CN103173544B - Mitochondrial T3866C detection kit of Leber disease, and application thereof - Google Patents

Abstract

The invention provides a mitochondrial T3866C detection kit of Leber disease, and an application thereof. The detection kit is composed of a DNA extraction mixed solution, a PCR mixed solution used for amplifying T3866C, outer primers and inner primers designed aiming at T3866C, a restriction endonuclease Bgl II, a positive control, and a negative control. According to the invention, genomic DNA is rapidly extracted from small amounts of samples such as blood samples, hair with follicle, oral mucosa smears, or saliva. Therefore, a problem of DNA extraction in primary Leber disease patient blood of traditional methods is solved, pain of patient to be detected is reduced, a problem of cross-region sample transferring is solved, enzyme digestion specificity is improved, false negative is avoided, and detection result stability is improved. The kit provided by the invention is rapid, simple, accurate, and economical. With the kit, primary-Leber-disease-related mtDNAT3866C mutation large-scale screening and preventive inspection can be implemented.

Description

The plastosome T3866C detection kit of Leber disease and application

Technical field

The invention belongs to biological technical field, relate to the test kit suddenlyd change for detecting the Mitochondrial DNA T3866C sick relevant to primary LeberShi, also relate to a kind of detection method of the mitochondrial gene mutation sick relevant to primary LeberShi, particularly detection line plastochondria nD1the method of T3866C sudden change, and aforesaid method or above-mentioned test kit detect the Mitochondrial DNA T3866C relevant with primary LeberShi disease suddenly change in application.

Background technology

Leber hereditary optic neuropathy (Leber's Hereditary Optic Neuropathy, LHON, be called for short LeberShi sick) be a type of optic neuropathy, mainly involve retina, papillomacular bundle fiber is looked in lamina cribrosa of sclera front portion, cause the matrilinear inheritance of optic nerve degeneration sick, the serious people that affect produce normally, live.Add up the existing low visual acuity population of China according to health ministry (http://www.moh.gov.cn/) latest data and about have 7,100,000, blind person about has 5,000,000, accounts for 0.4% of total number of persons, becomes one of country that vision impairment is the most serious in the world.Wherein, what caused by optic neuropathy is about 550,000.The clinical symptom of German this disease of ophthalmologist Theodor Leber reported first in 1871, sign and hereditary property.Erickson in 1972 etc. find that the mode of inheritance of LHON is typical maternal inheritance characteristics.Wallace DC in 1988 etc. have found first Mitochondrial Genome Overview DNA(mitochondria DNA, the mtDNA relevant to LHON) mutational site nD4g11778A.Reported at present 50 multiple line mitochondrial DNA mutational sites and LHON pathogenic relevant (http://www.mitomap.org/), wherein the family of LHON of more than 90% is caused by the ND4 G11778A on oxidative phosphorylation composite I subunit, ND1 G3460A and these 3 primary mutation points of ND6 T14484C.In order to probe into the pathogenesis of LHON further, have collected a large amount of LHON familys in China, except above-mentioned 3 primary mutational sites, in succession having found tRNA ^meta4435G, nD4g11696A, tRNA ^thra15951G, nD1t3866C and nD5t12338C sudden change is relevant to LHON, and clinical symptom is not obvious in early days for the primary LeberShi disease relevant to plastosome, and therefore early stage inspection usually can be delayed, especially in area, China remote countryside, and this situation ubiquity.Therefore, in high risk population and Susceptible population, carry out mtDNA Mutation Screening, have extremely important effect for the prevention and corntrol primary LeberShi disease relevant to plastosome.

Self-discovery has suddenlyd change since relevant disease to mtDNA, the main still sequencing of detection method in detection line plastochondria mutational site.Direct sequencing is the golden standard of qualification sudden change, but this complex operation, and somewhat expensive limits its widespread use.

In recent years, domestic gene diagnosis kit and the detection method thereof in succession reporting Leber hereditary optic neuropathy, to meet needs mitochondrial mutations sudden change being carried out to extensive examination, the gene diagnosis kit applied in 2005 as Medical University Of Fujian and the detection method patent (patent No.: 200510006097.8) thereof, this invention belongs to 3 primary pathogenic sites sudden change (G11778A according to the Mitochondrial DNA Mutation of the Leber hereditary optic neuropathy patient of more than 90%, G3460A and T14484C), design and synthesis Allele-specific diagnostic PCR primer, the DNA profiling of PCR is directly made with whole blood, utilize multiplex allele-specific polymerase chain reaction technology, the disposable PCR reaction of single tube, detect 3 primary pathogenic mutation sites of the Mitochondrial DNA of LHON patient simultaneously, have fast easy, efficiently, expense is low, specificity is good, only need the advantages such as micro blood sample, rapid clinical gene diagnosis for LHON patient provides a kind of simple and easy, reliable method and test kit, there is huge penetration and promotion using value.But the difficulty that the method deposits Direct PCR amplification in blood strengthens, and the conditional request of the multiplex PCR taked in experiment will increase, and detection method does not have the difference of essence with common method.You Sida bio tech ltd, Hangzhou in 2006 sets up a kind of with the novel method (patent No.: 200610003429.1) of G11778A site mutation in single nucleotide polymorphism nucleic acid test paper rapid detection LHON Mitochondrial DNA.When applying single nucleotide polymorphism nucleic acid detection test strip and carrying out the detection in polymorphic site or mutational site, design specificity is needed to extend primer, 3 ' end base of this primer is close to polymorphic base or mutating alkali yl, it starts to extend under the effect of archaeal dna polymerase, is connected to extends on primer with two deoxymononucleotides (ddNTP) that antigenic mark is corresponding with template.Although the method can realize the positive site of detection in the short period of time, pcr amplification condition is strict, and there is false-negative probability increases greatly.

