CN110616233B - Method for efficiently knocking out primary T cell gene by CRISPR-Cas9 and application thereof - Google Patents

Method for efficiently knocking out primary T cell gene by CRISPR-Cas9 and application thereof Download PDF

Info

Publication number
CN110616233B
CN110616233B CN201810636410.3A CN201810636410A CN110616233B CN 110616233 B CN110616233 B CN 110616233B CN 201810636410 A CN201810636410 A CN 201810636410A CN 110616233 B CN110616233 B CN 110616233B
Authority
CN
China
Prior art keywords
cell
cells
gene
cas9
sgrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810636410.3A
Other languages
Chinese (zh)
Other versions
CN110616233A (en
Inventor
彭作翰
李玏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Sunisier Biopharmaceutical Co.,Ltd.
Original Assignee
Xi'an Soniser Biomedical Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xi'an Soniser Biomedical Co ltd filed Critical Xi'an Soniser Biomedical Co ltd
Priority to CN201810636410.3A priority Critical patent/CN110616233B/en
Publication of CN110616233A publication Critical patent/CN110616233A/en
Application granted granted Critical
Publication of CN110616233B publication Critical patent/CN110616233B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Abstract

The invention relates to a method for efficiently knocking out primary T cell genes by CRISPR-Cas9 and application thereof. The invention specifically relates to a method of increasing the efficiency of CRISPR-Cas9 knockout of a primary T cell gene, the method comprising delivering Cas9mRNA and a chemically modified sgRNA to a T cell. The method can be applied to the preparation of various CAR-T cells, TCR-T cells and TIL cells.

