CN103221531A

CN103221531A - Bacterium lactobacillus helveticus having high proteolysis activity

Info

Publication number: CN103221531A
Application number: CN2011800541384A
Authority: CN
Inventors: 若井丈人; 畑中美咲; 中村康则; 山本直之
Original assignee: Calpis Co Ltd
Current assignee: Asahi Group Holdings Ltd
Priority date: 2010-11-09
Filing date: 2011-11-08
Publication date: 2013-07-24
Anticipated expiration: 2031-11-08
Also published as: JPWO2012063826A1; WO2012063826A1; TW201305331A; AU2011327288B2; AU2011327288A1; MY160992A; CN103221531B; TWI551684B; JP5888701B2

Abstract

The present invention provides a lactic acid bacterium which has high proteolysis activity and thus has excellent peptide production ability and/or amino acid production ability. The present invention also provides fermented milk which contains an amino acid and/or a peptide at high concentration and has a good flavor. The present invention specifically provides a lactic acid bacterium belonging to the genus Lactobacillus helveticus, which is characterized by having at least one of the following properties (a)-(d). (a) The lactic acid bacterium produces 25 [mu]mol/ml or more of a free amino acid by fermenting animal milk. (b) The lactic acid bacterium produces 8.5 mg/ml or more of a peptide by fermenting animal milk. (c) The lactic acid bacterium produces XP peptide and/or XPP peptide in a total amount of 260 [mu]g/ml or more by fermenting animal milk. (d) The amount of IPP peptide and VPP peptide per acidity of fermented milk that is obtained by fermenting animal milk at 30-34 DEG C (inclusive) is 6.0 mg/g or more in terms of VPP.

Description

Lactobacterium helveticus bacterium with high protein hydrolytic activity

Technical field

The present invention relates to a kind of new milk-acid bacteria that belongs to lactobacterium helveticus (Lactobacillus helveticus).The present invention relates in addition by make the milk fermentation fermented-milk that obtains and the composition or the diet product that contain described milk-acid bacteria with described milk-acid bacteria.The present invention relates to the method for using described milk-acid bacteria to produce amino acid and/or peptide in addition.

Background technology

Known milk protein and food proteins comprise functional peptide potentially.Milk protein or food proteins have been attempted using by enzymolysis or fermentation processing.For example, as this type of functional peptide, reported tripeptides VPP and IPP to have angiotensin-converting enzyme (angiotensin converting enzyme ACE) suppresses active and therefore shows hypotensive activity (patent documentation 1-4 and non-patent literature 1).

The dipeptides YP that has reported the functional peptide that conduct except that VPP and IPP is milk-derived has hypotensive and angst resistance effect (patent documentation 5).Reported that also dipeptides IP, AP, EP, RP, QP, TP, MP and GP have ACE to suppress active hard-decomposed peptide group (for example, patent documentation 6).

Simultaneously, lactobacterium helveticus (L.helveticus) routine is used to produce dairy products, and known its has the high protein hydrolytic activity.For the fermented-milk of easier picked-up and processing is provided, reported that some have the lactobacterium helveticus bacterial strain (patent documentation 1-4 and 7, non-patent literature 1) of high protein hydrolytic activity and good peptide productivity.

Protein is to be made of amino acid, and therefore can supply with amino acid whose source by promoting proteolysis to become.Known amino acid also has multiple function except that nutrition and local flavor.For example, because branched-chain amino acid (BCAA) is contained in the protein that constitutes muscle, wherein BCAA is consumed when motion waits and is used as energy, so known supply BCAA is important.L-Ala (Ala) is a glycogenic amino acid, known energy source as liver.Because Ala consumes the NADH that produces when alcohol decomposes, so show that the decomposition reaction in the liver carries out in the presence of Ala.Known in addition Ala induces the sense of taste (that is, good taste and local flavor) of delicate flavour (umami) and has generation Nai Er (shionare) and Su Naier (sunare) effect (that is, reducing the effect of the salty and sour sense of taste) and shelter the effect of sharp flavor.It is said that Methionin (Lys) is the amino acid of easy shortage among the indispensable amino acid.Must absorb the starting material of Lys as antibody, hormone or enzyme etc.Reported that Lys also participates in calcium absorption, collagen forms and osseous tissue production.For example phosphatidylserine and other amino acid whose precursors are important to Serine (Ser) as various important substance in the body.Also known Ser suppresses the minimizing or the brain cell death of blood cholesterol levels by neuronic activation in the brain, prevents brain aging thus and as the skin moisture-keeping composition.

For producing this type of amino acid, microorganism is used energetically.Yet, can be also few with the amino acid whose example that the form of microbial fermentation product is directly absorbed.About milk-acid bacteria, screened milk-acid bacteria so that improve the local flavor of Japanese pickled prod with good decomposition amino acid active.Yet, the known example that does not have research directly to use fermented-milk for capture functions acidic amino acid and functional peptide.

The prior art document

Patent documentation

Patent documentation 1: European patent 1016709B

Patent documentation 2: international publication WO01/32836

Patent documentation 3: international publication WO2007/096510

Patent documentation 4: European patent 1820850

Patent documentation 5: European patent 0821968

Patent documentation 6: European patent 1661909

Patent documentation 7:JP publication (Te Kaiping) 07-274949A (1995)

Non-patent literature

Non-patent literature 1:Nakamura, people such as Y., J.Dairy Sci.Vol.78,1253-1257 page or leaf, 1995

Summary of the invention

The problem that invention will solve

Therefore, the purpose of this invention is to provide and have high protein hydrolytic activity and the good peptide throughput and/or the milk-acid bacteria of amino acid throughput.Another object of the present invention provides amino acid and/or peptide that contains high density and the fermented-milk with excellent flavor.

The scheme that is used to deal with problems

As the result with the further investigation that achieves the above object, the present inventor has been subordinated to and has successfully obtained in the lactic bacterium strains of lactobacterium helveticus milk protein is had good amino acid throughput and excellent function peptide throughput and has the active bacterial strain of the proteolysis that is higher than conventional milk-acid bacteria.In addition, the present inventor has found to obtain amino acid and/or high fermented-milk and the composition of peptide content by means of this bacterial strain, thereby allows to produce amino acid and/or peptide.As a result, the present inventor finishes the present invention.

Particularly, the present invention comprises following [1] to [32].

[1] a kind of milk-acid bacteria that belongs to lactobacterium helveticus, it has following (a) at least a to (d) characteristic:

(a) by making the total free aminoacids more than the animal milk fermentative production 25 μ mol/ml;

(b) by making the peptide more than the animal milk fermentative production 8.5mg/ml;

(c) be XP peptide and/or XPP peptide more than the 260 μ g/ml by making animal milk fermentative production total amount; With

(d), produce with the conversion amount of VPP and count IPP and VPP peptide more than the 6.0mg/g by making under the acidity unit (acidity) of animal milk at the 30-34 ℃ of fermented-milk that bottom fermentation obtained.

[2] according to [1] described milk-acid bacteria, wherein the described total free aminoacids more than 15% is a branched-chain amino acid.

[3] according to [1] or [2] described milk-acid bacteria, wherein said total free aminoacids comprises at least a amino acid that is selected from Beta Alanine, Methionin and Serine.

[4] according to [1] to [3] each described milk-acid bacteria, it produces the YP peptide with the amount more than the 60 μ g/ml.

[5] according to [1] to [4] each described milk-acid bacteria, it is the mutant strain of lactobacterium helveticus CM4 bacterial strain (accession number FERM BP-6060).

[6] according to [1] to [5] each described milk-acid bacteria, it is lactobacterium helveticus CP3232 bacterial strain (accession number FERM BP-11271) or its mutant strain.

[7] a kind of lactobacterium helveticus CP3232 bacterial strain (accession number FERM BP-11271).

[8] a kind of composition that is used for being produced by animal milk amino acid and/or peptide, it comprises at least a milk-acid bacteria that belongs to lactobacterium helveticus.

[9] according to [8] described composition, it is by making the total free aminoacids more than the animal milk fermentative production 25 μ mol/ml.

[10] according to [9] described composition, wherein said total free aminoacids be branched-chain amino acid more than 15%.

[11] according to [9] or [10] described composition, wherein said total free aminoacids comprises at least a amino acid that is selected from Beta Alanine, Methionin and Serine.

[12] according to [8] to [11] each described composition, it produces peptide by making the animal milk fermentation with the amount more than the 8.5mg/ml.

[13] according to [8] to [12] each described composition, it is XP peptide and/or an XPP peptide more than the 260 μ g/ml by making animal milk fermentative production total amount.

[14] according to [8] to [13] each described composition, it produces the YP peptide by making the animal milk fermentation with the amount more than the 60 μ g/ml.

[15] according to [8] to [14] each described composition, by making animal milk under the acidity unit of the 30-34 ℃ of fermented-milk that bottom fermentation obtained, it is produced with the conversion amount of VPP and counts IPP and VPP peptide more than the 6.0mg/g.

[16] according to [8] to [15] each described composition, wherein said milk-acid bacteria is [1] to [7] each described milk-acid bacteria.

[17] a kind of fermented-milk, it is by making the animal milk fermentation and obtain and comprising following (a) at least a to (d) composition with at least a milk-acid bacteria that belongs to lactobacterium helveticus:

(a) the above total free aminoacids of 25 μ mol/ml;

(b) the above peptide of 8.5mg/ml;

(c) add up to 260 μ g/ml above XP peptide and/or XPP peptide; With

(d) under acidity unit, when the conversion amount timing with VPP is IPP and a VPP peptide more than the 6.0mg/g.

[18] according to [17] described fermented-milk, it comprises at least a milk-acid bacteria that belongs to lactobacterium helveticus.

[19] according to [17] or [18] described fermented-milk, it comprises [1] to [7] each described at least a milk-acid bacteria.

[20] according to each described fermented-milk of claim [17] to [19], wherein said total free aminoacids be branched-chain amino acid more than 15%.