Summary of the invention

The object of the invention is for current detection nD1the deficiency of the method existence of T3866C sudden change, provides a kind of plastosome T3866C detection kit of Leber disease, is the test kit of the Mitochondrial DNA T3866C sudden change that a kind of quick, easy, accurate, economic detection primary LeberShi disease is relevant.

Test kit provided by the invention is made up of the PCR mixed solution of the DNA extraction mixed solution be placed in box body, amplification T3866C, the outer primer designed for T3866C, the inner primer designed for T3866C, restriction enzyme, positive control and negative control.Wherein, DNA extraction mixed solution is primarily of cell pyrolysis liquid and solution I (main component is Proteinase K) composition; The PCR mixed solution of amplification T3866C is primarily of dNTP (deoxymononucleotide), 10 × PCR damping fluid, MgCl ₂, tri-distilled water and taqenzyme (archaeal dna polymerase) forms, and the outer primer for T3866C design has outer forward direction primers F: TACTTCACAAAGCGCCTTCC (SEQ ID NO:1) and outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); Inner primer for T3866C design has interior forward direction primers F: CAACACAAGAACACCTCTGATTACTCCTGCCAT CATGACCCTTGGCCATAATATGATAGA (SEQ ID NO:3) and interior reverse primer R:GAGAGTGCGTCATATGTTGTTCCT AGGAAGA (SEQ ID NO:4); Restriction enzyme is restriction enzyme bgliI; It is that the enzyme suddenlyd change containing mtDNA sequence the 3866th site generation T>C cuts sample, ' negative ' specimens contrast is that the enzyme do not suddenlyd change containing mtDNA sequence the 3866th site generation T>C cuts sample that positive sample contrasts.

In mentioned reagent box, add for improving the specific a little dimethyl sulfoxide (DMSO) of extension (0.1-0.2 μ l is advisable) in the PCR mixed solution of amplification T3866C.

Another object of the present invention is to provide described test kit and is detecting the chondriogen sick relevant to matrilinear inheritance primary LeberShi nD1application in T3866C sudden change.Realized by following steps:

(1) extraction of genomic dna: use protease K digesting cracking process, extracts genomic dna from the sample of the hair of a small amount of blood preparation, band hair follicle, oral mucosa scraping blade or saliva;

(2) specific PCR amplification: use Primer 5.0 software and the primers F designed by the homo mitochondrion gene sequence of Oligo7.0 software according to SEQ ID NO:5 _outward/ R _outward, F _in/ R _inthe fragment that can amplify the mitochondrial mutations site comprising above-mentioned primary LeberShi disease, F is outer/R outside amplify Nucleotide 3150-4679 into Mitochondrial DNA, its sequence is the SEQ ID NO:1,2 in sequence table; F _in/ R _inamplify the Nucleotide 3806-4058 for Mitochondrial DNA, its sequence is the SEQ ID NO:3,4 in sequence table;

(3) enzyme cuts qualification: by above-mentioned PCR primer restriction enzyme bgliI pair of T3866C mutational site place carries out enzyme and cuts;

(4) abrupt climatic change: polyacrylamide gel electrophoresis detects, directly cuts DNA fragmentation quantity and the DNA fragmentation size of PCR primer generation according to enzyme, detect mtDNA and whether T3866C sudden change occurs.

In the method that above-mentioned detection mtDNA T3866C suddenlys change, can from the sample of blood specimen (as bleeds), the band hair of hair follicle, oral mucosa scraping blade or saliva rapid extraction genomic dna, according to sampling mode or tested sample form difference, carry out corresponding pre-treatment to different sample, treatment process is as follows:

(1) blood specimen (as bleeds): get a small amount of blood specimen of 20 ~ 200 μ l (as bleeds) or 1cm ²blood filter paper put into 1.5ml EP manage (centrifuge tube), add 900 μ l erythrocyte lysing buffer (20mmol/L Tris-HCl, pH 7.6) (tris-HCI buffer) room temperature leaves standstill 10min, abundant splitting erythrocyte, the centrifugal 1min of 12000rpm, collects leukocyte cell pellet;

(2) be with the hair of hair follicle: wash the hair 1 time being with hair follicle with 70% ethanol, after use distilled water flushing hair again 2 times.In 1.5ml EP pipe, put into 2 ~ 4 hairs respectively, hair follicle is placed in bottom EP pipe, cuts off the part of hair higher than EP pipe with clean scissors;

(3) oral mucosa scraping blade or saliva: before collecting saliva, the person of being collected must be allowed to gargle.To remove the materials such as aged cells too much in oral cavity, swill, toothpaste, coffee, cigarette.Do not drink water in half an hour, take food, smoking, then start to collect oral mucosa scraping blade or saliva, visual condition select following method collect saliva sample: 1. tongue is around oral cavity scraping mucomembranous cell, about 0.1ml saliva is directly told in EP pipe; 2. physiological saline is gargled, and tells in EP pipe, draws PBS solution in the EP pipe that the saliva sample collected by any one method above-mentioned is housed, repeatedly after piping and druming, and the centrifugal 5min of 12000rpm, removing supernatant, repeats this process once; 3. repeatedly scrape cheek inwall 6 times, air drying with cotton swab, then carefully tear its outside surface off with the tweezers of sterilizing, put into EP pipe; 4. saliva is told on filter paper, after air drying, form salivary stain, then be cut into size with clean scissors and be about 1cm ²a scrap of paper is placed in EP pipe.