Description

Method for efficiently knocking out primary T cell gene by CRISPR-Cas9 and application thereof
Technical Field
The invention relates to the field of cell therapy, in particular to a method for efficiently knocking out primary T cell genes by CRISPR-Cas9 and application thereof.
Background
Use of gene editing T cells
(1) Universal CAR-T cell therapy
The chimeric antigen receptor T cell (CAR-T cell) therapy technology is characterized in that an artificial gene for recognizing cancer cells is transduced on human T cells in vitro, so that the human T cells have the capacity of specifically killing tumor cells. CAR-T cell therapy belongs to Adoptive Cell Transfer (ACT), which utilizes human immune cells to fight tumors, and is called a "live drug". Gene editing is a very hot area in CAR-T cell therapy, and it is because CAR-T cell therapy is a very potential anti-cancer therapy that has had great success in the treatment of a variety of leukemias. Another point is that gene editing technology allows more variability in CAR-T cell therapy. Gene editing CAR-T cells are essentially a gene therapy that operates in vitro, not requiring delivery modalities facing complex difficulties, and is more feasible. At present, the gene editing CAR-T cell is mainly applied to the treatment of universal CAR-T cells, and the specific application comprises the following points:
TCR gene knockout, avoiding GvHD, thus can be used for allografting. Graft Versus Host Disease (GVHD) is a response that occurs when specific lymphocytes in the graft recognize host antigens. The conditions for this are the inclusion of T lymphocytes in the graft and the disagreement of the graft with the host's major histocompatibility antigens. In bone marrow transplantation, GvHD is a major obstacle, causing multiple organ failure by killing cells in the host, which leads to other complications. Among the universal CAR-T cell therapies, GvHD is one of the most desirable problems to avoid, otherwise the host has serious side effects. TCR is a main gene of T lymphocyte recognition target cells, and the TCR gene is knocked out, so that the attack of allogeneic T cells on host cells can be avoided, and therefore the TCR gene of the allogeneic transplanted universal CAR-T cells needs to be knocked out to avoid GvHD. Generally only one of TCR- α or TCR- β needs to be knocked out to allow TCR protein not to be displayed on the T cell surface.
Knocking out B2M and CIITA genes, avoiding the attack of receptor T cells and reducing rejection reaction. Histocompatibility antigens vary from individual to individual, leading to attack and rejection of the graft by recipient T cells. To solve this problem, the B2M gene in CAR-T cells is usually knocked out by gene editing methods (such as ZFN, TALEN or CRISPR-Cas9), so that HLA-ABC protein cannot be displayed on the cell surface, and thus attack by recipient T cells can be avoided. There are also some researchers who knock out the CIITA gene together to reduce the expression of two types of histocompatibility antigens.
Knocking out the genes of the immune check points such as PD-1, CTLA-4, LAG-3 and the like, and improving the curative effect of the universal CAR-T. Immune checkpoints such as PD-1, CTLA-4, etc. are tumor immune targets that have proven to be very effective in recent years by blocking tumor infiltrating T cells (TIL cells) with these immune checkpoint antibodies to activate TIL cells that are already "exhausted". Clinical studies have shown that direct in vitro knockout of the PD-1 gene of TIL cells can activate TIL cells and effectively alleviate tumor progression, and studies have shown that PD-1 knockout can enhance the in vivo and in vitro anti-tumor efficacy of CAR-T cells.
(2) The field of AIDS
Gene editing T cells were earlier studied in the aids treatment field, and attempts to edit T cell genomic DNA have been made since the ZFN gene editing tool. The HIV infects CD4T cells very specifically, and theoretically, the potential for treating AIDS is provided by editing CD4T cells. The concrete application is as follows:
CCR-5 gene knockout, preventing HIV virus from infecting CD4T cells. CCR-5 is a receptor protein expressed on the surface of T cells, and the well-known Brown in Berlin patients is the bone marrow deficient in transplanting CCR-5 gene to completely cure AIDS. The CCR-5 knockout in T cells or stem cells is one direction of the very frontier aids treatment.
(3) TCR-T field
TCR is an abbreviation for T cell receptor (T cell receptor). On normal T cells, these receptors specifically recognize targets on the surface or within cancer cells. In TCR-T therapy, developers isolate and engineer endogenous TCRs, introduce them into entirely new T cells, and infuse them back into the body. TCR-T therapy has shown therapeutic potential in some solid tumors, and gene editing has been mainly applied to TCR-T cell therapy:
simultaneous knockout of TCR double chains avoids mismatch between exogenous TCR and endogenous TCR. Exogenous TCR easily forms heterodimer with endogenous TCR protein in the process of TCR-T cell preparation, and the heterodimer cannot identify target tumor antigens and even can identify normal cell antigens to cause serious side effects. Unlike the common CAR-T, which only needs to knock out one TCR chain (TCR-alpha or TCR-beta), TCR-T cells need to knock out the TCR double chains at the same time to achieve good therapeutic effect, because endogenous TCR-alpha or TCR-beta can be combined with exogenous TCR-beta or TCR-alpha.
Knocking out the genes of the immune check points such as PD-1, CTLA-4, LAG-3 and the like, and improving the curative effect of TCR-T cell treatment. The principle is the same as for gene editing generic CAR-T.
Cellular gene knockout method
(a)ZFN
Zinc Finger Nucleases (ZFNs), also known as Zinc Finger Protein Nucleases (ZFPNs), are a class of artificially synthesized restriction endonucleases, which are fused from a Zinc finger DNA-binding domain and a DNA-cleavage domain of a restriction endonuclease. Researchers can engineer the zinc finger DNA binding domain of a ZFN to target different DNA sequences, such that the ZFN can bind to a sequence of interest in a complex genome and be specifically cleaved by the DNA cleavage domain. In addition, by combining zinc finger nuclease technology with intracellular DNA repair mechanisms, researchers can freely edit genomes in vivo. Currently, ZFN technology has been widely applied to mutations of targeted genes in a large number of species of plants, drosophila, zebrafish, frogs, rats/mice, and cattle, etc., and new species with modified genetic backgrounds can be generated by artificially modifying genomic information. The technology also has very important value in the medical field, has potential significance for gene therapy of diseases, and has very wide application prospect.
(2)TALEN
