CN103224979A

CN103224979A - A pair of primer sequences for screening wheat scab resistance and use thereof

Info

Publication number: CN103224979A
Application number: CN201310013281XA
Authority: CN
Inventors: 王磊; 马鸿翔; 张旭; 余桂红; 杜军凯
Original assignee: Jiangsu Academy of Agricultural Sciences
Current assignee: Jiangsu Academy of Agricultural Sciences
Priority date: 2013-01-15
Filing date: 2013-01-15
Publication date: 2013-07-31
Anticipated expiration: 2033-01-15
Also published as: CN103224979B

Abstract

The invention relates to a pair of primer sequences for screening wheat scab resistance and a use thereof. The primer sequences are shown in the formulas of SEQ ID NO.1 and SEQ ID NO.2. Through the primer sequences, a wheat genome DNA is subjected to PCR amplification; and the amplification product is subjected to agarose gel electrophoresis and it is judged if the amplification product contains 183bp of a band so that it is directly determined if the detected wheat has wheat scab resistance, wherein only when the amplification product contains about 183bp of the band, the detected wheat has wheat scab resistance.

Description

A pair of primer sequence and the application thereof that can screen wheat scab resistance

Technical field

The present invention relates to a pair of primer sequence and the application thereof that can screen wheat scab resistance

Background technology

The wheat scab that is caused by Fusarium graminearum is the important disease of Chinese middle and lower reach of Yangtze River Mai Qu and northeast spring wheat district wheat, expands rapidly to Yellow River-Huai River region in recent years.In the rainy time, the popular and big generation of wheat scab can cause the serious underproduction of wheat, can be produced in the wheat of courses of infection the deleterious toxin of people and animals simultaneously, people and animals is vomitted after edible and poisons.Though chemical agent can be prevented and treated wheat scab, but the effect that adopts chemical control concerning serious susceptible kind is also not as people's will, and pesticide control also exists cost to strengthen and environmental pollution problems, and therefore cultivating disease-resistant variety is this sick essential measure of control.

The wheat scab resistance qualification process is easily affected by environment, and wastes time and energy.Molecular marker assisted selection can be selected breeding material at gene or the QTL of dna level at anti gibberellic disease, thereby can overcome the unstable of head blight phenotypic evaluation, reduces the cost that phenotype is estimated, and improves breeding for disease resistance efficient.In order to obtain the molecule marker chain with wheat scab resistance, people have carried out big quantity research, as far back as anti gibberellic disease kind Soviet Union wheat No. 3 and derive and obtained a main effect QTL that is positioned at the 3B the short arm of a chromosome in being, the 24%-46% of soluble phenotypic variation had also navigated to main effect QTL at same chromosome segment afterwards in Wangshuibai, resistant varieties such as peaceful 894037.Chain and the molecule marker that be positioned at both sides of QTL is SSR mark Xgwm493 and Xgwm533 therewith, but SSR marking path resistance QTL genetic distance is bigger, and there are problems such as pleomorphism site is inconsistent in as kinds such as Soviet Union wheat No. 3 and Wangshuibais at known disease-resistant material, be difficult to use in the marker assisted selection breeding, therefore be necessary to develop nearer and the consistent molecule marker of pleomorphism site in disease-resistant variety with resistant gene.

Liu etc. (2008) have been reported in this wheat 3BS scab resistance QTL area discover 7 anti gibberellic disease candidate genes, and according to wherein the 2nd gene order design primer, developed one with the closely linked molecule marker UMN10 of scab resistance QTL.This mark upstream primer is CGTGGTTCCACGTCTTCTTA, and downstream primer is TGAAGTTCATGCCACGCATA.Primer is behind pcr amplification, the resistant variety amplification obtains the gene fragment of 239bp, and the susceptible variety amplification obtains the gene fragment of 236bp, only there is the difference of 3 nucleotide base sizes in both, therefore must distinguish the anti-sense of head blight kind by the capillary electrophoresis analysis that ABI dna sequence analysis instrument carries out.Du Junkai etc. (2010) report utilizes specific dna single chain conformation polymorphism (SSCP) technology at this mark, also can detect this mark.But this technical requirements uses 12% non-sex change polyacrylate hydrogel to carry out electrophoresis, and gel volume is 320mm*30mm*0.4mm, and electrophoresis power is 80W.And the laboratory that present China is engaged in wheat breeding, many to the detection of pcr amplification product based on the gel electrophoresis of plain agar sugar, so utilize the primer of molecule marker UMN10 between anti-sense kind, to obtain polymorphism, also can't resist the sense kind and carry out check and analysis.