Then carry out digestion cracking with cell pyrolysis liquid and Proteinase K to above-mentioned sample, utilize salting-out process to remove the impurity such as albumen, isopropanol precipitating DNA, finally saves backup in-20 DEG C with after autoclaving water or TE buffer solution.

In embodiments of the invention, the guiding theory of design of primers is, the position existed for mtDNA T3866C site is adjoining, increases in a bar segment, therefore should design the 3' end upstream primer corresponding with 3866 site wild-type T and 3866 site mutation type C; For the downstream primer (see Fig. 2) that 3866 site design 3' ends are corresponding with 3866 site wild-type T and 4263 site mutation type C respectively.

The present inventor is for after specific PCR amplification (Fig. 3), and mtDNA T3866C site defines the disappearance of restriction enzyme site.Restriction enzyme site is suddenlyd change by mtDNA T3866C and causes disappearing, and restriction enzyme is wherein bgliI, its site is the SEQ ID NO:3,4 in sequence table;

With the primer of above design, to be detected the DNA of sample accordingly for template, be about the constant amplified band of 253bp by obtaining size limpid in sight after pcr amplification respectively, 3866 mutational sites correspond to the 60th of amplified fragments.

In the method for above-mentioned detection line mitochondrial genes primary LeberShi disease sudden change, binding specificity round pcr and enzyme incision technology, every part of DNA sample carries out regular-PCR amplification with Auele Specific Primer and primers F/R respectively in PCR reaction tubes, then the enzyme carrying out mutational site place is cut, and just can detect the sick relevant mtDNA T3866C of primary LeberShi in several hours suddenly change by a PCR.

In theory, genomic dna sample reacts through a PCR, namely only adds in system for after the T3866C primers F/R of saltant type site, adds the restriction enzyme newly formed for mutational site bgliI carries out enzyme cuts, and just can detect.That is, same gene group DNA sample is cut through a PCR-enzyme, thus makes detected result more accurate, credible.

The present inventor is also according to the primer sequence designed in the present invention, primer is obtained by synthetic (entrusting biotech firm), and primer is mixed according to a certain percentage, with extract sample genomic dna reagent, pcr amplification reaction reagent, positive sample contrasts, ' negative ' specimens contrasts and working instructions combine, make the test kit for vitro detection matrilinear inheritance primary LeberShi sick chondriogen mtDNA T3866C sudden change, such that sample DNA extracts, specific PCR amplification and enzyme cut on the reagent basis that can provide at test kit and completed smoothly.Wherein, the reagent of sample DNA is extracted primarily of cell pyrolysis liquid and solution I (main component is Proteinase K) composition; Pcr amplification reaction reagent comprises dNTP, 10 × PCR damping fluid, MgCl ₂, tri-distilled water and Taq enzyme, restriction enzyme comprises restriction enzyme bgliI.

With the sick relevant chondriogen mtDNA T3866C mutagenesis kit of vitro detection primary LeberShi of method of the present invention and preparation thereof, there is following characteristics:

1. the method obtaining primary LeberShi patient genomic dna traditionally extracts from blood, and everyone approximately needs 3 ~ 5ml.This blood-sampling method brings some painful and injuries to a lot of examinee especially infant, and there is certain risk and trouble when trans-regional transfer samples.The present invention uses protease K digesting cracking process, rapid extraction genomic dna from a small amount of blood preparation (as bleeds), the hair being with hair follicle, oral mucosa scraping blade or saliva equal samples.The method not only solves the problem extracting DNA traditionally from primary LeberShi patient blood, alleviates the misery of examinee; But also solving the problem of trans-regional transfer samples, blood filter paper, hair and oral mucosa scraping blade (cotton swab) or salivary stain filter paper etc. can be placed in envelope easily, and the trans-regional transmission of mode by posting.

2. there is the matrilinear inheritance disease gene diagnostic method that several plastosome is relevant both at home and abroad at present, as direct sequencing fluorescent quantitative PCR detection method, gene chip detection method etc., due to the defect of himself, as wasted time and energy, complex operation and testing cost higher and not easily promote clinical.Compared with these methods, PCR-enzyme incision technology then combines the advantage of both specific PCR technology and enzyme incision technology, every part of DNA sample Auele Specific Primer and primers F/R carry out specific PCR amplification in PCR reaction tubes, cut in several hours, just can detect mtDNA T3866C simultaneously suddenly change by PCR-enzyme.It is worth mentioning that in addition, present method primer used is all through carefully design.First, it is different that bases different between normal and mutation allele cuts through at enzyme the site formed specific restriction restriction endonuclease in journey, thus substantially increases the specificity that enzyme is cut; Can be used as by the product of normal control and blank the molecule internal control index that whole PCR reacts in addition, thus avoid the appearance of false negative result, improve the stability of detected result.By adjusting concentration and the ratio of different primers and being optimized PCR reaction conditions, to guarantee specificity and the stability of result.