In recent years, another simple DNA recognition module has been discovered, namely the DNA recognition module in TALE nuclease. TALE protein is a natural protein derived from plant pathogenic bacterium, Xanthomonas flavus, and also contains DNA binding structural domain. The DNA binding domain in the TALE protein is composed of a repetitive domain consisting of a series of 33-35 amino acids, wherein each domain can recognize one base. The DNA binding specificity of TALE nucleases is largely determined by two highly variable amino acids, which scientists refer to as repeat-variable di-amino acid Residue Sites (RVDs). Like the zinc finger domain, such TALE repeat modules can also be concatenated to recognize a long string of DNA sequences. However, cloning of such a large repeat coding sequence of the TALE protein DNA sequence recognition domain is also a not trivial challenge. In order to solve the problem, scientists have devised a plurality of methods, and there are several schemes for researchers to rapidly assemble the recognition structural domain of the TALE protein DNA sequence with any collocation. There are a number of large-scale, systematic studies using various assembly strategies that show that TALE repeat recognition modules can be assembled together to recognize any DNA sequence. Since the TALEN technology was formally invented in 2010, specific cleavage activity of TALENs was verified by various research groups worldwide using a plurality of animal and plant systems such as in vitro cultured cells, yeast, arabidopsis thaliana, rice, drosophila, zebrafish and the like.
(3)CRISPR-Cas9
CRISPR (Clusters of regulated interleaved Short Palindromic repeats) technology was commonly discovered in 2012 by scientists at the institute of technology, Massachusetts and Burkeley university, California, as a double-stranded DNA endonuclease tool mediated by RNA sequences. The target double-stranded DNA targeted recognition chip is composed of two parts, wherein one part is sgRNA with the length of about 100bp and used for targeted recognition of target double-stranded DNA, the other part is Cas9 protein with the length of 1369 amino acids, the sgRNA can be combined with the sgRNA, the DNase activity is realized, the artificially designed sgRNA and the Cas9 protein can be specifically cut after forming a complex, when the cut causes mismatch repair, gene frame shift is caused to achieve the purpose of knockout, and when a repair DNA sequence is added, the target editing can be performed. Since the CRISPR-Cas9 technology is available, the application of the CRISPR-Cas9 technology is available in a plurality of fields.
The delivery vector for CRISPR-Cas9 gene knockout comprises:
1. plasmid vector
Plasmid vectors usually express the Cas9 gene and sgRNA in two or one plasmid vector, respectively, and the plasmids are transferred into T cells by liposome or electroporation methods. The advantages are that: the operation is simple, and the material cost is low. The disadvantages are that: firstly, DNA toxicity is highly damaging to primary T cells, which is detrimental to later culture amplification, and secondly, plasmid delivery, which allows for relatively long-term expression of Cas9 protein and sgrnas, increases the probability of off-target.
2. Lentiviral vectors
The lentiviral vector also puts the Cas9 gene and the sgRNA into two or one lentiviral vector respectively, and delivers the CRISPR-Cas9 component into T cells through lentiviral packaging and infection. The advantages are that: has little damage to cells and low requirements on instruments. The disadvantages are that: long term expression of Cas9 protein and sgrnas resulted in more off-target probabilities.
3.mRNA
mRNA delivery is by in vitro transcription of DNA encoded by Cas9 protein into mRNA, as do sgrnas. Cas9mRNA and sgRNA were transferred simultaneously into T cells using electroporation. The advantages are that: off-target rates are relatively low (because both Cas9mRNA and sgRNA are transiently expressed).
4.RNP
The RNP approach is to form an RNP complex with Cas9 protein and sgRNA in vitro, and then send RNP into T cells by means of electroporation. The advantages are that: knockout efficiency is high, off-target rate is low (Cas9 protein and sgRNA will be degraded by T cells all within 24 hours). The disadvantages are that: cas9 protein, absolutely endotoxin free, is not readily available and has relatively high requirements for both reagents and instrumentation.
5.AAV
AAV delivery is a method in which a Cas9 gene and sgRNA are separately or simultaneously loaded into an adeno-associated virus vector (AAV), and then a T cell is infected in vitro to knock out a gene, and AAV delivery is the most common method in vivo target gene knock-out. The advantages of knocking out T cell genes in vitro are as follows: AAV is safer than lentivirus, AAV is not integrated, and the off-target rate is lower theoretically. The disadvantages are that: in vitro infection efficiency is low, the knockout effect is not good as that of other methods, and in addition, the virus packaging and purification are complicated relative to lentivirus.
The method for improving CRISPR-Cas9 gene knockout efficiency in primary T cells comprises the following steps:
selection of sgRNAs
In general, when sgrnas for target genes are designed, professional websites such as crishpr. mit. com, http:// ZiFiT. paratners. org/ZiFiT/etc. are used. The overall principle is to try to design the 5 'end of a gene CDS, but the specific knockout effect is not necessarily higher closer to the 5' end, and usually more than one sgRNA needs to be designed, and the best sgRNA is selected.
2. Multiple electroporation method
Since rnases inside T cells are very sensitive to foreign sgrnas, the conventional mRNA electroporation method introduces Cas9mRNA and sgrnas into T cells, where the sgrnas are degraded by nuclease within hours, and Cas9mRNA is not translated into protein, so that the method has low efficiency (less than 10%) in knocking out target genes of T cells. The method can lead the knockout efficiency to reach 90% by electroporating Cas9mRNA and sgRNA to be transduced by PZhao Yang soldier at the university of Pennsylvania respectively on the first day and the second day, and when the sgRNA is transduced on the second day, Cas9 protein is already in T cells, but the T cells are inevitably subjected to poor state by two times of electric shock to influence the amplification of the T cells.
Disclosure of Invention
In order to solve the above technical problems, the present invention first provides:
in a first aspect of the invention, a method of increasing the efficiency of CRISPR-Cas9 knockout of a primary T cell gene is provided, the method comprising delivering Cas9mRNA and a chemically modified sgRNA to a T cell.
In a second aspect of the invention, there is provided the method of the first aspect, wherein the chemically modified sgRNA has (i) a methylation modification at 1-10 bases head to tail; (ii) a phosphorylation modification; and/or (iii) other modifications capable of stabilizing the sgRNA.
In a third aspect of the present invention, there is provided the method of the second aspect, wherein the methylation modification is a 2 '-O-methylation modification, and the phosphorylation modification is a 3' phosphorothioate modification.
In a fourth aspect of the invention, there is provided the method of the first aspect, wherein the Cas9 type comprises: SpCas9, SaCas9, SpCas9-HF, eSPcas9, xCas9 and cpf1, preferably SpCas9, and the amino acid sequence is shown as SEQ ID NO 1.
In a fifth aspect of the invention, there is provided the method of the first aspect, wherein the Cas9mRNA is obtained by: after cloning the Cas9 gene into a plasmid vector, a Cas9 DNA fragment with a T7 or SP6 promoter at the 5' end is amplified by PCR and is transcribed into Cas9mRNA in vitro.