For this resistance QTL is reliably used at China's wheat breeding, we have carried out dna sequencing with the amplified production of this mark, according to the mononucleotide site difference that exists between the anti-sense kind, being translated into general laboratory, can to operate, utilize agarose gel electrophoresis be distinguishable SNAP primer, and be applied in the anti gibberellic disease molecular mark of wheat, effectively improve the wheat hybridizing breeding validity of scab resistance selection from generation to generation early.

Summary of the invention

The object of the present invention is to provide a kind of primer sequence and application thereof that is used for the wheat scab resistance screening.

The object of the present invention is achieved like this: a pair of primer sequence that can screen wheat scab resistance is characterized in that described a pair of specific primer sequence is: upstream primer SEQ ID NO.1 and downstream primer SEQ ID NO.2.

A kind of application of above-mentioned primer sequence, it is characterized in that, with SEQ ID NO.1 and SEQ ID NO.2 is primer, with wheat cdna group DNA to be measured is that template is carried out pcr amplification, again amplified production electrophoretic separation in sepharose is detected,, be disease-resistant variety if contain the band of size about 183bp in the amplified production, otherwise wheat to be measured does not have scab resistance, is susceptible variety.

In the application of above-mentioned primer sequence:

The reaction system of pcr amplification is: the wheat cdna group DNA to be measured of 20-100ng, the Taq enzyme 0.25 μ L of 5U/ μ L, each 1 μ L of the SEQ ID NO.1 of 4 μ mol/L and SEQ ID NO.2, the dNTP 0.5 μ L of 10mmol/L, the Mg of 10 * PCR ²⁺Plus damping fluid 2.5 μ L, surplus is a sterile distilled water;

The reaction conditions of pcr amplification is: 95 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30sec subsequently, the 30sec that anneals under 58 ℃ of conditions, 72 ℃ are extended 30sec, carry out 35 circulations; Last 72 ℃ are extended 10min; Preserve down at 4 ℃.

In the application of above-mentioned primer sequence:

To being meant that amplified production electrophoretic separation in sepharose detects: with amplified production electrophoretic separation in the sepharose of 0.8%-2%, the band that whether contains 183bp in the amplified production is judged in EB dyeing.

The invention has the advantages that: wheat cdna group DNA is carried out pcr amplification by SEQ ID NO.1 and SEQ ID NO.2, amplified production is carried out the detection of mark by agarose electrophoresis, do not need to utilize sequenator or native gel electrophoresis to detect, simple to operate; Bring to judge whether wheat lines contains this scab resistance gene can amplify the 183bp size bar, very directly perceived, do not need size by order-checking or comparison band.

Description of drawings

Fig. 1: utilize agarose electrophoresis to detect the amplification of primer UMN10 to the anti-sense of head blight kind.

Fig. 2: utilize the SSCP method to detect the amplification of primer UMN10 to the anti-sense of head blight kind.

Fig. 3: utilize agarose electrophoresis detection primer SEQ ID NO.1 and SEQ ID NO.2 amplification to the anti-sense of head blight kind.

Among Fig. 1 and Fig. 3: M: molecular weight standard DL2000; The 1-7 swimming lane is followed successively by wheat breed Wangshuibai, peaceful 894037, peace farming 8455, Alondra, Clark, Taiwan wheat, A Fu among Fig. 1 ~ Fig. 3.

Embodiment

Embodiment 1:

UMN10 primer (known primer entrusts Nanjing Genscript Biotechnology Co., Ltd. to synthesize):

Upstream primer: 5 '-CGTGGTTCCACGTCTTCTTA-3 ',

Downstream primer: 5 '-TGAAGTTCATGCCACGCATA-3 '.

Wheat breed: Wangshuibai, peaceful 894037, peace farming 8455, Alondra, Clark, Taiwan wheat, A Fu.

Detection method:

With UMN10 is primer, is that template is carried out pcr amplification with wheat cdna group DNA to be measured, and the PCR reaction system is: DNA 20-100ng, Taq enzyme (5U/ μ L) 0.25 μ L, each 1 μ L of upstream and downstream primer (4 μ mol/L), dNTP (10mmol/L) 0.5 μ L, 10 * PCR damping fluid (Mg ²⁺Plus) 2.5 μ L use sterile distilled water postreaction system to 25 μ L then; With reaction system at 95 ℃ of pre-sex change 5mi, 94 ℃ of sex change 30sec subsequently, the 30sec that anneals under 58 ℃ of conditions, 72 ℃ are extended 30sec, carry out 35 circulations; Last 72 ℃ are extended 10min; Preserve down at 4 ℃.