3. apply test kit provided by the invention and carry out mtDNA T3866C abrupt climatic change, cost is lower compared with other detection methods; Testing process is easy, quick, and result interpretation is directly perceived; To experimental installation and operator without particular requirement, be adapted at general hospital, molecular biosciences labs, be convenient in China extensive examination and preventive inspection that the relevant mtDNA T3866C sudden change of primary LeberShi disease is carried out in particularly low developed area.

Accompanying drawing explanation

Fig. 1 is reagent cartridge configuration schematic diagram of the present invention.

Fig. 2 is specificity nido PCR primer schematic diagram of the present invention.

Fig. 3 is specificity nested PCR amplification scheme schematic diagram of the present invention.

Fig. 4 carries T3866C sudden change primary LeberShi patient and his family system family tree.

Fig. 5 is the 7% polyacrylamide gel electrophoresis figure of gene specific nested PCR amplification qualification mtDNA T3866C.

Nomenclature:

In Fig. 2 and 3: F is outward the forward primer of specificity nest-type PRC first time amplification; R is outward the reverse primer of specificity nest-type PRC first time amplification, matches outward use with F; Be the forward primer of specificity nest-type PRC second time amplification in F, be the reverse primer that specificity nest-type PRC increases for the second time in R, uses with matching in F; T3866C is expressed as Mitochondrial DNA the 4263rd, and wild-type is A, is G after producer sudden change.

In Fig. 4: is that normal male is individual; Zero is that normal female is individual; ■ is that affected males is individual; ● be morbidity female individual; ◥ is propositus; / be the individuality of dead; I is the first-generation member of this family; II is the s-generation member of this family; III is the third generation member of this family; IV is the forth generation member of this family.

In Fig. 5: N1 represents the electrophorogram cut through the non-enzyme of pcr amplification product; N2 represents that propositus carries the electrophorogram that the pcr amplification product enzyme detected in T3866C mutational site cuts qualification; N3 is mother propositus carrying T3866C sudden change; N4, N5 and N6 are respectively three younger brothers carrying T3866C sudden change, and N7 represents that propositus carries T3866C mutational site but the maternal member do not fallen ill; N8 is the propositus husband carrying T3866C sudden change; N9, N10 and N11 are its three children respectively.

Embodiment

Below in conjunction with the drawings and specific embodiments, the invention will be further described, can better understand the present invention and can be implemented, but illustrated embodiment is not as a limitation of the invention to make those skilled in the art.

The test kit that embodiment 1 one kinds of detection line mitochondrial DNA T3866C suddenly change

See Fig. 1, test kit provided by the invention, be made up of the PCR mixed solution 2 of DNA extraction mixed solution 1, amplification T3866C, the outer primer 3 designed for T3866C, the inner primer 4 designed for T3866C, restriction enzyme 5, positive control 6, negative control 7 and box body 8, the PCR mixed solution 2 of DNA extraction mixed solution 1, amplification T3866C, the outer primer 3 for T3866C design, the inner primer 4 for T3866C design, restriction enzyme 5, positive control 6, negative control 7 are placed in box body 8 respectively.Wherein, DNA extraction mixed solution 1 is primarily of cell pyrolysis liquid and solution I (main component is Proteinase K) composition; The PCR mixed solution 2 of amplification T3866C is primarily of dNTP (deoxymononucleotide), 10 × PCR damping fluid, MgCl ₂, tri-distilled water and taqenzyme (archaeal dna polymerase) forms, and the outer primer 3 for T3866C design has outer forward direction primers F: TACTTCACAAAGCGCCTTCC (SEQ ID NO:1) and outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); Inner primer 4 for T3866C design has interior forward direction primers F: CAACACAAGAACACCTCTGATTACTCCTGCCAT CATGACCCTTGGCCATAATATGATAGA (SEQ ID NO:3) and interior reverse primer R:GAGAGTGCGTCATATGTTGTTCCT AGGAAGA (SEQ ID NO:4); Restriction enzyme 5 is restriction enzyme bgliI; Positive control 6 is that the enzyme containing mtDNA sequence the 3866th site generation T>C sudden change cuts sample, negative control 7 is that the enzyme do not suddenlyd change containing mtDNA sequence the 3866th site generation T>C cuts sample; .

In mentioned reagent box, add for improving the specific a little dimethyl sulfoxide (DMSO) of extension (0.1-0.2 μ l is advisable) in the PCR mixed solution 2 of amplification T3866C.

Embodiment 2 carries the detection of the primary LeberShi patient and his family system that chondriogen T3866C suddenlys change

1. detect sample

Select 1 primary LeberShi patient and his family system of carrying T3866C sudden change.Its pedigree chart is see Fig. 4.This family presents typical matrilinear inheritance, send out patient all with the clinical symptom that elevation of blood pressure is unique, but in family each morbidity member elevation of blood pressure varying degree.This family total number of persons is 58 people, and wherein maternal number of members is 27 people, and suffering from LeberShi patient has 8 people.