In a sixth aspect of the invention, there is provided the method of any one of the first to fifth aspects, wherein the Cas9mRNA contains a nuclear entry signal, preferably SV40 NLS and nucleoplasmin NLS, with the amino acid sequences of SEQ ID NO:2 and SEQ ID NO:3, respectively.
In a seventh aspect of the invention, there is provided the method of any one of the first to fifth aspects, wherein the sgRNA targeting the TRAC gene comprises the DNA sequence of SEQ ID No. 4 and the sgRNA targeting the B2M gene comprises the DNA sequence of SEQ ID No. 5.
In an eighth aspect of the invention, there is provided the method of any one of the first to fifth aspects, further comprising activating the T cell, and introducing the Cas9mRNA and the chemically modified sgRNA into the activated T cell simultaneously using electroporation 2-5 days after T cell activation.
In a ninth aspect of the invention, there is provided the method of the eighth aspect, wherein the mass ratio of Cas9mRNA and chemically modified sgRNA at the time of electrical transduction is 1:1 to 10: 1.
In a tenth aspect of the invention, there is provided the method of the first aspect, wherein the Cas9mRNA may be replaced with Cas9 protein or a plasmid expressing Cas 9.
In an eleventh aspect of the invention, there is provided a method of knock-in, comprising applying a repair template after knock-out using the method of any one of the first to tenth aspects, the repair template preferably comprising adeno-associated virus, non-integrating lentivirus, single-stranded DNA, double-stranded DNA, plasmid DNA.
In a twelfth aspect of the invention, there is provided a cell prepared according to the method of any one of the first to tenth aspects, the cell comprising a CAR-T cell, a TCR-T cell and a TIL cell.
In a thirteenth aspect of the invention, there is provided a cell of the twelfth aspect, wherein the TRAC, TRBC1, or TRBC2 gene is single knocked out according to the method of any one of the first to tenth aspects to produce a universal CAR-T cell; or simultaneously knocking out TRAC and TRBC (TRBC1 or TRBC2) genes according to the method of any one of the first to tenth aspects to produce a universal TCR-T cell.
In a fourteenth aspect of the invention, there is provided a cell of the twelfth aspect, wherein the genes CIITA, PD-1, LAG-3, TIM-3, TIGIT, CD96 are knocked out according to the method of any one of the first to tenth aspects for use in enhancing the therapeutic efficacy of CAR-T, TCR-T and TIL cells.
In a fifteenth aspect of the invention, there is provided a use of the cell of any one of the twelfth to fourteenth aspects in the preparation of a medicament for the treatment of leukemia, solid tumors, aids, type I diabetes or autoimmune diseases.
Drawings
Fig. 1 shows that the modified sgRNA mediates the process by which the gene of interest is recognized and edited. sgRNA and Cas9mRNA enter T lymphocyte cytoplasm by electroporation or other means. 2. After about 8 hours, Cas9mRNA was translated into Cas9 protein at the ribosome. Cas9 protein and sgRNA form an RNA protein complex in the cytosol. 4. The RNA protein complex is guided into the nucleus by the nuclear entry signal. The RNA protein complex recognizes the target DNA and cleaves it. 6. The common sgrnas degrade soon after entering T lymphocytes. 7. The modified sgRNA can exist relatively stably after entering T lymphocytes.
FIG. 2 is a graph of the effect of modified and unmodified ribonucleotides.
Fig. 3 shows flow detection after T cell TCR gene is knocked out by CRISPR-Cas 9. T cells were tested for TCR protein expression 7 days after electroporation of SpCas 9mRNA and corresponding sgRNA.
Fig. 4 shows flow detection after T cell B2M gene is knocked out by CRISPR-Cas 9. T cells detect the expression of HLA-ABC protein 7 days after electroporation of SpCas 9mRNA and corresponding sgRNA, and the expression of HLA-ABC protein can be used for indication after knocking out the B2M gene because the B2M protein and the HLA-ABC protein form heterodimers.
FIG. 5 shows the monitoring of the cell survival status after electroporation of the different components.
Detailed Description
Definition of
"Universal CAR-T cell therapy" refers to the single production of CAR-T cells for tens or even hundreds of patients, without the need for custom time, and is "on the shelf" cargo.
"ZFNs", Zinc finger nucleases (Zinc-finger nucleases), consist of one DNA recognition domain and one non-specific endonuclease. The DNA recognition domain is composed of a series of Cys2-His2 zinc finger proteins (zinc-fingers) which are connected in series (generally 3-4), and each zinc finger protein recognizes and is combined with a specific triplet base. ZFNs are an earlier gene editing method.
"TALEN" refers to Transcription activator-like effector nucleases (Transcription activator-like effector nucleases), which are a new gene editing tool based on the following principle: TALEN elements are targeted to specific DNA sites through a DNA recognition module and combined, then the specific sites are cut under the action of FokI nuclease, and the insertion (or inversion), deletion and gene fusion of specific sequences are completed by means of the inherent Homologous Directed Repair (HDR) or non-homologous end joining pathway (NHEJ) repair process in cells.
"CRISPR" is a bacterial immune system that has been engineered by scientists as the hottest gene editing tool in this year.
"sgRNA", a small guide rna (small guide rna), is used in CRISPR-Cas9 technology to anchor a targeting DNA.
"RNP" refers to Cas9 crRNA tracrRNA Ribonucleoprotein (RNP) complex.
By "immune checkpoint genes" is meant inhibitory receptors and inhibitory signaling pathways that normally inhibit T cell function, while possibly being utilized by the tumor in tumor tissue to form an immune escape.
"TCR-T" refers to T cell receptor therapy.
The TIL is tumor infiltrating lymphocyte, is a novel anti-tumor effector cell and has the advantages of high efficiency, specificity, small side effect and the like.
In one aspect, the invention relates to a method of increasing the efficiency of CRISPR-Cas9 knockout of a primary T cell gene, the method comprising delivering Cas9mRNA and a chemically modified sgRNA to a T cell.
In some embodiments, sgRNA design follows the principle that the PAM sequence is NGG, close to the CDS region, with software design of http:// crispr. mit. edu, http:// ZiFiT. partners. org/ZiFiT/etc. In some embodiments, a chemically modified sgRNA has (i) a methylation modification at 1-10 bases from head to tail (such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases); (ii) methylation modification and phosphorylation modification; (iii) other modifications that are capable of stabilizing sgrnas. Synthetic modified sgrnas are provided by professional suppliers.
In some embodiments, after cloning the Cas9 gene into a plasmid vector, a Cas9 DNA fragment with a T7 or SP6 promoter at the 5' end was PCR amplified and transcribed in vitro to Cas9mRNA, wherein the Cas9 gene type is selected from the group consisting of: SpCas9, SaCas9, SpCas9-HF, eSpCas9, xCas9, and cpf 1.
In some embodiments, Cas9mRNA contains a nuclear entry signal, preferably SV40 NLS and nucleoplasmin NLS.
In some embodiments, the method further comprises isolating PBMCs from human blood, optionally with or without isolation of purified T lymphocytes.