[21] according to each described fermented-milk of claim [17] to [20], wherein said total free aminoacids comprises at least a amino acid that is selected from Beta Alanine, Methionin and Serine.

[22] according to each described fermented-milk of claim [17] to [21], it comprises the YP peptide that 60 μ g/ml are above.

[23] according to each described fermented-milk of claim [17] to [22], wherein under 30-34 ℃ temperature, carry out described fermentation.

[24] according to each described fermented-milk of claim [17] to [23], it is used for hypotensor, improving brain function agent, autonomic nerve conditioning agent, parasympathetic nerve conditioning agent, sympathetic nerve conditioning agent, nutritious supplementary, energy supplement agent, sarcolysis and muscle injury inhibitor, muscle toughener, tired light-weight additive, weather resistance activator, flavor improving agent or pure metabolism agent.

[25] a kind of diet product, it comprises [1] to [7] each described at least a milk-acid bacteria and/or its handled thing and/or [17] to [24] each described fermented-milk and/or its handled thing.

The production method of [26] one seed amino acids and/or peptide, it comprises that each described at least a milk-acid bacteria of use [1] to [7] or [8] to [16] each described composition make animal milk or milk protein fermentation, collect amino acid and/or peptide then from the tunning that is obtained.

[27] according to [26] described method, wherein said amino acid is branched-chain amino acid.

[28] according to [26] or [27] described method, wherein said amino acid comprises at least a amino acid that is selected from Beta Alanine, Methionin and Serine.

[29] according to [26] to [28] each described method, wherein said peptide is at least a peptide that is selected from the group of being made up of XP peptide and/or XPP peptide.

[30] according to [26] to [29] each described method, wherein under 30-34 ℃ temperature, carry out described fermentation.

[31] a kind of preparation method that has the proteolysis activity and belong to the milk-acid bacteria of lactobacterium helveticus, it may further comprise the steps:

(a) mutant strain of preparation lactobacterium helveticus CM4 bacterial strain (accession number FERM BP-6060) or lactobacterium helveticus CP3232 bacterial strain (accession number FERM BP-11271); With

(b) from this mutant strain screening have at least a below (a) to the bacterial strain of (d) characteristic:

(c) by making the animal milk fermentative production add up to XP peptide and/or XPP peptide more than the 260 μ g/ml; With

(d), produce with the conversion amount of VPP and count IPP and VPP peptide more than the 6.0mg/g by making animal milk under the acidity unit of the 30-34 ℃ of fermented-milk that bottom fermentation obtained.

[32] a kind of production method of functional diet product, it comprises each described at least a milk-acid bacteria of preparation [1] to [7] and/or its handled thing and/or [17] to [24] each described fermented-milk and/or its handled thing, and described milk-acid bacteria and/or its handled thing and/or described fermented-milk and/or its handled thing are mixed to step in the diet product.

The effect of invention

According to the present invention, provide to have high protein hydrolytic activity and the good peptide throughput and the milk-acid bacteria that belongs to lactobacterium helveticus of amino acid throughput.Amino acid and/or the peptide produced by described milk-acid bacteria have multiple function.For example, peptide such as IPP, VPP and YP have hypotensive activity.In addition, by using described lactobacillus-fermented, can obtain to contain the various amino acid with various functions of high density and/or the fermented-milk of peptide.The amount height of described IPP and VPP peptide under the acidity unit (unit of acidity) of thus obtained fermented-milk is therefore owing to carrying out the caused problem of high acidity that conventional fermenting lactic acid causes.Particularly, can produce the fermented-milk that the level that contains amino acid and/or peptide is higher than the lactic acid-producing level.Therefore, by means of a spot of fermented-milk, can produce the product that has excellent flavor and be easy to drink or keep edible the time its functional form expediently.In addition, described product can be offered the human consumer.

Description of drawings

Fig. 1 illustrates and shows the figure be included in by each amino acid whose amount (nmol/ml) in the supernatant liquor that makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains under 32 ℃ (A) or 37 ℃ (B).

Fig. 2 illustrate show the total amount (μ mol/ml) be included in by total free aminoacids in the supernatant liquor that under 32 ℃ or 37 ℃, makes the fermented-milk that milk fermentation obtained in 24 hours with each lactic bacterium strains (A) with amount (μ mol/ml) figure (B) of branched-chain amino acid.

Fig. 3 is the figure that illustrates by the amount (mg/ml) of peptide in the supernatant liquor that makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains under 32 ℃ or 37 ℃.

Fig. 4 illustrates and shows the figure be included in by the amount (μ g/ml) of functional peptide in the supernatant liquor that makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains under 32 ℃ (A) or 37 ℃ (B).

Fig. 5 illustrates and shows the figure be included in by the amount (μ g/ml) of XP peptide and XPP peptide in the supernatant liquor that makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains under 32 ℃ (A) or 37 ℃ (B).

Fig. 6 illustrates and shows the figure be included in by each amino acid whose amount (nmol/ml) in the supernatant liquor that makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains under 32 ℃ (A) or 37 ℃ (B).

Fig. 7 illustrate show the total amount (μ mol/ml) be included in by total free aminoacids in the supernatant liquor that under 32 ℃ or 37 ℃, makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains (A) with amount (μ mol/ml) figure (B) of branched-chain amino acid.

Fig. 8 is the figure that is illustrated in by the amount (mg/ml) of peptide in the supernatant liquor that makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains under 32 ℃ or 37 ℃.

Fig. 9 illustrates and shows the figure be included in by the amount (μ g/ml) of functional peptide in the supernatant liquor that makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains under 32 ℃ (A) or 37 ℃ (B).

Figure 10 illustrates and shows the figure be included in by the amount (μ g/ml) of XP peptide and XPP peptide in the supernatant liquor that makes the fermented-milk that milk fermentation obtained in 24 hours with each specified lactic bacterium strains under 32 ℃ (A) or 37 ℃ (B).

Figure 11 illustrates by polymerase chain reaction (PCR) the method segmental electrophoretogram that the genomic dna of each specified lactic bacterium strains obtains that increases.

Figure 12 illustrates by polymerase chain reaction (PCR) the method segmental electrophoretogram that the genomic dna of each specified lactic bacterium strains obtains that increases.

Embodiment

Below the present invention will be described in more detail.The application requires the right of priority of the Japanese patent application 2010-250754 of submission on November 9th, 2010, and the application comprises the specification sheets and/or the described content of accompanying drawing of this application.

The milk-acid bacteria that belongs to lactobacterium helveticus according to the present invention is for producing the milk-acid bacteria of lactic acid by fermentation by sugar, and is also referred to as " milk-acid bacteria of the present invention " herein.Milk-acid bacteria of the present invention is characterised in that to have high protein hydrolytic activity and good amino acid throughput and/or excellent function peptide throughput.Particularly, milk-acid bacteria of the present invention has following (a) at least a to (d) characteristic:

(a) by making the total free aminoacids more than the animal milk fermentative production 25 μ mol/ml, more than the preferred 30 μ mol/ml;

(b) by making the peptide more than the animal milk fermentative production 8.5mg/ml, more than the preferred 10mg/ml;

(c) animal milk fermentative production total amount is more than the 260 μ g/ml, more than the preferred 280 μ g/ml, further XP peptide and/or the XPP peptide more than the preferred 300 μ g/ml by making; With

Can measure the characteristic of above-mentioned (a) to (d) by the method for for example describing in an embodiment after a while known in the art.Simply, can by with the milk-acid bacteria that belongs to lactobacterium helveticus under 30-35 ℃, preferably (for example under 30-34 ℃, make as the milk protein of substrate, animal milk) fermentation is 10-30 hour, measures the amount of the total free aminoacids be included in from the tunning that described milk protein obtains or peptide and acidity then and waits and judge (a) to (d) characteristic.

About (a), can use known amino acid analyzer for example high performance liquid chromatograph measure amino acid whose amount.Milk-acid bacteria of the present invention can be by fermenting animal milk to produce the total free aminoacids more than the 25 μ mol/ml, more than the preferred 30 μ mol/ml.In addition, branched-chain amino acid is with more than the 5 μ mol/ml and the more preferably amount production more than the 6 or 7 μ mol/ml, and branched-chain amino acid (Xie Ansuan, leucine and Isoleucine) is preferably more than 15% of the total free aminoacids of producing, more preferably more than 19% or 20%.Total free aminoacids preferably comprises the above at least a amino acid that is selected from Beta Alanine, Methionin and Serine of 2000 μ g/ml, and more preferably comprises each at least two seed amino acid of 1500 μ g/ml.

About (b), can by methods known in the art for example OPA method people such as (, J.Dairy Sci.1983.66:1219-1227) Church measure the amount of peptide.Milk-acid bacteria of the present invention can be by fermenting animal milk to produce the peptide more than the 8.5mg/ml, more than the preferred 10mg/ml.

About (c), term " XP peptide " is meant the peptide that Xaa-Pro (wherein Xaa represents amino acid arbitrarily) constitutes.The example of XP peptide comprises YP (Tyr-Pro), VP (Val-Pro), IP (Ile-Pro), AP (Ala-Pro), EP (Glu-Pro), RP (Arg-Pro), QP (Gln-Pro), TP (Thr-Pro), MP (Met-Pro) and GP (Gly-Pro).In addition, term " XPP peptide " is meant the peptide that Xaa-Pro-Pro (wherein Xaa represents amino arbitrarily) constitutes.The example of XPP peptide comprises VPP (Val-Pro-Pro), IPP (Ile-Pro-Pro) and LPP (Leu-Pro-Pro).In addition, be called as " dipeptides " and " tripeptides " separately, or be called as " functional peptide " together as the XP peptide and the XPP peptide that use in this article.Can use known LC/MS instrument to measure the amount of described XP peptide and/or described XPP peptide.Milk-acid bacteria of the present invention can be by making animal milk fermentation production be more than the 260 μ g/ml, more than the preferred 280 μ g/ml and more preferably XP peptide more than the 300 μ g/ml and/or XPP peptide.Especially, preferably produce above, the more preferably above and further above YP peptide of preferred 70 μ g/ml of 65 μ g/ml of 60 μ g/ml.