2. the extraction of genomic dna

The sample obtaining 10 persons under inspection respectively (comprises capillary vessel venous blood filter paper of collection III-1, II-2, III-3, III-7 and IV-1; IV-2 and 3 is the hair being with hair follicle), blood filter paper is cut into clean scissors a scrap of paper that size is about 1cm2 put into 1.5ml EP and manage (Eppendorf pipe), add 900 μ l erythrocyte lysing buffer (20mmol/L Tris-HCl, pH 7.6) room temperature leaves standstill 10min, abundant splitting erythrocyte, the centrifugal 1min of 12000rpm, collects leukocyte cell pellet; The hair 1 time of band hair follicle washed by hair swatch with hair follicle 70% ethanol, after use distilled water flushing hair again 2 times.In 1.5ml EP pipe, put into 2 ~ 4 hairs respectively, hair follicle is placed in bottom EP pipe, cuts off the part of hair higher than EP pipe with clean scissors.Then add 600 μ l cell pyrolysis liquids, after mixing, add solution I again, make the working concentration of Proteinase K be 20 μ g/ml.The rear 55 DEG C of digestion cracking of abundant mixing, then remove the impurity such as albumen with salting-out process, isopropanol precipitating DNA, finally saves backup in-20 DEG C with after autoclaving water or TE buffer solution.

3. design of primers

Use Primer 5.0 software and Oligo7.0 software assistance to design meliorated primer, design according to published homo mitochondrion gene Cambridge reference sequences (SEQ ID NO:5), the design (see figure 2) of primer is as follows:

For mtDNA 3866 site, ensure the specificity of design of primers, outside we design nest-type PRC two pairs of primers F outer/R, in F/R in; The close experiment condition of being convenient to of their length, annealing temperature is stablized, to strengthen specificity.The nest-type PRC primer in 4263 sites designed thus is outer forward direction primers F: TACTTCACAAAGCGCCTTCC (SEQ ID NO:1), outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); Interior forward direction primers F: CAACACAAGAACACCTCTGATTACTCCTGCCAT CATGACCCTTGGCCATAATATGATAGA (SEQ ID NO:3), interior reverse primer R:GAGAGTGCGTCATATGTTGTTCCT AGGAAGA (SEQ ID NO:4).

The guiding theory of design of primers is, the position existed for mtDNA T3866C site is adjoining, increases in a bar segment, therefore should design the 3' end upstream primer corresponding with 3866 site wild-type T and 3866 site mutation type C; For the downstream primer (see Fig. 2) that 3866 site design 3' ends are corresponding with 3866 site wild-type T and 4263 site mutation type C respectively.

The present inventor is for after specific PCR amplification (Fig. 3), and mtDNA T3866C site defines the disappearance of restriction enzyme site.Restriction enzyme site is suddenlyd change by mtDNA T3866C and causes disappearing, and restriction enzyme is wherein bgliI, its site is the SEQ ID NO:3,4 in sequence table.

With the primer of above design, to be detected the DNA of sample accordingly for template, be about the constant amplified band of 253bp by obtaining size limpid in sight after pcr amplification respectively, 3866 mutational sites correspond to the 60th of amplified fragments.

4. gene specific nested PCR amplification

According to 4 primer sequences of above-mentioned design, 2 pairs of primers are obtained by synthetic (entrusting biotech firm), with the tested sample genomic dna of said extracted for template, carry out gene specific nested PCR amplification and 7% polyacrylamide gel electrophoresis enzyme cut qualification.

Nest-type PRC loop parameter uses outer primer to be 94 DEG C of denaturation 5min, then 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, after recirculation 30 times, then use inner primer 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, after recirculation 30 times, finally extend 5 min again in 72 DEG C.PCR primer 5 ~ 10 μ l electrophoresis in the polyacrylamide gel of 7%, observes and photographic recording result after EB dyeing on gel imaging instrument.

5. result

According to Fig. 5, when the genomic dna of propositus and normal control sample is respectively through 2 pairs of primers F _outward/ R _outward, F _in/ R _inafter nest-type PRC enzyme cuts qualification, only produce a constant amplified band of 253bp, after digestion with restriction enzyme qualification, constant being limited property of the amplified band restriction endonuclease of generation is cut into two sections (see Fig. 5 swimming lane N8), proves that propositus's sample does not carry mtDNA T3866C and suddenlys change; And after digestion with restriction enzyme qualification, the constant amplified band of generation being not limited property restriction endonuclease is cut into two sections (see Fig. 5 swimming lane N2, N3), prove that this sample carries mtDNA T3866C and suddenlys change.The genomic dna of family propositus (III-14) is through 2 pairs of primers F _outward/ R _outward, F _in/ R _inafter carrying out nest-type PRC, there is the constant amplified band (see Fig. 5 swimming lane N2) of 1 253bp; And after digestion with restriction enzyme, this band does not have enzyme to cut, demonstrate this sample and carry mtDNA T3866C and suddenly change.N2 represents that propositus carries the electrophorogram that the pcr amplification product enzyme detected in T3866C mutational site cuts qualification; N3 is mother propositus carrying T3866C sudden change; N4, N5 and N6 are respectively three younger brothers carrying T3866C sudden change, and N7 represents that propositus carries T3866C mutational site but the maternal member do not fallen ill; N8 is the propositus husband carrying T3866C sudden change; N9, N10 and N11 are its three children respectively.

6. the inspection of gene specific nested PCR amplification detection method reliability

After gene specific nested PCR amplification enzyme cuts qualification, we detect and carry T3866C sudden change positive individuals in the maternal member of family.Further the pcr amplification product of these samples is carried out sequencing analysis, sequencing result and gene specific nested PCR amplification result match, and the reliability and stability using the inventive method detection line mitochondrial genes T3866C sudden change are described.

Gene specific Nested PCR Technique tool compared with fluorescent quantitative PCR technique, order-checking and biochip technology has the following advantages (see table 2).

