introduce mutations in the targeted DNA sequence during the repair process after cleavage, thereby achieving the purpose of gene targeting.

The present invention realizes above-mentioned object through following technical scheme:

A eukaryotic gene targeting method without species limitation and without biosafety problems, the steps of which are as follows:

(1) Design and construction of CRISPR/Cas9 and chimeric RNA

1) Optimize the codon encoding Cas9

2) Cas9 nuclease vector construction and Cas9 nuclease mRNA synthesis

According to the optimized sequence in step 1), custom synthesize the DNA sequence encoding Cas9 nuclease, and insert it into the following expression vectors to form: pST1374-Cas9, pST1374-NLS-Flag-Cas9;

Using two primers Cas9C-NLS Cla For and Cas9C-NLS Apa Rev, a DNA fragment was amplified by chain polymerase reaction (PCR), and the amplified DNA fragment and pST1374 were digested with two restriction enzymes ClaI and ApaI -NLS-Flag-Cas9, insert the amplified DNA fragment into pST1374-NLS-Flag-Cas9, construct pST1374-NLS-Flag-Cas9-NLS vector;

The sequences encoding the three nuclear localization signals NLS were amplified by PCR using the Cas9-N-3NLS For and Cas9-N-3NLS Rev primers using oligonucleotides as templates, and the PCR products were restricted by NheI and NotI After enzyme digestion, insert the same restriction site into the pST1374-NLS-Flag-Cas9 vector to construct pST1374-3XNLS-Flag-Cas9;

The helix structure (Helix) DNA sequence is custom synthesized and inserted between the sequence encoding the tag protein Flag and the sequence encoding the Cas9 nuclease to form the pST1374-NLS-Flag-Helix-Cas9 vector;

The Cas9 system is derived from prokaryotic cells, and it is difficult to transfer to the nucleus in eukaryotic cells, so it cannot be guaranteed that this system will realize its shearing function in eukaryotic cells. The present invention solves this problem by adding a helical DNA sequence between the nuclear localization signal sequence and the Cas9 coding sequence to increase the expression of Cas9 in the eukaryotic nucleus, as shown in FIG. 2 . Human 293T was used in this process.

After Cas9 nuclease series vectors are linearized by AgeI, Cas9 nuclease mRNA is obtained after in vitro transcription using T7Ultra Kit, which can be directly used for gene targeting; due to the instability of mRNA, it will not exist in the organism for a long time and will not further affect the environment , so there is no biosafety issue.

3) Synthesis of chimeric RNA

The T7 promoter sequence on the chimeric RNA template is generated by PCR using a synthetic oligonucleotide as a template, and the chimeric RNA is transcribed in vitro using the T7Shortscript Kit. site;

(2) After Cas9 mRNA is translated in vivo, Cas9 nuclease is formed to combine with chimeric RNA to realize site-specific shearing. After shearing, DNA double-strand breaks are generated, and foreign cells are introduced by inducing the cell's own natural DNA repair process "non-homologous end joining". Source DNA, thereby modifying the cell's endogenous genes.

A DNA sequence with a helical structure, which enhances the nuclear transfer ability of the protein and the ability to bind to nucleic acids under the guidance of nuclear localization signals, and its gene sequence is:

ctggaacccggcgagaagccatacaaatgcccagagtgtggtaaatctttctctcagtctggtgctctgaccagacaccagcggacccaacactaga.

3. Beneficial effect

Compared with the prior art, the present invention has the advantages of:

(1) Higher accuracy. With the method of the present invention, as long as there is any base pair difference between the RNA target sequence and the genome sequence, Cas9 will not bind, thus cutting DNA cannot be achieved;

(2) Genomic multi-site targeting. Using the method of the present invention, multiple sites on the target gene can be cut at the same time to achieve the purpose of genome transformation;

(3) It is more convenient to use and lower in cost. Whether it is ZFN or TALEN, it is necessary to change the recognition sequence in front of the nuclease for different targets, and the synthesis or assembly of these recognition sequences is time-consuming, labor-intensive and expensive. In the method of the present invention, the CRISPR/Cas system can achieve specific recognition of different sites only by changing a very short RNA sequence. In the establishment of animal genetic engineering models, if ZFN or TALEN technology is used, the ZFN or TALEN plasmid must be transcribed into mRNA, which increases the cost and difficulty of the experiment. The CRISPR/Cas system only needs to transcribe the Cas nuclease once. Multiple experiments can be completed, which greatly reduces the cost;

(4) No biological safety issues. The present invention uses mRNA and RNA as raw materials for gene targeting, without any resistance gene for screening, so there is no biological safety problem;

(5) There is no species limitation by adopting the method of the present invention.