In some embodiments, the method further comprises activating the T cell, which can be performed by: coating with anti-CD 3 antibody alone, coating with anti-CD 3 antibody/anti-CD 28 antibody, directly adding anti-CD 3 antibody alone, directly adding anti-CD 3 antibody/anti-CD 28 antibody, and activating with anti-CD 3 antibody/anti-CD 28 antibody magnetic beads. The activation time is2 to 3 days, and if the activation is carried out by using anti-CD 3 antibody/anti-CD 28 antibody magnetic beads, the magnetic beads need to be removed.
In some embodiments, the Cas9mRNA and the chemically modified sgRNA are introduced into the activated T cells simultaneously using electroporation at 2-5 days after T cell activation.
In some embodiments, wherein the mass ratio of SpCas 9mRNA and chemically modified sgRNA at the time of electrotransformation is 1:1 to 10:1 (such as 5: 1).
In some embodimentsAnd culturing and amplifying the obtained cells. The culture adopts 1640 culture medium + 10% serum or other serum-free culture medium specially used for T cell culture, such as X-VIVO-15. Culturing in culture bottle, culture dish or culture bag, and changing the culture solution every 1 day to ensure that the density of T cells is 1 × 106About one per ml.
In another aspect, the invention relates to a method of knock-in comprising knock-out using the above method followed by the application of a repair template, which may include adeno-associated virus, non-integrating lentivirus, single-stranded DNA, double-stranded DNA, plasmid DNA.
In another aspect, the methods of the invention can be applied to T cell therapy, including the preparation of CAR-T cells, TCR-T cells, TIL cells, and the like. The application of the CAR-T cell therapy mainly comprises the knocking-out of TRAC and B2M genes to prepare universal CAR-T cells, and the knocking-out of PD-1 and other immune check points to improve the curative effect of the CAR-T cells. Simultaneous deletion of TCR- α and TCR- β in TCR-T cells prevents endogenous and exogenous TCR mismatching. Mainly knocking out PD-1 and other immune check points in TIL cells to improve the curative effect of CAR-T cells. The cell therapy method is used for treating leukemia, various solid tumors, AIDS, type I diabetes and some autoimmune diseases.
The invention has the beneficial technical effects that:
1. knockout efficiency is higher
The modified sgRNA is more stable in T cells until SpCas 9mRNA is translated into protein and forms a complex with the modified sgRNA to effectively edit a target gene. While unmodified sgrnas are mostly degraded by nucleases in T cells before translation of Cas9mRNA and therefore cannot form complexes with Cas9 protein. Common sgRNA and SpCas 9mRNA can perform efficient knock-out in other cell lines and cannot be applied to T cells, because primary T has a relatively strong molecular immune mechanism.
2. Has no cytotoxicity
Both Cas9mRNA and the modified sgRNA are theoretically not cytotoxic, as demonstrated by the experimental results of the present invention.
3. The miss ratio is lower
Cas9mRNA is usually degraded by cells after only a few days of protein expression, while modified sgrnas are also degraded by cells within one day, so editing of the gene of interest and potential off-target DNA is transient, theoretically with lower off-target rates.
4. Lower immunogenicity
At present, RNP is the most used delivery mode in T cell gene knock-out, but the mode directly introduces excessive Cas9 protein purified from bacteria, is easy to be presented by MHC protein on the surface of T cells, and can cause certain immune response if being input into a body. While delivery of Cas9mRNA and sgrnas to T cells did not produce excessive Cas9 protein, while the immunogenicity of the RNA was relatively low.
Certain specific embodiments of the present invention are described below by way of examples, but these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
Example 1: SpCas 9mRNA in vitro transcription
a. The vector used for in vitro transcription comprises SpCas9 gene, the amino acid sequence of which is SEQ ID NO. 1. The N end is SV40 NLS peptide segment, and the amino acid sequence is SEQ ID NO 2. The C end is nucleoplasmin NLS peptide segment, and the amino acid sequence is SEQ ID NO: 3:
b. a pair of primers is designed to amplify an SV40-NLS-SpCas 9-nucleoplasmin NLS DNA fragment, and the 5 end of the amplified DNA fragment contains a T7 promoter sequence, and the primer sequence is shown as follows:
upstream primer TAATACGACTCACTATAGGGAGAATGGACTATAAGGACCACGAC
Downstream primer GCGAGCTCTAGGAATTCTTACTTTTTCTTTTTTGCCTG
And c, amplifying the DNA fragment by PCR, wherein the PCR system and the amplification program are as follows:
Figure BDA0001701672270000111
recovery of PCR products. According to the kit instructions, the measured concentrations and 260/280 ratios of the recovered products were:
concentration of 280ng/ml
260/280 1.90
In vitro transcription of spcas9 mRNA. The following ingredients (20 μ l system) were added in order:
Figure BDA0001701672270000112
Figure BDA0001701672270000121
after reacting for 2 hours in a water bath kettle at 37 ℃, adding 1 mu l of TURBO DNase, sealing the opening, tapping the bottom of the centrifuge tube for 4-5 times, and uniformly mixing the system. After sealing with a sealing film, the mixture was digested in a water bath at 37 ℃ for 20 minutes in the same manner.
Spcas9 mRNA tailing. The following ingredients (100 μ l system) were added in order:
in vitro transcription 20. mu.l system of SpCas 9mRNA 20μl
RNase-free H2O 36μl
5 xE-PAP buffer 20μl
25mM MnCl2 10μl
10mM ATP 10μl
E-PAP enzyme 4μl
The reaction was carried out in a water bath at 37 ℃ for 45 minutes.
g. SpCas 9mRNA was purified according to the kit instructions and the resulting concentration of SpCas 9mRNA was determined as: 540 ng/ml. And (5) freezing and storing at minus 80 ℃ after subpackaging.
Example 2: sgRNA design and Synthesis
Two T cell surface protein genes are selected as knockout objects, namely TRAC and B2M genes. Designing sgRNAs by using a website http:// ZiFiT. paratners. org/ZiFiT/the sequence of the designed sgRNAs is as follows:
the sgRNA sequence for TRAC gene is shown as SEQ ID NO. 4, and the sgRNA sequence for B2M gene is shown as SEQ ID NO. 5.
In vitro transcription of common sgrnas:
a. firstly, the sgRNA is cloned into a plasmid vector pGRNA, then sgRNA template PCR and product recovery are carried out, 20 mu l of PCR amplification is carried out, and the system and the reaction conditions are as follows:
Figure BDA0001701672270000122
Figure BDA0001701672270000131
wherein the upstream and downstream primers are respectively:
Figure BDA0001701672270000132
and b, recovering PCR products. According to the kit instructions, the measured concentrations and 260/280 ratios of the recovered products were:
sample (I) Concentration of 260/280
sgRNA (for TRAC gene) T7 transcription template 110ng/μl 1.85
sgRNA (for B2M gene) T7 transcription template 90ng/μl 1.92
c. In vitro transcription of sgrnas was performed according to the in vitro transcription kit instructions, adding the following components in order (20 μ l system):
T710X reaction buffer 2μl
T7 ATP solution (75mM) 2μl
T7 CTP solution (75mM) 2μl
T7 GTP solution (75mM) 2μl
T7 UTP solution (75mM) 2μl
PCR recovery of products 8μl
T7 Enzyme Mix 2μl