About (d), can measure acidity (that is the concentration of acid in the fermented-milk) by using known neutralization titrations such as known automatic titrator.In addition, can measure IPP peptide and VPP peptide by the method for being put down in writing about (c).Milk-acid bacteria of the present invention is by making animal milk under the acidity unit of the 30-34 ℃ of fermented-milk that bottom fermentation obtained, the amount of the IPP of production and VPP peptide with the conversion amount of VPP count more than the 5.5mg/ml, more than the preferred 6.0mg/ml.In addition, use 1.02 proportions to calculate above-mentioned amount as fermented-milk.In addition, calculate the amount of IPP and VP peptide (as described herein) by following formula according to suppress active VPP conversion amount based on ACE:

The amount (μ g/ml) of amount (μ g/ml) * 1.7+VPP of (VPP conversion amount (μ g/ml))=IPP

Milk-acid bacteria of the present invention has at least a above-mentioned (a) to (d) characteristic and preferred demonstration above-mentioned 2 kinds, 3 kinds or whole characteristics.For example, milk-acid bacteria of the present invention has (a) and (b), (c) or characteristic (d), or have (a) and (b), (a) and (c), (a) and (d), (b) and (c), (b) and (d) or (c) and characteristic (d), (a) and (b) and (c); (a) and (b) and (d); (a), (c) and (d); (b), (c) and characteristic (d), or (a) to the characteristic of (d).

Among the present invention, milk-acid bacteria of the present invention comprises that any belongs to the milk-acid bacteria of the lactobacterium helveticus that shows at least a above-mentioned characteristic.Have this class feature lactobacterium helveticus preferred embodiment for by the inventor oneself from using lactobacterium helveticus CM4 bacterial strain (accession number FERM BP-6060, patent documentation 1) as parental plant (parent strain) and the lactobacterium helveticus CP3232 bacterial strain that screens in the mutant strain of acquisition.In addition, (AIST) (a kind of ground of 1 fourth order, east, ripple city, 1 the 6th (postcode 305-8566) Tsukuba Central6 of central authorities is built in the Hitachinaka County, Japan on August 15th, 1997 and on August 4th, 2010 lactobacterium helveticus CM4 bacterial strain and CP3232 bacterial strain to be preserved in biological preservation center (the International Patent Organism Depositary) Independent Administrative Leged Industrial Technology Complex Inst of international monopoly (National Institute of Advanced Industrial Science and Technology) according to FERM BP-6060 and FERM BP-11271 respectively by the applicant, 1-1-1Higashi, Tsukuba, Ibaraki, Japan, 305-8566), described AIST is the international depositary institution (IDA) that sets up for preservation patent microorganism according to budapest treaty (Budapest Treaty).Described in embodiment, confirmed that described lactobacterium helveticus CP3232 bacterial strain has above-mentioned (a) all characteristics to (d).

In addition, described lactobacterium helveticus CP3232 bacterial strain is the mutant strain that is derived from above-mentioned lactobacterium helveticus CM4 bacterial strain as parental plant.Therefore, the mutant strain of lactobacterium helveticus CM4 bacterial strain and lactobacterium helveticus CP3232 bacterial strain may have any above-mentioned (a) characteristic to (d).Also comprise these mutant strains among the present invention, as long as it has above-mentioned characteristic from lactobacterium helveticus CP3232 bacterial strain or lactobacterium helveticus CM4 bacterial strain.

Among the present invention, term " mutant strain " is meant any bacterial strain that obtains from parental plant.Particularly, be meant by increasing the spontaneous mutation frequency or increasing through with the method for the artificial mutation frequency of the mutagenesis of physics or chemical mutagen or the bacterial strain that concrete mutating technology (for example, genetic recombination) obtains from parental plant.Screen repeatedly and separate the microorganism that produces by these methods, therefore the mutant strain that can obtain to have the purpose characteristic to cultivate useful microorganism.

The example of this type of mutant strain used herein comprises from as CM4 bacterial strain, CP3232 bacterial strain or its mutant strain of parental plant and the bacterial strain that obtains.Particularly, the example of the mutant strain of CM4 bacterial strain comprises the mutant strain that the CM4 bacterial strain screens in addition after some sudden changes repeatedly.

For example, molecular weight distribution based on the fragment (fragment of the genomic dna of milk-acid bacteria) that increases by polymerase chain reaction (PCR) method can easily make the mutant strain from lactobacterium helveticus CM4 bacterial strain, lactobacterium helveticus CP3232 bacterial strain and mutant strain thereof be different from other lactic bacterium strains.In brief, the DNA sample of preparation purpose lactic bacterium strains, for example having by the use of PCR method, the primer of sequence shown in the SEQ ID NOS:1 and 2 carries out gene amplification, analyze thus obtained segmental electrophoretogram, and whether the resulting bacterial strain of decidable is the mutant strain that originates from lactobacterium helveticus CP3232 bacterial strain or lactobacterium helveticus CM4 bacterial strain.Yet, confirm that whether this class object bacterial strain (subject strain) is that the method for mutant strain is not limited to this method.Even when not detecting above-mentioned PCR fragment, obtained strains may be from the mutant strain of lactobacterium helveticus CM4 bacterial strain or from the mutant strain of lactobacterium helveticus CP3232 bacterial strain.Can confirm whether this class object bacterial strain is mutant strain by detecting other gene fragments, Microbiological Characteristics or technology known in the art.

By judging that whether this type of mutant strain has above-mentioned (a) characteristic to (d), can obtain can be used as the bacterial strain of milk-acid bacteria of the present invention.

Milk-acid bacteria of the present invention can be cultivated under suitable condition by the substratum that use is generally used for cultivating milk-acid bacteria and prepare.Natural medium or synthetic medium can be used as substratum, as long as it comprises carbon source, nitrogenous source, inorganic salt and other compositions and can cultivate milk-acid bacteria effectively.Those skilled in the art can suitably select the known substratum that is applicable to stand-by bacterial strain.The example of spendable carbon source comprises lactose, glucose, semi-lactosi and blackstrap molasses (blackstrap molasses).The example of spendable nitrogenous source comprises organic nitrogenous substances, for example casein hydrolysate, serum protein hydrolysate and soy-protein hydrolyzate.The example of spendable inorganic salt comprises phosphoric acid salt, sodium, potassium and magnesium.The example of cultivating the suitable substratum of milk-acid bacteria comprises MRS liquid nutrient medium, GAM substratum, BL substratum, Briggs liver broth (Briggs Liver Broth), animal milk, skimming milk and whey deutero-breast.The preferred newborn substratum that contains sterilized skim-milk that uses.

In addition, can be 20 ℃ to 50 ℃, preferred 25 ℃ to 42 ℃, also more preferably 28 ℃ to 37 ℃ cultivations of carrying out milk-acid bacteria of the present invention by anaerobic condition.Can use thermostatic bath, sheathing formula well heater (mantle heater) or chuck to wait and adjust temperature condition.In addition, the term " anaerobic condition " that uses in the text is meant the low-oxygen environment that milk-acid bacteria can breed.For example, can be by using anaerobic chamber, anaerobic box or contain the sealed vessel of oxygen scavenger or sack etc., or provide anaerobic condition by sealing culture vessel simply.The form of cultivating comprises that leaving standstill cultivation, shaking culture and slot type cultivates (tank culture).Incubation time can be 3-96 hour.When cultivating beginning, preferably keep the pH of substratum at 4.0-8.0.

The specific examples of preparation milk-acid bacteria of the present invention is below described simply.For example, when using lactobacterium helveticus CP3232 bacterial strain, with lactobacillus inoculum to sterilized newborn substratum (for example, containing the newborn substratum that 9.00% (w/w) restores skim-milk (reconstituted powdered skim milk)), then in 28-37 ℃ of following incubated overnight (about 18-28 hour).Preferably carry out this culturing step repeatedly.

After the cultivation, the culture of the milk-acid bacteria that is obtained can directly use, or can be further randomly carries out thick purifying and/or carry out solid-liquid separation and sterilization by filtering etc. by centrifugal etc.

In addition, can use by handling the handled thing of the milk-acid bacteria that milk-acid bacteria of the present invention obtains, as long as it has the purpose characteristic.Alternatively, the handled thing of milk-acid bacteria can be further processed.The example of this type of processing is below described.

Use lactic-acid bacteria cells and/or its handled thing to make lactogenesis, skimming milk or soya-bean milk fermentation, therefore can prepare tunning.For example, milk-acid bacteria or the lactobacillus inoculum handled in addition to lactogenesis, skimming milk or soya-bean milk, are then fermented by (condition that is equivalent to above-mentioned cultivation milk-acid bacteria basically) under the condition known in the art.The tunning that is obtained can directly use, or carries out other processing and for example filter, sterilize, dilute or concentrate.

Can be by in appropriate solvent, suspending or dilution and lactic-acid bacteria cells and/or its handled thing are prepared as the form of suspension or diluent.The example of spendable solvent comprises water, physiological saline and phosphate buffered saline buffer (PBS).

The sterilization of lactic-acid bacteria cells and/or its handled thing can be made, therefore the sterilization product can be prepared.In order to make the sterilization of lactic-acid bacteria cells and/or its handled thing, for example, can carry out for example filtration sterilization, the radioactivity sterilization of known sterilising treatment, cross heat sterilization (superheat sterilization) or pressurization sterilization.

Lactic-acid bacteria cells and/or its handled thing are heat-treated, therefore can prepare the thermal treatment thing.In order to prepare this type of thermal treatment thing, lactic-acid bacteria cells and/or its handled thing are carried out pyroprocessing (for example, under 80-150 ℃) about 10-60 minute (for example, about 10-20 minute).