Description of drawings

Figure 1 is a schematic diagram of the process of Cas9 binding to chimeric RNA to achieve site-specific shearing resulting in DNA double-strand breaks;

Figure 2 is a fluorescent photo taken by confocal microscopy of each carrier of Cas9 nuclease.

Detailed ways

The technical solutions of the present invention will be further introduced below in conjunction with the accompanying drawings and specific embodiments.

Example 1

A eukaryotic gene targeting method without species limitation and without biological safety problems in this embodiment, the steps are:

(1) Design and construction of CRISPR/Cas9 and chimeric RNA

1) Optimize the codon encoding Cas9

Cas9 belongs to the second type of CRISPR/Cas system, which is derived from prokaryotic cells. In order to make it better expressed in eukaryotic cells, the Cas9 coding sequence was first optimized and used in eukaryotic cells without changing amino acids. Codons encoding amino acids;

2) Cas9 nuclease vector construction and Cas9 nuclease mRNA synthesis

According to the optimized sequence in step 1), custom-synthesize the DNA sequence encoding Cas9 nuclease, and insert it into the following expression vectors: pST1374-Cas9, pST1374-NLS-Flag-Cas9 (this vector contains the vector pST1374 -In addition to all the sequences of Cas9, there is a sequence NLS encoding the nucleus localization signal and a sequence encoding the tag protein Flag);

Using two primers Cas9C-NLS Cla For and Cas9C-NLS Apa Rev (see Table 1 for primer sequences), a DNA fragment was amplified by chain polymerase reaction (PCR), digested with two restriction enzymes ClaI and ApaI The amplified DNA fragment and pST1374-NLS-Flag-Cas9, insert the amplified DNA fragment into pST1374-NLS-Flag-Cas9 to construct the pST1374-NLS-Flag-Cas9-NLS vector, which contains the vector pST1374- In addition to all Cas9 sequences, there are two sequences NLS encoding the nucleus localization signal and a sequence encoding the tag protein Flag;

The sequences encoding the three nuclear localization signals NLS were amplified by PCR using the Cas9-N-3NLS For and Cas9-N-3NLS Rev primers (see Table 1 for the primer sequences) using oligonucleotides as templates (see Table 1 for the template sequences) Yes, the PCR product is digested by two restriction enzymes NheI and NotI, and then inserted into the pST1374-NLS-Flag-Cas9 vector through the same restriction site to construct pST1374-3XNLS-Flag-Cas9, the vector In addition to containing all the sequences of the vector pST1374-Cas9, there are three sequences NLS encoding the nuclear localization signal and one sequence encoding the tag protein Flag;

The helical structure (Helix) DNA sequence (see Table 2) is custom-synthesized and inserted between the sequence encoding the tag protein Flag and the sequence encoding the Cas9 nuclease to form the pST1374-NLS-Flag-Helix-Cas9 vector, which contains the vector In addition to all the sequences of pST1374-Cas9, there is a sequence NLS encoding the nuclear localization signal, a sequence encoding the tag protein Flag and a helical DNA sequence;

The Cas9 system is derived from prokaryotic cells, and it is difficult to transfer to the nucleus in eukaryotic cells, so it cannot be guaranteed that this system will realize its shearing function in eukaryotic cells. The present invention solves this problem by adding a helical DNA sequence between the nuclear localization signal sequence and the Cas9 coding sequence to increase the expression of Cas9 in the eukaryotic nucleus, as shown in FIG. 2 . Human 293T was used in this process.