The above embodiment is only that protection scope of the present invention is not limited thereto in order to absolutely prove the preferred embodiment that the present invention lifts.The equivalent alternative or conversion that those skilled in the art do on basis of the present invention, all within protection scope of the present invention.

<110> Zhejiang University

The plastosome T3866C detection kit of <120> Leber disease and application

<160> 5

<210> 1

<211> 20

<212> DNA

<213> people (homo sapiens)

<400> 1

TACTTCACAAAGCGCCTTCC

<210> 2

<211> 20

<212> DNA

<213> people (homo sapiens)

<400> 2

AAGGATTATGGATGCGGTTG

<210> 3

<211> 20

<212> DNA

<213> people (homo sapiens)

<400> 3

CAACACAAGAACACCTCTGATTACTCCTGCCAT ATGACCCTTGGCCATAATATGATAGA

<210> 4

<211> 20

<212> DNA

<213> people (homo sapiens)

<400> 4

GAGAGTGCGTCATATGTTGTTCCTAGGAAGA

<210> 5

<211> 16569

<212> DNA

<213> Homo sapiens

<221> misc_feature

<222> (3107)..(3107)

<223> n is a, c, g, or t

<400> 5

gatcacaggt ctatcaccct attaaccact cacgggagct ctccatgcat ttggtatttt 60

cgtctggggg gtatgcacgc gatagcattg cgagacgctg gagccggagc accctatgtc 120

gcagtatctg tctttgattc ctgcctcatc ctattattta tcgcacctac gttcaatatt 180

acaggcgaac atacttacta aagtgtgtta attaattaat gcttgtagga cataataata 240

acaattgaat gtctgcacag ccactttcca cacagacatc ataacaaaaa atttccacca 300

aaccccccct cccccgcttc tggccacagc acttaaacac atctctgcca aaccccaaaa 360

acaaagaacc ctaacaccag cctaaccaga tttcaaattt tatcttttgg cggtatgcac 420

ttttaacagt caccccccaa ctaacacatt attttcccct cccactccca tactactaat 480

ctcatcaata caacccccgc ccatcctacc cagcacacac acaccgctgc taaccccata 540

ccccgaacca accaaacccc aaagacaccc cccacagttt atgtagctta cctcctcaaa 600

gcaatacact gaaaatgttt agacgggctc acatcacccc ataaacaaat aggtttggtc 660

ctagcctttc tattagctct tagtaagatt acacatgcaa gcatccccgt tccagtgagt 720

tcaccctcta aatcaccacg atcaaaagga acaagcatca agcacgcagc aatgcagctc 780

aaaacgctta gcctagccac acccccacgg gaaacagcag tgattaacct ttagcaataa 840

acgaaagttt aactaagcta tactaacccc agggttggtc aatttcgtgc cagccaccgc 900

ggtcacacga ttaacccaag tcaatagaag ccggcgtaaa gagtgtttta gatcaccccc 960

tccccaataa agctaaaact cacctgagtt gtaaaaaact ccagttgaca caaaatagac 1020

tacgaaagtg gctttaacat atctgaacac acaatagcta agacccaaac tgggattaga 1080

taccccacta tgcttagccc taaacctcaa cagttaaatc aacaaaactg ctcgccagaa 1140

cactacgagc cacagcttaa aactcaaagg acctggcggt gcttcatatc cctctagagg 1200

agcctgttct gtaatcgata aaccccgatc aacctcacca cctcttgctc agcctatata 1260

ccgccatctt cagcaaaccc tgatgaaggc tacaaagtaa gcgcaagtac ccacgtaaag 1320

acgttaggtc aaggtgtagc ccatgaggtg gcaagaaatg ggctacattt tctaccccag 1380

aaaactacga tagcccttat gaaacttaag ggtcgaaggt ggatttagca gtaaactaag 1440

agtagagtgc ttagttgaac agggccctga agcgcgtaca caccgcccgt caccctcctc 1500

aagtatactt caaaggacat ttaactaaaa cccctacgca tttatataga ggagacaagt 1560

cgtaacatgg taagtgtact ggaaagtgca cttggacgaa ccagagtgta gcttaacaca 1620

aagcacccaa cttacactta ggagatttca acttaacttg accgctctga gctaaaccta 1680

gccccaaacc cactccacct tactaccaga caaccttagc caaaccattt acccaaataa 1740

agtataggcg atagaaattg aaacctggcg caatagatat agtaccgcaa gggaaagatg 1800

aaaaattata accaagcata atatagcaag gactaacccc tataccttct gcataatgaa 1860

ttaactagaa ataactttgc aaggagagcc aaagctaaga cccccgaaac cagacgagct 1920

acctaagaac agctaaaaga gcacacccgt ctatgtagca aaatagtggg aagatttata 1980

ggtagaggcg acaaacctac cgagcctggt gatagctggt tgtccaagat agaatcttag 2040

ttcaacttta aatttgccca cagaaccctc taaatcccct tgtaaattta actgttagtc 2100

caaagaggaa cagctctttg gacactagga aaaaaccttg tagagagagt aaaaaattta 2160

acacccatag taggcctaaa agcagccacc aattaagaaa gcgttcaagc tcaacaccca 2220