Lactic-acid bacteria cells and/or its handled thing fragmentation, grinding or pulverizing can be made, therefore breakdown products or cell-free extract can be prepared.For example, can pass through physics fragmentation (for example, stirring or strainer filter), enzymolysis processing, chemical treatment or self-disaggregating treatment etc. and carry out this type of processing.

Use suitable aqueous solvent or organic solvent extraction lactic-acid bacteria cells and/or its handled thing, therefore can obtain extract.Extracting method is not particularly limited, as long as it is to use aqueous solvent or organic solvent as the extracting method that extracts solvent.Yet, the example of these class methods is that currently known methods for example comprises milk-acid bacteria or its handled thing (the other processing by milk-acid bacteria prepares) are immersed in aqueous solvent or the organic solvent (for example, water, methyl alcohol or ethanol) and with its method that stirs or reflux in solvent.

In addition, but drying is processed into lactic-acid bacteria cells and/or its handled thing the form of powdered product (powder) or partical.The specific examples of drying means comprises, but be not limited to spraying drying especially, drum dried, vacuum-drying and freeze-drying, it can be used alone or in combination.When drying, can add normally used vehicle as required.

Milk-acid bacteria of the present invention also can be the bacterial cell that wets or dried bacterial cell.

Can under suitable situation, be used alone or in combination the example of above-mentioned processing.Among the present invention, this type of handled thing can the mode similar to milk-acid bacteria use.

The milk-acid bacteria of above-mentioned acquisition and/or handled thing can be used for producing amino acid and/or peptide from animal milk as composition separately or together with other compositions.Particularly, the invention provides the composition that is used to produce amino acid and/or peptide, it contains at least a milk-acid bacteria that belongs to lactobacterium helveticus.

Composition of the present invention can be produced total free aminoacids more than the 25 μ mol/ml, more than the preferred 30 μ mol/ml by making animal milk fermentation.The preferred total free aminoacids of being produced more than 15% is a branched-chain amino acid.Alternatively or additionally, composition of the present invention can be produced peptide more than the 8.5mg/ml, more than the preferred 10mg/ml by making the animal milk fermentation.Alternatively or additionally, the animal milk fermentation can production be more than the 260 μ g/ml composition of the present invention by making, preferred 280 μ g/ml and more preferably XP peptide more than the 300 μ g/ml and/or XPP peptide.Alternatively or additionally, by making animal milk under the acidity unit of the 30-34 ℃ of fermented-milk that bottom fermentation obtained, composition production of the present invention is counted IPP and VPP peptide more than the 6.0mg/g with the conversion amount of VPP.

Composition of the present invention comprises that above-mentioned milk-acid bacteria and/or its handled thing are as activeconstituents.Particularly, described composition can comprise the combination of the handled thing of 1 type milk-acid bacteria and/or its handled thing, multiple different milk-acid bacteria and/or handled thing or multiple milk-acid bacteria through different treatment.In addition, composition of the present invention preferably includes at least 1 * 10 ⁷Individual lactic-acid bacteria cells/ml.

In addition, composition of the present invention can be supplemented with alone or in combination except that as additive known in the art and vehicle the milk-acid bacteria of activeconstituents, needs only them and does not suppress the purpose effect.Composition of the present invention also can comprise the additive (for example, L-glutamic acid and sugar are as glucose) that promotes lactobacillus-fermented.The form of composition of the present invention is not particularly limited, and its preparation can be become suspension, particle, powder or capsule etc.The content of activeconstituents in the composition of the present invention (milk-acid bacteria) is according to its form difference, as the amount of milk-acid bacteria, usually at 0.0001 quality % to 99 quality %, preferred 0.001 quality % to 80 quality %, more preferably in the scope of 0.001 quality % to 75 quality %.Contain in the composition of the present invention and have an appointment 10 ⁷Individual cell/g is to about 10 ¹²The milk-acid bacteria of individual cell/g.

Milk-acid bacteria of the application of the invention or composition ferment animal milk to obtain to contain the fermented-milk composition of high-purity amino acid and/or peptide.Therefore, the invention provides by using at least a milk-acid bacteria that belongs to lactobacterium helveticus that the animal milk fermentation is obtained and comprising at least a following (a) fermented-milk to the composition of (d):

(a) total free aminoacids of above, the preferred 30 μ mol/ml of 25 μ mol/ml (preferred total free aminoacids be branched-chain amino acid more than 15%);

(b) the above peptide of above, the preferred 10mg/ml of 8.5mg/ml;

(c) total amount be that 260 μ g/ml are above, preferred 280 μ g/ml above, more preferably above XP peptide and/or the XPP peptide of 300 μ g/ml; With

(d) under the acidity unit of fermented-milk, be IPP and VPP peptide more than the 6.0mg/g in conversion amount timing with VPP.

Can use milk-acid bacteria of the present invention or composition to prepare fermented-milk of the present invention by fermentation according to means known in the art.Can in suitable condition it be cultivated then and ferment by at least a milk-acid bacteria being added into animal milk.As animal milk, the breast that can use Mammals source is cow's milk, goat breast and horse breast for example, or modified milk for example skimming milk, reconstituted milk (reconstituted milk) or condensed milk.Particularly, can use 1 type breast maybe can use the combination of polytype breast and modified milk.The solid concentration of breast is not particularly limited.For example, when using skimming milk, there is not the solid concentration of fat breast in the scope of about 3 quality % to 15 quality %, preferred 6 quality % to 15 quality %.Animal milk is sterilized before fermentation.Can will promote the additive (for example, L-glutamic acid or sugar are as glucose) of lactobacillus-fermented to be added into animal milk.Alternatively, separate the milk protein composition, can use this type of milk protein composition to ferment then as substrate from the animal Ruzhong.

As the milk-acid bacteria that is added into animal milk, pre-incubated milk-acid bacteria is preferably used as bottle opener (starter).Equally, the amount of the milk-acid bacteria of interpolation does not limit, and is scaled dried lactic-acid bacteria cells usually in the scope of 0.005 quality % to 10 quality %, preferred 0.05 quality % to 5 quality %.Milk-acid bacteria used herein can be a complete lactic acid bacteria culture, after filtration or the centrifugal milk-acid bacteria that is separated to from substratum, or the refrigerated or the freeze dried milk-acid bacteria that preserve from the substratum after separating.

Fermentation condition is identical with aforesaid cultivation milk-acid bacteria almost.At 20 ℃ to 50 ℃, preferred 25 ℃ to 42 ℃ and more preferably 28 ℃ to 37 ℃ and under anaerobic ferment.In addition, among the embodiment of Miao Shuing, milk-acid bacteria of the present invention produces the branched-chain amino acid and the functional peptide of special a large amount down at 30 ℃ to 34 ℃ (about 32 ℃) after a while.Therefore, ferment under 34 ℃ particularly preferably in 30 ℃.Can use thermostatic bath, sheathing formula well heater or chuck to wait and adjust temperature condition.Fermentation can be left standstill the form that cultivation, shaking culture or slot type cultivate and be carried out.In addition, fermentation time can be in 3 hours to 96 hours and preferred 12 to 36 hours scope.Preferably in fermentor tank, measure pH and acidity and keep pH to ferment at 4.0 to 8.0 o'clock.

Can handle as mentioned above the fermented-milk that obtains or can further handle the handled thing of fermented-milk, as long as it comprises desired composition.The example of this type of processing is below described.

Fermented-milk and/or its handled thing are suspended or be diluted in the appropriate solvent, but therefore prepare suspension or dilute solution.The example of spendable solvent comprises water, physiological saline and phosphate buffered saline buffer (PBS).

With fermented-milk and/or the sterilization of its handled thing, therefore can prepare the sterilization product.Can be by for example filtration sterilization, the radioactivity sterilization of known sterilising method, cross heat sterilization and the pressurization sterilization makes fermented-milk and/or the sterilization of its handled thing.

Fermented-milk and/or its handled thing are heat-treated, therefore can prepare the thermal treatment thing.Carry out pyroprocessing (for example, 80 ℃ to 150 ℃) certain hour for example about 10-60 minute (for example, about 10-20 minute) to prepare this type of thermal treatment thing.

In addition, with fermented-milk and/or its handled thing filtration or centrifugal, therefore can prepare its supernatant liquor (whey).

In addition, make fermented-milk and/or its handled thing dry so that obtain powdered product (powder) or partical.The example of concrete drying means comprises, but be not limited to spraying drying especially, drum dried, vacuum-drying and lyophilize.Can use this type of drying means separately, or these methods of use capable of being combined.At this moment, also can add normally used vehicle as required.

Can under suitable situation, be used alone or in combination the example of above-mentioned processing.The present invention also comprises the handled thing of this type of fermented-milk.

Fermented-milk of the present invention or its handled thing comprise each seed amino acid and/or the peptide of high density, so it can be used for using the application of the characteristic of amino acid and/or peptide.For example, amino acid relates to local flavor, the energy, stable effect and growth-promoting effect etc., and therefore fermented-milk of the present invention can be used as flavor improving agent, nutritious supplementary or energy supplement agent.In addition, the branched-chain amino acid (BCAA) that comprises Xie Ansuan, leucine and isoleucine is indispensable amino acid and can be used for increasing muscular strength or prevent physical fatigue.In addition, think that carrying out decomposition reaction in liver is because the existence of Beta Alanine (Ala).In addition.Known Ala induces the sense of taste (that is, good taste and local flavor) of delicate flavour and has generation Nai Er and Su Naier effect (reducing the effect of the salty and sour sense of taste) and shelter the effect of sharp flavor.It is said that Methionin (Lys) is the amino acid of easy shortage among the indispensable amino acid.Lys should be ingested as for example starting material of antibody, hormone or enzyme etc.Reported that also Lys also participates in calcium absorption, collagen forms and osseous tissue production.For example phosphatidylserine and other amino acid whose precursors are important to Serine (Ser) as various important substance in the body.Also known Ser waits the minimizing that suppresses blood cholesterol levels and brain cell death by neuronic activation in the brain, prevents brain aging thus and is used as the skin moisture-keeping composition.Therefore, fermented-milk of the present invention or its handled thing can be used as flavor improving agent, nutritious supplementary, energy supplement agent, improving brain function agent, autonomic nerve conditioning agent, parasympathetic nerve conditioning agent, sympathetic nerve conditioning agent, sarcolysis and muscle injury inhibitor, muscle toughener, tired light-weight additive, weather resistance activator or pure metabolism agent etc.In addition, described VPP peptide and IPP peptide have the effect that ACE suppresses activity and loosens.Particularly, the LPP peptide has ACE and suppresses active, and the YP peptide has hypotensive activity and angst resistance effect, and VP, IP, AP, EP, RP, QP, TP, MP and GP peptide are biological nondegradable and have ACE and suppress active.Therefore, fermented-milk of the present invention or its handled thing can be used as hypotensor or stress reduction agent.