d.37 ℃ water bath reaction for 4 hours, adding 1 mul of TURBO DNase, sealing the opening, tapping the bottom of the centrifuge tube for 4-5 times, and mixing the system uniformly. Sealing with sealing film, and digesting in water bath at 37 deg.C for 15 min.
e. sgRNA was purified according to the kit instructions, and the final sgRNA concentrations were as follows:
sgRNA (for TRAC gene) 1050ng/μl
sgRNA (for B2M gene) 990ng/μl
Chemical synthesis of modified sgRNA:
the effect of modified and unmodified ribonucleotides is shown in fig. 2 by simultaneously carrying out 2 '-O-methylation and 3' -phosphorothioate modification on three bases at the 5 'end and the 3' end of the two sgRNAs.
The synthesized sgRNA was supplied from synthgo, usa, and 3nM of dry powder was obtained in total, and prepared into 20 μ l of a solution at a concentration of 1 μ g/μ l by adding a TE buffer (pH 8.0), and frozen in a minus 20-degree freezer.
Example 3: PBMC extraction
Healthy volunteers were recruited (information was not revealed easily) without symptoms of cold fever. Blood was drawn 100ml from the median elbow vein of a human by medical professionals into a BD anticoagulation tube. After blood collection, the blood was mixed with an equal amount of PBS buffer (containing 2% fetal bovine serum). The PBMC separation tube Sepmate-50 is taken, 15ml of Ficoll buffer solution is carefully added, and the mixture of blood PBS is added, and about 30ml is carefully added into each tube. After centrifugation for 10 minutes at 1200g, the supernatant was quickly poured into a new 50ml tube, centrifuged for 8 minutes at 200g, discarded, added with 10ml of PBS buffer to resuspend the pellet, discarded, added with 20ml of PBS buffer to resuspend, and centrifuged, discarded, and then resuspended in all pellets in 10ml of PBS buffer. The resuspended cells were counted, 10. mu.l of the suspension was added to 10. mu.l of 0.1% trypan blue and mixed, and the cell count and viability were counted on the machine, and the results are shown in Table 1.
TABLE 1
PBMC cell density 4.99×106Per ml
Rate of cell viability 91％
Example 4: t cell activation
After centrifugation at 200g for 5 minutes, 4ml of PBMC cells from the previous step were removed from the supernatant and resuspended in 12ml of X-VIVO-15 medium. After anti-CD 3/anti-CD 28 magnetic beads (Life Technology) were resuspended in PBS buffer (containing 2mM EDTA and 1% fetal bovine serum), the magnetic pole was added and the supernatant carefully discarded after 2 minutes of standing. The above process was repeated 4 times. Washing the magnetic beads, and mixing the magnetic beads with the mixture to obtain a mixture of 1.2X 107Adding the magnetic beads into PBMC cells, uniformly mixing, and placing into a 37-degree incubator for 3 days. The beads were removed after 3 days and the T cells were first resuspended multiple times with a pipette. And (3) placing the cell suspension in a magnetic pole, standing for two minutes, and then removing the magnetic beads on the tube wall. Recounting and the counting result is shown in table 2.
Figure BDA0001701672270000141
Figure BDA0001701672270000151
Example 5: electroporation transduction of Cas9mRNA and sgRNA to activated primary T cells
After 3 days of activation, 11ml of cell volume remained, and 1.74ml of each cell suspension was centrifuged in three centrifuge tubes at 200g for 5 minutes. After centrifugation, the medium was completely removed and resuspended separately in Lonza electroporation buffer,then adding Cas9mRNA 5 mug + common sgRNA 1 mug, Cas9mRNA 5 mug and Cas9mRNA 5 mug + modified sgRNA 1ug to the T cell suspension respectively, adding the mixture into an electric rotating cup after mixing evenly, shocking the electric rotating cup by an E-0115 program of a Lonza 4D electroporator respectively, placing the electric rotating cup in a 37-degree incubator for 5 minutes, adding the electric rotating cup into 3ml of preheated cell culture medium (X-VIVO-15+10ng/ml rIL-2) respectively, wherein the single-rotating SpCas 9mRNA 5 mug group carries out electroporation transduction on 1 mug common sgRNA after 8 hours. Continuing the culture to maintain the growth density of each T cell at 1X 106The liquid is changed every other day for about one/ml.
Example 6: gene knock-out efficiency detection
After electroporation, the cells were cultured for 4 days, 2X 10 cells were collected5The flow cytometry analysis of the corresponding cells comprises the following specific steps: adding corresponding cells into a 1.5ml centrifuge tube, washing for 2 times by PBS + 1% FBS buffer solution, completely discarding the supernatant, adding 100ul of buffer solution to resuspend the cells, adding 5ul of PE-anti-human-TCR or APC-anti-human HLA-ABC flow type antibody, uniformly mixing, standing for 15 minutes at room temperature in a dark place, adding PBS buffer solution to wash for 2 times, and then loading on a machine to detect PE and APC channels respectively, wherein the results are shown in FIG. 3 and FIG. 4. From fig. 3 and fig. 4, we can see that the target gene can hardly be knocked out by one-time electric transformation of unmodified sgRNA and SpCas 9mRNA, and we speculate that when SpCas 9mRNA is translated into protein in T cells, the transduced sgRNA is already degraded by intracellular endonuclease. Aiming at the possibility, after SpCas 9mRNA and unmodified sgRNA are respectively subjected to electric transformation for two times at 0 and 8 hours, the knockout efficiencies of TRAC and B2M genes respectively reach about 79% and 83%, and the method can remarkably improve the T cell gene knockout efficiency of CRISPR-Cas 9. According to the characteristic that sgrnas are easy to degrade, methylation and phosphorothioate modification are added to the sgrnas to enable the sgrnas to be more stably present in a T cell, and if the sgrnas are co-transferred into the T cell by SpCas9 and the modified sgrnas, the knockout efficiency is greatly improved compared with that of unmodified sgrnas, and fig. 3 and 4 show that the knockout efficiency reaches about 83% and 84%.
Example 7 cytotoxicity assay
10 mu l of T cells corresponding to 2, 4, 6 and 8 days after electroporation are respectively taken, 10 mu l of 0.1% trypan blue is respectively added and mixed, and the cell survival rate is calculated on the machine, and as a result, as shown in figure 5, the cell survival rate caused by two times of electrical transduction is only about 60%, the injury of SpCas9 and modified sgRNA electrical transduction to cells is relatively low, and the survival rate is not much different from that of SpCas 9mRNA and common sgRNA after one time of electrical transduction and can reach more than 90%. The results show that the method for electrically transferring SpCas9 and common sgRNA twice respectively can improve the gene knockout efficiency of T cells, but brings great harm to the cells and is not beneficial to subsequent amplification culture, and the SpCas9 and the modified sgRNA electric transfer method adopted by the patent can improve the gene knockout efficiency on one hand, cannot cause reduction of cell viability on the other hand, and are beneficial to preparing cell therapeutic drugs subjected to gene editing, such as CAR-T, TCR-T and TIL cells.
Figure RE-IDA0001846925670000011
Figure RE-IDA0001846925670000021
Figure RE-IDA0001846925670000031
Figure RE-IDA0001846925670000041
Figure RE-IDA0001846925670000051