In this example, a series of expression vectors containing Cas9 were also constructed. After these vectors were transfected into the cells, the localization of Cas9 in the cells could be displayed by immunostaining reaction. Before cell transfection, cells should be cultured on poly-lysine-coated coverslips, and Cas9 series plasmid DNA was transfected into 293T cells using Lipofectamine2000 transfection reagent. In immunostaining experiments, cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes, washed twice with PBS buffer, soaked in PBS plus 0.2% Triton X-100 for 5 minutes, and washed twice with PBS. Second-rate. After that, normal goat serum was used to block for 1 hour at room temperature, and then the antibody against the tag protein FLAG was added to the blocking solution, and incubated for 2 hours at room temperature. After washing with PBS, the cells were incubated with cy3-conjugated goat anti-mouse secondary antibody dissolved in PBS and Hoechst for 1 hour at room temperature. After washing with PBS, the cells were blocked with Vectashield culture medium, and then used Olympus Flueview1000 confocal microscope Take fluorescent pictures (see Figure 2). Only by adding a helical DNA sequence between the nuclear localization signal sequence and the Cas9 coding sequence can Cas9 be expressed in the eukaryotic nucleus, which further ensures its splicing function in gene targeting.

Cas9 nuclease series vectors are linearized by AgeI and transcribed in vitro with T7Ultra Kit to obtain Cas9 nuclease mRNA, which can be directly used for gene targeting; due to the instability of mRNA, it will not exist in the organism for a long time and will not cause further damage to the environment. impact, so there is no biosafety issue.

3) Synthesis of chimeric RNA

There is a T7 promoter sequence on the chimeric RNA template, which is generated by PCR using a synthetic oligonucleotide as a template (see Table 1 for the template sequence), and the chimeric RNA is transcribed in vitro using the T7Shortscript Kit, which contains crRNA and tracrRNA structure, which can be directed to bind to the site on the target DNA;

(2) After Cas9 mRNA is translated in vivo, Cas9 nuclease is formed to combine with chimeric RNA to realize site-specific shearing. After shearing, DNA double-strand breaks are generated, and foreign cells are introduced by inducing the cell's own natural DNA repair process "non-homologous end joining". Source DNA, thereby modifying endogenous genes in cells; see Figure 1.

Table 1

Italics, binding sequence; bold, T7 promoter.

Table 2

Claims (2)

1., without an eukaryotic gene shooting method for species restriction lifeless matter safety issue, the steps include:

(1) design & formulation of the chimeric RNA of CRISPR/Cas9 and crRNA and tracrRNA composition

1) codon of Optimized Coding Based Cas9

2) Cas9 nuclease vector construction and Cas9 nuclease mRNA synthesize

According to step 1) optimize after sequence, the DNA sequence dna of customization composite coding Cas9 nuclease, and it is inserted in expression vector is respectively formed: pST1374-Cas9, pST1374-NLS-Flag-Cas9;

In the middle of the sequence that helical-structure DNA sequence is inserted into code tag albumen Flag after customization synthesis and coding Cas9 nucleotide sequence, form pST1374-NLS-Flag-Helix-Cas9 carrier;

Cas9 nuclease carrier, after AgeI linearizing, obtains Cas9 nuclease mRNA, is directly used in gene targeting after utilizing T7Ultra Kit in-vitro transcription;

3) synthesis of the chimeric RNA of crRNA and tracrRNA composition

T7 promoter sequence in the chimeric RNA template of crRNA and tracrRNA composition is that the oligonucleotide synthesized is produced by chain polymerization enzyme reaction for template, utilizes T7Shortscript Kit in-vitro transcription to go out the chimeric RNA of crRNA and tracrRNA composition;

(2) the chimeric RNA that in Cas9mRNA body, after translation, formation Cas9 nuclease and crRNA and tracrRNA form combines, realize fixed point to shear, DNA double splitting of chain is produced after shearing, the DNA repair process " non-homologous end joining " natural by inducing cell self introduces foreign DNA, thus amendment cellular endogenous genomic;

Wherein, the core transfer ability that this helical-structure DNA sequence strengthens albumen under nuclear localization signal instructs and the ability be combined with nucleic acid, its gene order is:

ctggaacccggcgagaagccatacaaatgcccagagtgtggtaaatctttctctcagtctggtgctctgaccagacaccagcggacccacactaga。

2. a helical-structure DNA sequence, is characterized in that, the core transfer ability that this helical-structure DNA sequence strengthens albumen under nuclear localization signal instructs and the ability be combined with nucleic acid, and its gene order is:

ctggaacccggcgagaagccatacaaatgcccagagtgtggtaaatctttctctcagtctggtgctctgaccagacaccagcggacccacactaga。