Use separation known and/or purification process from thus obtained fermented-milk or its each seed amino acid of handled thing purifying and/or peptide component, perhaps contain the fraction of these compositions.

Fermented-milk of the present invention or its handled thing comprise at least a above-mentioned (a) composition (for example, amino acid and peptide) to (d) composition, maybe can comprise the combination of multiple composition.Equally, fermented-milk or its handled thing can comprise the milk-acid bacteria that is used to ferment.

Equally, composition of the present invention is supplemented by additives, other known hypotensor, stress reduction agent, nutritious supplementary, energy supplement agent, muscle toughener or flavor improving agent etc. alone or in combination, as long as described purpose effect is not subjected to suppress.

The formulation of fermented-milk of the present invention comprises, but the tablet, capsule, granule, powder, pulvis, syrup and the dry syrup that are not particularly limited to suspension agent (the complete fermented-milk that the fermentation back obtains) and also obtain by technical finesse known in the art.Described fermented-milk preferably is convenient to the formulation of dosage forms for oral administration or picked-up.In addition, liquid preparation for example suspension agent before using or absorbing, can be suspended in immediately in water or the other suitable media.When described fermented-milk forms tablet or granule, can pass through currently known methods dressing from the teeth outwards.

Can for example vehicle, disintegrating agent, binding agent, wetting agent, stablizer, buffer reagent, lubricant, sanitas, tensio-active agent, sweeting agent, flavour agent (flavoring agent), perfume compound, souring agent and tinting material be produced the fermented-milk of above-mentioned formulation by mixing normally used additive according to conventional methods.For example, be used under medicine or the sanatory situation, pharmacological-acceptable carrier or additive can be incorporated in the fermented-milk that is obtained by fermentation at described fermented-milk.The example of this type of pharmacological-acceptable carrier and additive comprises water, pharmacology can be accepted organic solvent, collagen, polyvinyl alcohol, Polyvinylpyrolidone (PVP), carboxyvinyl polymer (carboxyvinyl polymer), sodium alginate, water-soluble dextran, water-soluble dextrin, sodium starch glycolate, pectin, xanthan gum, gum arabic, casein, gelatin, agar, glycerine, propylene glycol, polyoxyethylene glycol, Vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin, N.F,USP MANNITOL, sorbyl alcohol, lactose and acceptable tensio-active agent as the pharmacology additive.

In addition, fermented-milk of the present invention can further comprise multiple additive and other the various materials that are used to produce medicine, diet product or feed.The example of this type of material and additive (for example comprises multiple grease, vegetables oil is soya-bean oil for example, Semen Maydis oil, Thistle oil and sweet oil, with animal grease for example tallow or sardine oil), herbal medicine (for example, royal jelly and genseng (ginseng)), amino acid (for example, glutamine, halfcystine, leucine and arginine), polyvalent alcohol (for example, ethylene glycol, polyoxyethylene glycol, propylene glycol, glycerine and sugar alcohol be Sorbitol Powder for example, tetrahydroxybutane, Xylitol, maltose alcohol and N.F,USP MANNITOL), natural polymer (for example, gum arabic, agar, water-soluble zein fiber, gelatin, xanthan gum, casein, gluten or gluten hydrolyzate, Yelkin TTS, starch and dextrin), VITAMIN (for example, vitamins C and vitamin B complex), mineral substance (for example, calcium, magnesium, zinc and iron), food fibre (for example, mannosans, pectin and hemicellulose), tensio-active agent (for example, the glyceryl ester of lipid acid and the sorbitan ester of lipid acid), pure water, vehicle (for example, glucose, W-Gum, lactose and dextrin), stablizer, the pH regulator agent, antioxidant, sweeting agent, flavour agent, souring agent, tinting material and perfume compound.

In addition, except that above-mentioned activeconstituents, functional ingredient or additive can be incorporated in the fermented-milk of the present invention.The example comprises taurine; gsh; carnitine; creatine; ubiquinone; glucuronic acid; glucuronolactone; Fructus Capsici extract; Rhizoma Zingiberis Recens extract; cocoa extract; the Guarana extract; the garcinia plant milk extract; theanine; γ-An Jidingsuan; capsaicine; capsaicine ester (capsiate); various organic acids; flavonoid; polyphenol; catechin; xanthine derivative; heavy oligosaccharides such as oligofructose (fructooligosaccharide) and polyvinylpyrrolidone.The incorporation of examples of such additives can suitably be determined according to the type of additive and desired intake.

The experimenter who uses or absorb fermented-milk of the present invention can be vertebrates.Its specific examples comprises Mammals for example people, primates (for example, monkey and chimpanzee), livestock animals (for example, ox, horse, pig, sheep and bird), pet animals (for example, dog and cat) and laboratory animal (for example, mouse and rat).In addition, this type of experimenter can be reptile and birds.The experimenter of preferred especially those expectation picked-up amino acid and/or peptide, for example hyperpietic, people and the people before and after the motion with pressure induced symptom (stress-induced symptoms).

Fermented-milk of the present invention use or absorb dosage according to age of experimenter with body weight, the number of times of using/the picked-up approach, use/absorb dosage with use purpose etc. and different, and can extensively change by the free tailoring of those skilled in the art to reach desired effect.The content of activeconstituents is not particularly limited in the fermented-milk, and can according to the degree that for example is easy to produce and preferred every day dosage and suitably adjusting.Fermented-milk of the present invention is foolproof, and therefore also can increase picked-up dosage.Every day, dosage can absorb by dose, maybe it can be divided into multidose and absorb.In addition, the frequency of using or absorbing is not particularly limited, and can for example use according to various conditions/the picked-up approach, age of experimenter and body weight and desired effect and suitably select.

The using of fermented-milk of the present invention/picked-up approach is not particularly limited, and preferred dosage forms for oral administration or oral uptake.For example, be incorporated into fermented-milk in diet product or the feed or make tablet or granule etc., but and therefore dosage forms for oral administration or picked-up.

Fermented-milk of the present invention can be used in combination with other medicine, methods of treatment or prevention method etc.These type of other medicine and fermented-milk of the present invention can be made unitary agent.Alternatively, they can be made independent preparation so that use simultaneously or at interval.

As mentioned above, fermented-milk of the present invention can be used as hypotensor, improving brain function agent, autonomic nerve conditioning agent, parasympathetic nerve conditioning agent, sympathetic nerve conditioning agent, nutritious supplementary, energy supplement agent, sarcolysis and muscle injury inhibitor, muscle toughener, tired light-weight additive, weather resistance activator, flavor improving agent or pure metabolism agent etc.

Milk-acid bacteria of the present invention and fermented-milk are foolproof, and therefore are used for the long-term picked-up that continues easily.Therefore, milk-acid bacteria of the present invention and fermented-milk also can be used for diet product and feed.Milk-acid bacteria of the present invention produces a large amount of amino acid with various functions and/or peptide.In addition, fermented-milk of the present invention comprises this amino acid and/or the peptide of high density.In addition, milk-acid bacteria of the present invention demonstrates the output height of functional peptide with respect to acidity, can suppress tart flavour, even and also do not suppress the local flavor of diet product self when being added into various diet product.Therefore, milk-acid bacteria of the present invention and fermented-milk are added into various diet product, sustainable picked-up, and so various effects of desired display.

Therefore, diet product of the present invention comprise at least a milk-acid bacteria of the present invention and/or its handled thing and/or fermented-milk of the present invention and/or its handled thing.Among the present invention, the example of diet product of the present invention also comprises beverage (beverages).Except that sanatory health food and drink, functional diet product and the diet product by means of the special health caring use of amino acid and/or peptide, the example of diet product of the present invention comprises all diet product that milk-acid bacteria of the present invention and fermented-milk can be mixed wherein.

Functional diet product are especially preferably as diet product of the present invention.Term of the present invention " functional diet product " is meant the diet product that organism had predetermined function, and comprise, for example so-called general health food and drink (for example, the diet product that comprise special health caring use (comprise that qualified FOSHU[promptly, special health caring use food]) the diet product with Health Claims and have the diet product of trophic function statement), the diet product of special diet purposes, nutritious supplementary, healthy supplement, supplement (for example, have multiple formulation such as tablet, coated tablet, sugar coated tablet, those of capsule and liquor) and the beauty treatment diet product (for example, weight-reducing diet product).

The specific examples of diet product comprises health diet product and the nutritious supplementary of formulation for for example liquid diet (for example, pipe enteral nutritional supplements), tablet candy, tablet, chewable tablet, tablet, pulvis, powder, capsule, granule and tonic beverage etc.; Tea drink is green tea, oolong tea and black tea for example; Drink (drinks) or beverage for example soft drink, jelly beverage, etc. (for example ooze beverage, milky-drinks, soda pop, vegetable drink, nectar, fermented vegetables beverage, fermented fruit juice drink, leben, fermented-milk, drink sour milk and solid sour milk), leben (sterilized), lactobacillus drink, enriched drink, concentrate solid substance, milky-drinks (for example, coffee breast), contain beverage, cocoa drink, breast and the pure water of coffee beverage powder; Smear seasonings (spreads) for example butter, jam, dried seasonings and oleomargarine; Mayonnaise; Shortening (shortening); Custard cream; Dressings (dressings); Bread; Rice; Noodles; Spaghetti; Flavor increases soup; Bean curd; Sour milk; Soup or soy sauce; And sweet food (for example, biscuit and cookies, chocolate, candy, cake, ice-creams, chewing gum and sugar-tablet).