ctacctaaaa aatcccaaac atataactga actcctcaca cccaattgga ccaatctatc 2280

accctataga agaactaatg ttagtataag taacatgaaa acattctcct ccgcataagc 2340

ctgcgtcaga ttaaaacact gaactgacaa ttaacagccc aatatctaca atcaaccaac 2400

aagtcattat taccctcact gtcaacccaa cacaggcatg ctcataagga aaggttaaaa 2460

aaagtaaaag gaactcggca aatcttaccc cgcctgttta ccaaaaacat cacctctagc 2520

atcaccagta ttagaggcac cgcctgccca gtgacacatg tttaacggcc gcggtaccct 2580

aaccgtgcaa aggtagcata atcacttgtt ccttaaatag ggacctgtat gaatggctcc 2640

acgagggttc agctgtctct tacttttaac cagtgaaatt gacctgcccg tgaagaggcg 2700

ggcataacac agcaagacga gaagacccta tggagcttta atttattaat gcaaacagta 2760

cctaacaaac ccacaggtcc taaactacca aacctgcatt aaaaatttcg gttggggcga 2820

cctcggagca gaacccaacc tccgagcagt acatgctaag acttcaccag tcaaagcgaa2880

ctactatact caattgatcc aataacttga ccaacggaac aagttaccct agggataaca 2940

gcgcaatcct attctagagt ccatatcaac aatagggttt acgacctcga tgttggatca 3000

ggacatcccg atggtgcagc cgctattaaa ggttcgtttg ttcaacgatt aaagtcctac 3060

gtgatctgag ttcagaccgg agtaatccag gtcggtttct atctacnttc aaattcctcc 3120

ctgtacgaaa ggacaagaga aataaggcct acttcacaaa gcgccttccc ccgtaaatga 3180

tatcatctca acttagtatt atacccacac ccacccaaga acagggtttg ttaagatggc 3240

agagcccggt aatcgcataa aacttaaaac tttacagtca gaggttcaat tcctcttctt 3300

aacaacatac ccatggccaa cctcctactc ctcattgtac ccattctaat cgcaatggca 3360

ttcctaatgc ttaccgaacg aaaaattcta ggctatatac aactacgcaa aggccccaac 3420

gttgtaggcc cctacgggct actacaaccc ttcgctgacg ccataaaact cttcaccaaa 3480

gagcccctaa aacccgccac atctaccatc accctctaca tcaccgcccc gaccttagct 3540

ctcaccatcg ctcttctact atgaaccccc ctccccatac ccaaccccct ggtcaacctc 3600

aacctaggcc tcctatttat tctagccacc tctagcctag ccgtttactc aatcctctga 3660

tcagggtgag catcaaactc aaactacgcc ctgatcggcg cactgcgagc agtagcccaa 3720

acaatctcat atgaagtcac cctagccatc attctactat caacattact aataagtggc 3780

tcctttaacc tctccaccct tatcacaaca caagaacacc tctgattact cctgccatca 3840

tgacccttgg ccataatatg atttatctcc acactagcag agaccaaccg aacccccttc 3900

gaccttgccg aaggggagtc cgaactagtc tcaggcttca acatcgaata cgccgcaggc 3960

cccttcgccc tattcttcat agccgaatac acaaacatta ttataataaa caccctcacc 4020

actacaatct tcctaggaac aacatatgac gcactctccc ctgaactcta cacaacatat 4080

tttgtcacca agaccctact tctaacctcc ctgttcttat gaattcgaac agcatacccc 4140

cgattccgct acgaccaact catacacctc ctatgaaaaa acttcctacc actcacccta 4200

gcattactta tatgatatgt ctccataccc attacaatct ccagcattcc ccctcaaacc 4260

taagaaatat gtctgataaa agagttactt tgatagagta aataatagga gcttaaaccc 4320

ccttatttct aggactatga gaatcgaacc catccctgag aatccaaaat tctccgtgcc 4380

acctatcaca ccccatccta aagtaaggtc agctaaataa gctatcgggc ccataccccg 4440

aaaatgttgg ttataccctt cccgtactaa ttaatcccct ggcccaaccc gtcatctact 4500

ctaccatctt tgcaggcaca ctcatcacag cgctaagctc gcactgattt tttacctgag 4560

taggcctaga aataaacatg ctagctttta ttccagttct aaccaaaaaa ataaaccctc 4620

gttccacaga agctgccatc aagtatttcc tcacgcaagc aaccgcatcc ataatccttc 4680

taatagctat cctcttcaac aatatactct ccggacaatg aaccataacc aatactacca 4740

atcaatactc atcattaata atcataatag ctatagcaat aaaactagga atagccccct 4800

ttcacttctg agtcccagag gttacccaag gcacccctct gacatccggc ctgcttcttc 4860

tcacatgaca aaaactagcc cccatctcaa tcatatacca aatctctccc tcactaaacg 4920

taagccttct cctcactctc tcaatcttat ccatcatagc aggcagttga ggtggattaa 4980

accaaaccca gctacgcaaa atcttagcat actcctcaat tacccacata ggatgaataa 5040

tagcagttct accgtacaac cctaacataa ccattcttaa tttaactatt tatattatcc 5100

taactactac cgcattccta ctactcaact taaactccag caccacgacc ctactactat 5160

ctcgcacctg aaacaagcta acatgactaa cacccttaat tccatccacc ctcctctccc 5220

taggaggcct gcccccgcta accggctttt tgcccaaatg ggccattatc gaagaattca 5280