Claims (15)

1. A method for improving the efficiency of CRISPR-Cas9 in knocking out a primary T cell gene, the method comprising delivering Cas9mRNA and a chemically modified sgRNA to a T cell, wherein the sgRNA targeting a TRAC gene is shown as the DNA sequence of SEQ ID NO. 4, and the sgRNA targeting a B2M gene is shown as the DNA sequence of SEQ ID NO. 5, wherein three bases at each of the 5 'and 3' ends of the chemically modified sgRNA are simultaneously subjected to 2 '-O-methylation and 3' thiophosphorylation modification.
2. The method of claim 1, wherein the Cas9 types include: SpCas9, SaCas9, SpCas9-HF, eSpCas9, xCas9, and cpf 1.
3. The method of claim 2, wherein the Cas9 type is SpCas 9.
4. The method of claim 3, wherein the amino acid sequence of SpCas9 is set forth in SEQ ID No. 1.
5. The method of claim 1, wherein the Cas9mRNA is obtained by: after cloning the Cas9 gene into a plasmid vector, a Cas9 DNA fragment with a T7 or SP6 promoter at the 5' end is amplified by PCR and is transcribed into Cas9mRNA in vitro.
6. The method of any one of claims 1-5, wherein the Cas9mRNA contains a nuclear entry signal.
7. The method of claim 6, wherein the nuclear entry signal comprises SV40 NLS and nucleoplasmin NLS, the amino acid sequences of which are SEQ ID NO 2 and SEQ ID NO 3, respectively.
8. The method of any one of claims 1-5, further comprising activating the T cells, and introducing the Cas9mRNA and chemically modified sgRNA into the activated T cells simultaneously using electroporation 2-5 days after T cell activation.
9. The method of claim 8, wherein the mass ratio of Cas9mRNA and chemically modified sgRNA at the time of electrical transduction is 1:1 to 10: 1.
10. The method of claim 1, wherein the Cas9mRNA can be replaced with a Cas9 protein or a plasmid expressing Cas 9.
11. A method of gene knock-in comprising the use of a repair template following knock-out using a method according to any one of claims 1 to 10.
12. The method of claim 11, wherein the repair template comprises adeno-associated virus, non-integrating lentivirus, single-stranded DNA, double-stranded DNA, or plasmid DNA.
13. A cell prepared according to the method of any one of claims 1-10, comprising a CAR-T cell, a TCR-T cell, and a TIL cell.
14. Use of a cell according to claim 13 in the manufacture of a medicament for the treatment of leukemia, solid tumors, type I diabetes or autoimmune diseases.
15. The use of claim 14, wherein the autoimmune disease is aids.
CN201810636410.3A 2018-06-20 2018-06-20 Method for efficiently knocking out primary T cell gene by CRISPR-Cas9 and application thereof Active CN110616233B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810636410.3A CN110616233B (en) 2018-06-20 2018-06-20 Method for efficiently knocking out primary T cell gene by CRISPR-Cas9 and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810636410.3A CN110616233B (en) 2018-06-20 2018-06-20 Method for efficiently knocking out primary T cell gene by CRISPR-Cas9 and application thereof