Can be by (for example mixing other foodstuff raw materials, various nutrition, various VITAMIN, mineral substance, food fibre and various additive that being used to except that milk-acid bacteria of the present invention and/or fermented-milk produce above-mentioned diet product, taste composition (taste components), sweeting agent, souring agent be organic acid, stablizer and spices for example), produce diet product of the present invention according to conventional methods.

For diet product of the present invention, the incorporation that those skilled in the art can suitably determine milk-acid bacteria, fermented-milk or its handled thing in view of the form of diet product and required taste or mouthfeel.Consume diet product of the present invention by the form of managing the expectation intake of diet product of the present invention with permission, for example, can provide the described diet product of use to bring high blood pressure down, to eliminate pressure, nutritional support, energy supplement, strengthen muscle, the brain function of improving, regulate autonomic nerve, regulate parasympathetic nerve, regulate sympathetic nerve, suppress sarcolysis and damage, strengthen muscle, to lessen fatigue, improve weather resistance or pure metabolic method.

Can produce diet product of the present invention by the proper method that can get arbitrarily by those skilled in the art.For example, milk-acid bacteria of the present invention and/or fermented-milk (handled thing) can mix them in diet product then with aqueous, gel, solid state, Powdered or granular preparation.Alternatively, milk-acid bacteria of the present invention and/or fermented-milk (handled thing) can directly mix or be dissolved in the starting material of diet product.Milk-acid bacteria of the present invention and/or fermented-milk (handled thing) can be applied to, dressing to, immerse or be sprayed in the diet product.Milk-acid bacteria of the present invention and/or fermented-milk (handled thing) but homodisperse or be non-uniformly distributed in the diet product.Can prepare the capsule that contains milk-acid bacteria of the present invention and/or fermented-milk (handled thing).Edible film or food coating agent etc. can be wrapped in milk-acid bacteria of the present invention and/or fermented-milk (handled thing) around.Alternatively, can be after adding appropriate excipients etc. milk-acid bacteria of the present invention and/or fermented-milk (handled thing) for example be prepared into forms such as tablet.Can further process diet product of the present invention.These type of processed products are also included within the scope of the present invention.

In the production of diet product of the present invention, can adopt multiple routine to be used for the additive of diet product.The example of additive comprises, but be not limited to, chromogenic reagent (for example, Sodium Nitrite), tinting material (for example, gardenin and Red102), spices (for example, orange flavor spices), sweeting agent (for example, sweet Stevia and aspartame), sanitas (for example, sodium acetate and Sorbic Acid), emulsifying agent (for example, sodium chondroitin sulfate and fatty acid propylene glycol ester), antioxidant (for example, EDTA disodium and vitamins C), the pH regulator agent (for example, citric acid), chemical seasoning (for example, Sodium Inosinate), thickening material (for example, xanthan gum), swelling agent (for example, lime carbonate), defoamer (for example, calcium phosphate), binding agent (for example, sodium polyphosphate), nutrition-fortifying agent (nutrition-enriching agent) (for example, Creta Preparata and vitamin A) and vehicle (for example, water-soluble dextrin).Can further add functional raw material for example genseng (Panax ginseng) extract, Radix Et Caulis Acanthopanacis Senticosi (Acanthopanax senticosus) extract, eucalyptus extracts or bark of eucommia tea extract.

As mentioned above, diet product of the present invention have the various functions that caused by amino acid and/or peptide and fool proof, but need not to consider side effect.In addition, milk-acid bacteria of the present invention and/or fermented-milk can suppress acidity, have good local flavor, and do not suppress to drink flavours in food products when being added into various diet product.The diet product that obtained can easily be used for the long-term picked-up that continues to expect to bring into play for a long time various functions.

In addition, milk-acid bacteria of the present invention and/or fermented-milk not only can be incorporated into human with in the diet product, and for example domestic animal (for example, ox and pig), horse racing and pet (for example, dog and cat) are used in the feed but also can be incorporated into animal.Feed is equivalent to the diet product basically except giving the non-human experimenter.Therefore, the above description of diet product can be done necessary correction and be applicable to feed.

Embodiment

Below, with reference to the present invention of the following example more detailed description, but the invention is not restricted to described embodiment.

The evaluation of [embodiment 1] lactobacterium helveticus CP3232 bacterial strain

Cultivate lactobacterium helveticus CM4 bacterial strain (accession number FERM BP-6060).To show new lactobacterium helveticus CP3232 bacterial strain from the mutant strain that is derived from described CM4 bacterial strain as characteristic as described in the embodiment 2 to 5.

With described lactobacterium helveticus CP3232 bacterial strain under 37 ℃ in the MRS nutrient agar anaerobism cultivated 24 hours, check observed characteristic and its physiological property etc. on the morphology of gained bacterium colony then.In addition, measure 16S rRNA sequence and also confirm to have 99.9% homology with other lactobacterium helveticus bacterial strain (type strain).Therefore, disclosing thus obtained bacterial strain belongs to lactobacterium helveticus clearly and is new bacterial strain.

The preparation of [embodiment 2] fermented-milk

By temperature being increased to 95 ℃, the recovery skim-milk sterilization with 9.00% (w/w) is cooled to 15 ℃ then.Gains are as newborn substratum.The fermented-milk that will contain milk-acid bacteria (5%) is added in this breast substratum and (is used for inoculation), then cultivates 24 hours at 37 ℃.Repeat this step, then thus obtained fermented-milk is used as bottle opener.This bottle opener (3%) is added into newborn substratum, cultivated 24 hours down at 32 ℃ or 37 ℃ then.Measure the pH and the acidity of this fermented-milk.(Hiranuma Sangyo Co. Ltd.) measures acidity to use flat natural pond (Hiranuma) automatic titrator COMTITE-450.Use as the lactobacterium helveticus CP3232 bacterial strain of milk-acid bacteria and contrast with lactobacterium helveticus CP3264 bacterial strain (separating the hypertension medicine that gets from commercially available), lactobacterium helveticus CM4 bacterial strain (accession number FERM BP-6060), lactobacterium helveticus CP1092 bacterial strain, lactobacterium helveticus CP1100 bacterial strain, lactobacterium helveticus CP1081 bacterial strain and lactobacterium helveticus CPN4 bacterial strain (JP publication (Te Kaiping) H7-123977A (1995)).

The results are shown in table 1.Because it is 1.7 times of VPP that the ACE of unit weight IPP suppresses activity, so calculate the amount of IPP and VPP according to the conversion amount of VPP by following formula:

The amount (μ g/ml) of amount (μ g/ml) * 1.7+VPP of VPP conversion amount (μ g/ml)=IPP

In addition, term " acidity " is meant the concentration of the acid (lactic acid) that contains in the fermented-milk.As shown in table 1, by milk fermentation being obtained under the situation of fermented-milk with lactobacterium helveticus CP3232 bacterial strain, (that is, described acidity the amount of) IPP and VPP peptide is 6.2mg/g in the conversion amount timing with VPP, shows the peptide amount height with respect to acidity with respect to the amount of institute's lactic acid producing.Calculate with 1.02 proportions as fermented-milk.

[table 1]

The amount of LTP under the acidity unit (IPP and VPP) (VPP conversion amount)

The mensuration of total free aminoacids in [embodiment 3] fermented-milk supernatant liquor

The fermented-milk that obtains among the embodiment 2 was carried out under 10000g centrifugal 10 minutes.Suitably dilute supernatant liquor with distilled water, filter this solution, use amino acid automatic analyzer (C-R7A/LC-10A) to measure then by high performance liquid chromatography (HPLC, Shimadzu Corporation) with 0.2 μ M membrane filter.Following descriptive analysis condition.

Post: Shim-pack Amino-Li (100mmL * 6.0mmI.D.)

Catch ammonia post (Ammonia trap): Shim-pack ISC-30Li (50mmL * 4.0mmI.D.)

Column temperature: 38 ℃ to 58 ℃

Temperature of reaction: 65 ℃

Moving phase: amino acid analysis Tianjin, island (Shimadzu) moving phase test kit, that is, and the Li type

Reaction soln: amino acid analysis Tianjin, island reaction soln test kit, that is, and OPA reagent

Flow: 0.4ml/min.

Add clorox to reaction soln to detect proline(Pro).With fluorescence spectrophotometer detector (Ex:348nm; Em:450nm) measure amino acid whose fluorescence developing final and the Phthalyldicarboxaldehyde reaction.Standard amino acid mixture (H type) with each seed amino acid concentration known calculates amino acid whose content then as standard model.

The results are shown in Fig. 1 and Fig. 2.Figure 1A illustrates to measure and is included in by specified lactic bacterium strains makes the result of each amino acid whose amount (nmol/ml) in the supernatant liquor of the fermented-milk that milk fermentation obtained in 24 hours with each down at 32 ℃.Figure 1B illustrates by mensuration and is included in by down specified lactic bacterium strains makes the result that each amino acid whose amount (nmol/ml) obtains in the supernatant liquor of the fermented-milk that milk fermentation obtained in 24 hours with each at 37 ℃.Fig. 2 A illustrates and is included in by specified lactic bacterium strains makes the total amount (μ mol/ml) of total free aminoacids in the supernatant liquor of the fermented-milk that milk fermentation obtained in 24 hours with each down 32 ℃ or 37 ℃.Fig. 2 B illustrates and is included in by specified lactic bacterium strains makes the amount (μ mol/ml) of branched-chain amino acid in the supernatant liquor of the fermented-milk that milk fermentation obtained in 24 hours with each down 32 ℃ or 37 ℃.These results show that lactobacterium helveticus CP3232 bacterial strain has the high protein hydrolytic activity and passes through 24 hours above total free aminoacidss of fermentative production 25mol/ml.Especially, lactobacterium helveticus CP3232 bacterial strain is produced the total free aminoacids of 29.9 μ mol/ml by make milk fermentation under 37 ℃, and same bacterial strain is produced the total free aminoacids of 33.1 μ mol/ml (Fig. 2 A) by make milk fermentation under 32 ℃.Also show, the content height of branched-chain amino acid in the total free aminoacids of being produced, and the whole total free aminoacidss by 24 hours fermentative production is branched-chain amino acid more than 15%.Particularly, branched-chain amino acid accounts for 19.4% of whole total free aminoacidss under the situation of 37 ℃ of fermentations, and branched-chain amino acid accounts for 21.5% (Fig. 2 B) of whole total free aminoacidss under the situation of 32 ℃ of fermentations.