With amplified production electrophoretic separation in the sepharose of 0.8%-2%, EB dyeing, the detected result of acquisition such as Fig. 1.

All contain an amplified band in the amplified production of all wheat breeds to be measured, stripe size is close, can't distinguish 239bp or 236bp, the PCR qualification result can't be confirmed the resistance index of above-mentioned wheat breed, must be by the capillary electrophoresis mode, or SSCP detection mode (the results are shown in Figure 2), or the mode that traditional field resistance is identified is further analyzed.

Embodiment 2

Primer (entrusting Nanjing Genscript Biotechnology Co., Ltd. to synthesize):

Upstream primer SEQ ID NO.1

5’- ACAAGTATCGGATACTGGGTTGCAT -3’，

Downstream primer SEQ ID NO.2:

5’- TGAAGTTCATGCCACGCATA -3’。

Detection method:

With UMN10 SEQ ID NO.1 and SEQ ID NO.2 is primer, with wheat cdna group DNA to be measured is that template is carried out pcr amplification, the PCR reaction system is: DNA 20-100ng, Taq enzyme (5U/ μ L) 0.25 μ L, each 1 μ L of upstream and downstream primer (4 μ mol/L), dNTP (10mmol/L) 0.5 μ L, 10 * PCR damping fluid (Mg ²⁺Plus) 2.5 μ L use sterile distilled water postreaction system to 25 μ L then; With reaction system at 95 ℃ of pre-sex change 5mi, 94 ℃ of sex change 30sec subsequently, the 30sec that anneals under 58 ℃ of conditions, 72 ℃ are extended 30sec, carry out 35 circulations; Last 72 ℃ are extended 10min; Preserve down at 4 ℃.

With amplified production electrophoretic separation in the sepharose of 0.8%-2%, EB dyeing, the detected result of acquisition such as Fig. 3.

What contain the 183bp size strip in the amplified production has a Wangshuibai, peaceful 894037 and the Taiwan wheat, proves that it contains this scab resistance gene, is disease-resistant variety; And peace farming 8455, Alondra, Clark and A Fu do not amplify band, prove that it does not contain this scab resistance gene, are susceptible variety.Further utilize traditional field resistance authentication method to verify, each wheat breed was investigated the sick small ear rate of each wheat breed in back 21 days in the pathogenic bacteria spore liquid of blooming stage inoculation equal amts in inoculation.The disease resistance qualification result shows, the Wangshuibai of above-mentioned disease-resistant variety, peaceful 894037 and the sick small ear rate of Taiwan wheat respectively be 5.4%, 8.7% and 7.0%, prove its certain high anti gibberellic disease; And the sick small ear rate of the peace farming 8455 of above-mentioned susceptible variety, Alondra, Clark and A Fu respectively is 17.7%, 24.9%, 24.2% and 26.0%, proves its anti gibberellic disease not really, is susceptible variety.

By comparison to Fig. 1, Fig. 2 and Fig. 3, we are as can be seen: by SEQ ID NO.1 and SEQ ID NO.2 wheat cdna group DNA is carried out pcr amplification, can directly pass through agarose electrophoresis, bring the judgement wheat lines whether to contain this scab resistance gene can amplify the 183bp size bar, detection method is simple to operate, detected result is very directly perceived, detects the effect significant effective.

SEQUENCE LISTING

＜110〉Jiangsu Province Agriculture Science Institute

＜120〉a pair of primer sequence and the application thereof that can screen wheat scab resistance

<130> 2

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 25

<212> DNA

＜213〉artificial sequence

<400> 1

acaagtatcg gatactgggt tgcat 25

<210> 2

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 2

tgaagttcat gccacgcata 20

Claims

1. a pair of primer sequence that can screen wheat scab resistance is characterized in that, described a pair of specific primer sequence is: upstream primer SEQ ID NO.1 and downstream primer SEQ ID NO.2.

2. the application of primer sequence according to claim 1, it is characterized in that, with SEQ ID NO.1 and SEQ ID NO.2 is primer, with wheat cdna group DNA to be measured is that template is carried out pcr amplification, again amplified production electrophoretic separation in sepharose is detected,, be disease-resistant variety if contain the band of 183bp size in the amplified production, otherwise wheat to be measured does not have scab resistance, is susceptible variety.

3. the application of primer sequence according to claim 2 is characterized in that:

4. according to the application of claim 2 or 3 described primer sequences, it is characterized in that: to being meant that amplified production electrophoretic separation in sepharose detects: with amplified production electrophoretic separation in the sepharose of 0.8%-2%, the band that whether contains 183bp in the amplified production is judged in EB dyeing.