Publications (2)

Publication Number Publication Date
CN110616233A CN110616233A (en) 2019-12-27
CN110616233B true CN110616233B (en) 2022-02-22

Family

ID=68920947

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810636410.3A Active CN110616233B (en) 2018-06-20 2018-06-20 Method for efficiently knocking out primary T cell gene by CRISPR-Cas9 and application thereof

Country Status (1)

Country Link
CN (1) CN110616233B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112048480A (en) * 2020-09-09 2020-12-08 广东昭泰体内生物医药科技有限公司 Method for preparing NK (natural killer) sample cells based on electrotransformation
CN116555340A (en) * 2023-04-11 2023-08-08 浙江省血液中心 Efficient gene editing method for HLA-I molecules and reagent thereof

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103233028A (en) * 2013-01-25 2013-08-07 南京徇齐生物技术有限公司 Specie limitation-free eucaryote gene targeting method having no bio-safety influence and helical-structure DNA sequence
CN104651399A (en) * 2014-12-31 2015-05-27 广西大学 Method for realizing gene knockout in porcine embryonic cells by using CRISPR/Cas system
CN104894068A (en) * 2015-05-04 2015-09-09 南京凯地生物科技有限公司 Method for preparing CAR-T cell by CRISPR/Cas9
CN105899658A (en) * 2013-12-12 2016-08-24 布罗德研究所有限公司 Delivery, use and therapeutic applications of CRISPR-CAS systems and compositions for HBV and viral diseases and disorders
CN106636212A (en) * 2016-11-15 2017-05-10 西北农林科技大学 Method for producing GDF9 (Growth/Differentiation Factor 9) gene edited goats by utilizing CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 (CRISPR associated protein 9) system
CN106995821A (en) * 2016-01-26 2017-08-01 深圳市儿童医院 Jurkat-KI-R5 cell lines and its construction method and application
CN107630006A (en) * 2017-09-30 2018-01-26 山东兴瑞生物科技有限公司 It is a kind of to prepare TCR and the method for the T cell of the dual-gene knockouts of HLA
CN107787367A (en) * 2015-04-06 2018-03-09 里兰斯坦福初级大学理事会 Guiding RNA for the chemical modification of the gene regulation of CRISPR/CAS mediations

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103233028A (en) * 2013-01-25 2013-08-07 南京徇齐生物技术有限公司 Specie limitation-free eucaryote gene targeting method having no bio-safety influence and helical-structure DNA sequence
CN105899658A (en) * 2013-12-12 2016-08-24 布罗德研究所有限公司 Delivery, use and therapeutic applications of CRISPR-CAS systems and compositions for HBV and viral diseases and disorders
CN104651399A (en) * 2014-12-31 2015-05-27 广西大学 Method for realizing gene knockout in porcine embryonic cells by using CRISPR/Cas system
CN107787367A (en) * 2015-04-06 2018-03-09 里兰斯坦福初级大学理事会 Guiding RNA for the chemical modification of the gene regulation of CRISPR/CAS mediations
CN104894068A (en) * 2015-05-04 2015-09-09 南京凯地生物科技有限公司 Method for preparing CAR-T cell by CRISPR/Cas9
CN106995821A (en) * 2016-01-26 2017-08-01 深圳市儿童医院 Jurkat-KI-R5 cell lines and its construction method and application
CN106636212A (en) * 2016-11-15 2017-05-10 西北农林科技大学 Method for producing GDF9 (Growth/Differentiation Factor 9) gene edited goats by utilizing CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 (CRISPR associated protein 9) system
CN107630006A (en) * 2017-09-30 2018-01-26 山东兴瑞生物科技有限公司 It is a kind of to prepare TCR and the method for the T cell of the dual-gene knockouts of HLA

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Justin Eyquem等.Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection.《nature》.2017,第543卷第113-117页. *
Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection;Justin Eyquem等;《nature》;20170222;第543卷;第113-117页 *

Also Published As

Publication number Publication date
CN110616233A (en) 2019-12-27

Similar Documents

Publication Publication Date Title
JP7101419B2 (en) Targeted substitution of endogenous T cell receptors
CN110616187B (en) Method for efficiently knocking chimeric antigen receptor gene into T cell specific genome site by CRISPR-Cas9 and application
JP2023030067A (en) Rna-guided nucleic acid modifying enzymes and methods of use thereof
JP2020537516A (en) Systems, methods, and compositions for targeted nucleic acid editing
CN110616189B (en) Preparation and application of universal targeting CD19 antigen chimeric receptor T cell
JP2019532644A (en) RNA-induced nucleic acid modifying enzyme and method of using the same
CN107893076A (en) CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA
CN106061488A (en) Immunotherapy of cancer
JP2017513477A5 (en)
CN110616233B (en) Method for efficiently knocking out primary T cell gene by CRISPR-Cas9 and application thereof
JP2023502780A (en) Method for activating and proliferating tumor-infiltrating lymphocytes
JP2022519070A (en) Gene regulation compositions and methods for improving immunotherapy
JP2021518760A (en) Modification of loci in the immune-related genome using paired CRISPR nickaseribonuclear proteins
Baghini et al. Optimizing sgRNA to improve CRISPR/Cas9 knockout efficiency: special focus on human and animal cell
Amirkhanov et al. Systems of delivery of CRISPR/Cas9 ribonucleoprotein complexes for genome editing
AU2018264636A1 (en) Artificially manipulated immune cell
CN110241136B (en) Small molecule compound for promoting gene editing and application thereof
KR20230036059A (en) Compositions and methods for modifying target nucleic acids
CN113748126A (en) Method for identifying immunoregulatory genes
US11761004B2 (en) Safe harbor loci
CN112175905B (en) Method for efficiently knocking out CD96 gene in NK cell
Popova et al. Clinical implementation of genome editing for correction of human diseases
CN112553200A (en) Preparation method and application of targeting vector for knocking out pig UGT2C1 gene
CN112126661B (en) Method for efficiently knocking out TIGIT gene in NK cell
CN102206680A (en) Gene electrotransfection buffer solution based on short-chain nucleic acid segments and preparation and application methods thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address

Address after: Unit 304, Building A6, Phase I of the Biomedical Industry Park, No. 218 Xinghu Street, Suzhou Industrial Park, China (Jiangsu) Pilot Free Trade Zone Suzhou Area, Suzhou City, Jiangsu Province, 215000

Patentee after: Suzhou Sunisier Biopharmaceutical Co.,Ltd.

Address before: 710119 605, Block E, gazelle Valley, No. 69, Jinye Road, Yanta District, Xi'an City, Shaanxi Province

Patentee before: Xi'an soniser biomedical Co.,Ltd.

CP03 Change of name, title or address