The amount (OPA method) of peptide in [embodiment 4] fermented-milk supernatant liquor

Measure the amount of peptide in the fermented-milk supernatant liquor that obtains among the embodiment 2 according to people's such as Church method (J.Dairy Sci.1983.66:1219-1227).In brief, the 100mM sodium tetraborate solution of 25ml, the 20%SDS of 2.5ml and the 2 mercapto ethanol of 0.1ml are mixed.To be added into this mixture by the 1ml solution that the dissolving Phthalyldicarboxaldehyde prepares in methyl alcohol (4 weight %), with distilled water this solution finally will be adjusted to 50ml then, prepare OPA reagent thus.The fermented-milk that obtains among the embodiment 2 10, is carried out centrifugal 10 minutes, and the culture supernatants that is obtained is suitably diluted, so that the preparation analytic sample under the 000g.OPA reagent (200 μ l) and analytic sample (10 μ l) are mixed.After fully stirring, mixture was left standstill 5 minutes in room temperature, be determined at the absorption under the 340nm then.Bacto-tryptone (bacto-tryptone) is used as reference material.

The results are shown in Fig. 3.Show that by the result lactobacterium helveticus CP3232 bacterial strain has the high protein hydrolytic activity and passes through a large amount of peptide of fermentative production.Particularly, lactobacterium helveticus CP3232 bacterial strain by the above peptide of 24 hours fermentative production 8.5mg/ml, by producing 11.1mg/ml at 32 ℃ of bottom fermentations peptide and by produce the peptide (Fig. 3) of 9.6mg/ml at 37 ℃ of bottom fermentations.

[embodiment 5] functional peptide quantitatively

The fermented-milk that obtains among the embodiment 2 10, is carried out centrifugal 10 minutes, and with distilled water supernatant liquor suitably diluted under the 000g, before LC/MS analyzes, filter then with 0.2 μ M membrane filter.Method by people such as Inoue (J.Biosci.Bioeng., 2009,108,111-115) carry out LC/MS and analyze.Particularly, (Nomura Chemical Co. Ltd.) analyzes as separator column to use LCMS-2010A system (Shimadzu Corporation) and RP-aqueous post.Use synthetic peptide to calculate content as standard model.Synthetic peptide used herein be ( ¹³C ₅) Val-( ¹³C ₅) Pro-Pro, Ile-( ¹³C ₅) Pro-Pro, Glu-Pro and Gln-Pro (available from Scrum Inc.) and Leu-Pro-Pro, Tyr-Pro, Val-Pro, Ile-Pro, Ala-Pro, Arg-Pro, Thr-Pro, Met-Pro and Gly-Pro (available from Bachem).

The results are shown in Fig. 4 and Fig. 5.Result shown in Fig. 4 A and Fig. 4 B discloses lactobacterium helveticus CP3232 bacterial strain to be had the high protein hydrolytic activity and passes through 24 hours various functional peptides of fermentative production.Be reported among the functional peptide listed among Fig. 4, VPP and IPP have ACE and suppress activity and relaxation effect, LPP has ACE and suppresses active, YP has hypotensive activity and angst resistance effect, and VP, IP, AP, EP, RP, QP, TP, MP and GP are for biological nondegradable and have ACE and suppress active.A large amount of VPP, IPP, YP, QP and the TP of the special production of lactobacterium helveticus CP3232 bacterial strain.

The result further discloses shown in Fig. 5 A and Fig. 5 B, and lactobacterium helveticus CP3232 bacterial strain has the high protein hydrolytic activity and is functional peptide (XP+XPP) more than the 260 μ g/ml by 24 hours fermentative production total amounts.Especially, the lactobacterium helveticus CP3232 bacterial strain functional peptide (Fig. 5 A) by producing 318 μ mol/ml at 32 ℃ of bottom fermentations and by produce the functional peptide (Fig. 5 B) of 282 μ mol/ml at 37 ℃ of bottom fermentations respectively.

The preparation of [embodiment 6] fermented-milk and the mensuration of peptide amount

Use cultivate with lactobacterium helveticus CM4 bacterial strain (accession number FERM BP-6060) with lactobacterium helveticus CNCM I-3435 bacterial strain (patent documentation 4), lactobacterium helveticus FERM BP-5445 bacterial strain (patent documentation 7) as the lactobacterium helveticus CP3232 bacterial strain of milk-acid bacteria and contrast after, measure pH and acidity and the IPP peptide of producing thus and the amount of VPP peptide of fermented-milk in the mode similar to embodiment 2.

The results are shown in table 2.With to embodiment 2 in similar mode ecbatic: promptly, the amount of IPP and VPP is represented with VPP conversion amount.Term " acidity " is meant the concentration of the acid (lactic acid) that contains in the fermented-milk.As shown in table 2, by obtaining under the situation of fermented-milk with lactobacterium helveticus CP3232 strain fermentation, (that is, acidity the amount of) IPP and VPP peptide is 7.0mg/g in the conversion amount timing with VPP, shows the peptide amount height under the acidity unit with respect to institute's lactic acid producing.Calculate with 1.02 proportions as fermented-milk.

[table 2]

The amount of LTP under the acidity unit (IPP and VPP) (VPP conversion amount)

The mensuration of the total free aminoacids in [embodiment 7] fermented-milk supernatant liquor

Use the fermented-milk that obtains among the embodiment 6 with to embodiment 3 in similar mode measure total free aminoacids.The results are shown in Fig. 6 and Fig. 7.

Fig. 6 A illustrates and is included in by down specified lactic bacterium strains makes each amino acid whose amount (nmol/ml) in the supernatant liquor of the fermented-milk that milk fermentation obtained in 24 hours with each at 32 ℃.Fig. 6 B illustrates and is included in by down specified lactic bacterium strains makes each amino acid whose amount (nmol/ml) in the supernatant liquor of the fermented-milk that milk fermentation obtained in 24 hours with each at 37 ℃.Equally, Fig. 7 A illustrates and is included in by specified lactic bacterium strains makes the total amount (μ mol/ml) of total free aminoacids in the supernatant liquor of the fermented-milk that milk fermentation obtained in 24 hours with each down 32 ℃ or 37 ℃.Fig. 7 B illustrates and is included in by specified lactic bacterium strains makes the amount (μ mol/ml) of branched-chain amino acid in the supernatant liquor of the fermented-milk that milk fermentation obtained in 24 hours with each down 32 ℃ or 37 ℃.These results show that lactobacterium helveticus CP3232 bacterial strain has the high protein hydrolytic activity, and by 24 hours above total free aminoacidss of fermentative production 25mol/ml.Especially, lactobacterium helveticus CP3232 bacterial strain is by producing the total free aminoacids of 28.1 μ mol/ml at 37 ℃ of bottom fermentations, and by produce the total free aminoacids (Fig. 7 A) of 32.4 μ mol/ml at 32 ℃ of bottom fermentations.The content height that also shows branched-chain amino acid in the total free aminoacids of producing thus, and branched-chain amino acid accounts for more than 15% of total free aminoacids by 24 hours fermentative production.Particularly, branched-chain amino acid accounts for 20% of total free aminoacids under the situation of 37 ℃ of fermentations.Branched-chain amino acid accounts for 21% (Fig. 7 B) of total free aminoacids under the situation of 32 ℃ of fermentations.

The amount (OPA method) of peptide in [embodiment 8] fermented-milk supernatant liquor

With to embodiment 4 in similar mode measure the amount of peptide in the fermented-milk supernatant liquor that obtains among the embodiment 6.The results are shown in Fig. 8.The result shows that lactobacterium helveticus CP3232 bacterial strain has the high protein hydrolytic activity and passes through a large amount of peptide of fermentative production.Particularly, lactobacterium helveticus CP3232 bacterial strain is by the above peptide of 24 hours fermentative production 8.5mg/ml, by produce the peptide of 10.4mg/ml and the peptide (Fig. 8) of producing 9.1mg/ml at 37 ℃ of bottom fermentations at 32 ℃ of bottom fermentations.

[embodiment 9] functional peptide quantitatively

With to embodiment 5 in similar mode analyze the fermented-milk that obtains among the embodiment 6, the amount of measurement function peptide then by LC/MS.Fig. 9 and Figure 10 show the result.Result shown in Fig. 9 A and Fig. 9 B discloses, and lactobacterium helveticus CP3232 bacterial strain has the high protein hydrolytic activity and passes through 24 hours various functional peptides of fermentative production.Especially, a large amount of VPP, IPP, YP, QP and the TP of the special production of lactobacterium helveticus CP3232 bacterial strain.

In addition, show that lactobacterium helveticus CP3232 bacterial strain has the proteolysis activity of height and passes through 24 hours above (total amount) functional peptides (XP+XPP) of fermentative production 260 μ g/ml by result shown in Figure 10 A and Figure 10 B.Especially, lactobacterium helveticus CP3232 bacterial strain by producing 280 μ mol/ml at 32 ℃ of bottom fermentations functional peptide (Figure 10 A) and by produce the functional peptide (Figure 10 B) of 295 μ mol/ml at 37 ℃ of bottom fermentations.

The authentication method of [reference example 1] lactobacterium helveticus CP3232 bacterial strain and mutant strain thereof

By making up with evaluation via the mensuration of the method for describing among the embodiment 2-9 by polymerase chain reaction (PCR) method, can be easily with milk-acid bacteria, that is, lactobacterium helveticus CP3232 bacterial strain and the mutant strain thereof that obtains among the embodiment 1 is different from other lactic bacterium strains.In addition, can determine that easily whether bacterial strain is the mutant strain as the lactobacterium helveticus CM4 bacterial strain of the parental plant of lactobacterium helveticus CP3232 bacterial strain by the PCR method.

Below simple an embodiment described.Can by preparation DNA sample, use following primer by the PCR method carry out gene amplification, with 0.9% sepharose carry out electrophoresis, the analytical electrophoresis collection of illustrative plates determines whether the purpose lactic bacterium strains is the mutant strain of lactobacterium helveticus CP3232 bacterial strain or the mutant strain of lactobacterium helveticus CM4 bacterial strain then.

Primer:

Agccacttcctccgattacag (SEQ ID NO:1); With

gctattttagcagcgattcg(SEQ?ID?NO:2)。

Among this embodiment, use multiple lactobacterium helveticus bacterial strain to carry out above-mentioned PCR method.Figure 11 shows the result.Each swimming lane is as follows among Figure 11.

Swimming lane 1: lactobacterium helveticus CP3232 bacterial strain

Swimming lane 2: lactobacterium helveticus CM4 bacterial strain

Swimming lane 3: lactobacterium helveticus CP3231 bacterial strain

Swimming lane 4: lactobacterium helveticus CP3264 bacterial strain

Swimming lane 5; Lactobacterium helveticus CP1081 bacterial strain

Swimming lane 6; Lactobacterium helveticus CP209 bacterial strain

Swimming lane 7; Lactobacterium helveticus CP210 bacterial strain

Swimming lane 8; Lactobacterium helveticus CP293 bacterial strain

Swimming lane 9: lactobacterium helveticus CP617 bacterial strain

Swimming lane 10: lactobacterium helveticus CP39 bacterial strain

Swimming lane 11: lactobacterium helveticus CP790 bacterial strain

Swimming lane 12: lactobacillus helveticus strain jcm 1120 bacterial strains

M: the restriction enzyme Hind III digestion product of lambda bacteriophage dna.

As shown in figure 11, observe the characteristic DNA fragment of CM4 mutant strain (lactobacterium helveticus CP3232 bacterial strain and CP3231 bacterial strain) and parental plant CM4 bacterial strain (swimming lane 1 to 3).But do not observe other fragments except the lactobacterium helveticus bacterial strain.The restriction enzyme Hind III digestion product of lambda bacteriophage dna as dna marker (DNA marker) electrophoresis simultaneously, is determined that then the segmental molecular weight of characteristic DNA is about 2.2kb.

In addition, following evaluation lactobacterium helveticus CP3232 bacterial strain and CP3231 bacterial strain, and parental plant CM4 bacterial strain.As described in

embodiment

4 and 8, also can select lactobacterium helveticus CP3232 bacterial strain by the amount of using peptide in the OPA reagent analysis fermented-milk.Particularly, it is as follows to use OPA reagent to measure according to the amount of peptide in the fermented-milk of embodiment 2 preparations.Yet lactobacterium helveticus CP3231 bacterial strain and CM4 bacterial strain are produced the peptide of 7.5mg/ml and 4.5mg/ml respectively, and the production of lactobacterium helveticus CP3232 bacterial strain reaches the peptide of 11.1mg/ml, and therefore can easily be different from other bacterial strains.

The discrimination method of [reference example 2] lactobacterium helveticus CP3232 bacterial strain and mutant strain thereof

With to reference example 1 in similar mode, whether the milk-acid bacteria, lactobacterium helveticus CP3232 bacterial strain and the mutant strain thereof that obtain in the test implementation example 1 can be different from other lactic bacterium strains (lactobacterium helveticus CNCM I-3435 bacterial strain (patent documentation 4) and lactobacterium helveticus FERM BP-5445 bacterial strain (patent documentation 7)) by carrying out polymerase chain reaction (PCR) method.

Figure 12 illustrates the result who uses primer to carry out gene amplification by the PCR method and carry out electricity ice.Among Figure 12, each swimming lane is as follows:

Swimming lane 1: lactobacterium helveticus CP3232 bacterial strain

Swimming lane 2: lactobacterium helveticus CM4 bacterial strain

Swimming lane 3: lactobacterium helveticus CNCM I-3435 bacterial strain

Swimming lane 4: lactobacterium helveticus FERM BP-5445 bacterial strain

As shown in figure 12, observe the characteristic DNA fragment of lactobacterium helveticus CP3232 bacterial strain (CM4 mutant strain) and parental plant CM4 bacterial strain (swimming lane 1 to 2), but do not observe other fragments except the lactobacterium helveticus bacterial strain.

The full content of all publications, patent and patent application that this paper quoted is incorporated herein with for referencial use.

Utilizability on the industry

According to the present invention, provide to have high protein hydrolytic activity and the good peptide throughput and/or the milk-acid bacteria that belongs to lactobacterium helveticus of amino acid throughput.Amino acid and/or the peptide produced by described milk-acid bacteria have various functions.For example, peptide such as IPP, VPP and YP have hypotensive activity.In addition, by means of described lactobacillus-fermented, can obtain to contain each seed amino acid of high density and/or the fermented-milk of peptide and excellent flavor with these type of various functions.Therefore, the present invention is useful in fields such as medicine, diet product and health-promotings.

Accession number

Accession number: FERM BP-11271 (Lactobacillus Helveticus CP3232 bacterial strain was in preservation on August 4 in 2010)

Accession number: FERM BP-6060 (Lactobacillus Helveticus CM4 bacterial strain was in preservation on August 15 in 1997)

The free text of sequence table

SEQ ID NOS:1 and 2:DNA (synthetic oligonucleotide)

Claims

1. milk-acid bacteria that belongs to lactobacterium helveticus, it has following (a) at least a to (d) characteristic:

2. milk-acid bacteria according to claim 1, wherein the described total free aminoacids more than 15% is a branched-chain amino acid.

3. milk-acid bacteria according to claim 1 and 2, it produces the YP peptide with the amount more than the 60 μ g/ml.

4. according to each described milk-acid bacteria of claim 1 to 3, it is the mutant strain of lactobacterium helveticus CM4 bacterial strain (accession number FERM BP-6060).

5. according to each described milk-acid bacteria of claim 1 to 4, it is lactobacterium helveticus CP3232 bacterial strain (accession number FERM BP-11271) or its mutant strain.

6. a lactobacterium helveticus CP3232 bacterial strain (accession number FERM BP-11271).

7. composition that is used for being produced by animal milk amino acid and/or peptide, it comprises at least a milk-acid bacteria that belongs to lactobacterium helveticus.

8. composition according to claim 7, it is by making the total free aminoacids more than the animal milk fermentative production 25 μ mol/ml.

9. composition according to claim 8, wherein said total free aminoacids be branched-chain amino acid more than 15%.

10. according to each described composition of claim 7 to 9, it produces peptide by making the animal milk fermentation with the amount more than the 8.5mg/ml.

11. according to each described composition of claim 7 to 10, it is XP peptide and/or an XPP peptide more than the 260 μ g/ml by making animal milk fermentative production total amount.

12. according to each described composition of claim 7 to 11, it produces the YP peptide by making the animal milk fermentation with the amount more than the 60 μ g/ml.

13. according to each described composition of claim 7 to 12, by making animal milk under the acidity unit of the 30-34 ℃ of fermented-milk that bottom fermentation obtained, it is produced with the conversion amount of VPP and counts IPP and VPP peptide more than the 6.0mg/g.

14. according to each described composition of claim 7 to 13, wherein said milk-acid bacteria is each described milk-acid bacteria of claim 1 to 6.

15. a fermented-milk, it is by making the animal milk fermentation and obtain and comprising following (a) at least a to (d) composition with at least a milk-acid bacteria that belongs to lactobacterium helveticus:

(a) the above total free aminoacids of 25 μ mol/ml;

(b) the above peptide of 8.5mg/ml;

(c) add up to 260 μ g/ml above XP peptide and/or XPP peptide; With

16. fermented-milk according to claim 15, it comprises at least a milk-acid bacteria that belongs to lactobacterium helveticus.

17. according to claim 15 or 16 described fermented-milks, it comprises each described at least a milk-acid bacteria of claim 1 to 6.

18. according to each described fermented-milk of claim 15 to 17, wherein said total free aminoacids be branched-chain amino acid more than 15%.

19. according to each described fermented-milk of claim 15 to 18, it comprises the YP peptide that 60 μ g/ml are above.

20., wherein under 30-34 ℃ temperature, carry out described fermentation according to each described fermented-milk of claim 15 to 19.

21. according to each described fermented-milk of claim 15 to 20, it is used for hypotensor, improving brain function agent, autonomic nerve conditioning agent, parasympathetic nerve conditioning agent, sympathetic nerve conditioning agent, nutritious supplementary, energy supplement agent, sarcolysis and muscle injury inhibitor, muscle toughener, tired light-weight additive, weather resistance activator, flavor improving agent or pure metabolism agent.

22. diet product, it comprises each described at least a milk-acid bacteria of claim 1 to 6 and/or its handled thing and/or each described fermented-milk of claim 15 to 21 and/or its handled thing.

23. the production method of a seed amino acid and/or peptide, it comprises that use each described at least a milk-acid bacteria of claim 1 to 6 or each described composition of claim 7 to 14 make animal milk or milk protein fermentation, collect amino acid and/or peptide then from the tunning that is obtained.

24. method according to claim 23, wherein said amino acid are branched-chain amino acid.

25. according to claim 23 or 24 described methods, wherein said peptide is at least a peptide that is selected from the group of being made up of XP peptide and/or XPP peptide.

26., wherein under 30-34 ℃ temperature, carry out described fermentation according to each described method of claim 23 to 25.