caaaaaacaa tagcctcatc atccccacca tcatagccac catcaccctc cttaacctct 5340

acttctacct acgcctaatc tactccacct caatcacact actccccata tctaacaacg 5400

taaaaataaa atgacagttt gaacatacaa aacccacccc attcctcccc acactcatcg 5460

cccttaccac gctactccta cctatctccc cttttatact aataatctta tagaaattta 5520

ggttaaatac agaccaagag ccttcaaagc cctcagtaag ttgcaatact taatttctgt 5580

aacagctaag gactgcaaaa ccccactctg catcaactga acgcaaatca gccactttaa5640

ttaagctaag cccttactag accaatggga cttaaaccca caaacactta gttaacagct 5700

aagcacccta atcaactggc ttcaatctac ttctcccgcc gccgggaaaa aaggcgggag 5760

aagccccggc aggtttgaag ctgcttcttc gaatttgcaa ttcaatatga aaatcacctc 5820

ggagctggta aaaagaggcc taacccctgt ctttagattt acagtccaat gcttcactca 5880

gccattttac ctcaccccca ctgatgttcg ccgaccgttg actattctct acaaaccaca 5940

aagacattgg aacactatac ctattattcg gcgcatgagc tggagtccta ggcacagctc 6000

taagcctcct tattcgagcc gagctgggcc agccaggcaa ccttctaggt aacgaccaca 6060

tctacaacgt tatcgtcaca gcccatgcat ttgtaataat cttcttcata gtaataccca 6120

tcataatcgg aggctttggc aactgactag ttcccctaat aatcggtgcc cccgatatgg 6180

cgtttccccg cataaacaac ataagcttct gactcttacc tccctctctc ctactcctgc 6240

tcgcatctgc tatagtggag gccggagcag gaacaggttg aacagtctac cctcccttag 6300

cagggaacta ctcccaccct ggagcctccg tagacctaac catcttctcc ttacacctag 6360

caggtgtctc ctctatctta ggggccatca atttcatcac aacaattatc aatataaaac 6420

cccctgccat aacccaatac caaacgcccc tcttcgtctg atccgtccta atcacagcag 6480

tcctacttct cctatctctc ccagtcctag ctgctggcat cactatacta ctaacagacc 6540

gcaacctcaa caccaccttc ttcgaccccg ccggaggagg agaccccatt ctataccaac 6600

acctattctg atttttcggt caccctgaag tttatattct tatcctacca ggcttcggaa 6660

taatctccca tattgtaact tactactccg gaaaaaaaga accatttgga tacataggta 6720

tggtctgagc tatgatatca attggcttcc tagggtttat cgtgtgagca caccatatat 6780

ttacagtagg aatagacgta gacacacgag catatttcac ctccgctacc ataatcatcg 6840

ctatccccac cggcgtcaaa gtatttagct gactcgccac actccacgga agcaatatga 6900

aatgatctgc tgcagtgctc tgagccctag gattcatctt tcttttcacc gtaggtggcc 6960

tgactggcat tgtattagca aactcatcac tagacatcgt actacacgac acgtactacg 7020

ttgtagccca cttccactat gtcctatcaa taggagctgt atttgccatc ataggaggct 7080

tcattcactg atttccccta ttctcaggct acaccctaga ccaaacctac gccaaaatcc 7140

atttcactat catattcatc ggcgtaaatc taactttctt cccacaacac tttctcggcc 7200

tatccggaat gccccgacgt tactcggact accccgatgc atacaccaca tgaaacatcc 7260

tatcatctgt aggctcattc atttctctaa cagcagtaat attaataatt ttcatgattt 7320

gagaagcctt cgcttcgaag cgaaaagtcc taatagtaga agaaccctcc ataaacctgg 7380

agtgactata tggatgcccc ccaccctacc acacattcga agaacccgta tacataaaat 7440

ctagacaaaa aaggaaggaa tcgaaccccc caaagctggt ttcaagccaa ccccatggcc 7500

tccatgactt tttcaaaaag gtattagaaa aaccatttca taactttgtc aaagttaaat 7560

tataggctaa atcctatata tcttaatggc acatgcagcg caagtaggtc tacaagacgc 7620

tacttcccct atcatagaag agcttatcac ctttcatgat cacgccctca taatcatttt 7680

ccttatctgc ttcctagtcc tgtatgccct tttcctaaca ctcacaacaa aactaactaa 7740

tactaacatc tcagacgctc aggaaataga aaccgtctga actatcctgc ccgccatcat 7800

cctagtcctc atcgccctcc catccctacg catcctttac ataacagacg aggtcaacga 7860

tccctccctt accatcaaat caattggcca ccaatggtac tgaacctacg agtacaccga 7920

ctacggcgga ctaatcttca actcctacat acttccccca ttattcctag aaccaggcga 7980

cctgcgactc cttgacgttg acaatcgagt agtactcccg attgaagccc ccattcgtat 8040

aataattaca tcacaagacg tcttgcactc atgagctgtc cccacattag gcttaaaaac 8100

agatgcaatt cccggacgtc taaaccaaac cactttcacc gctacacgac cgggggtata 8160

ctacggtcaa tgctctgaaa tctgtggagc aaaccacagt ttcatgccca tcgtcctaga 8220

attaattccc ctaaaaatct ttgaaatagg gcccgtattt accctatagc accccctcta 8280

ccccctctag agcccactgt aaagctaact tagcattaac cttttaagtt aaagattaag 8340

agaaccaaca cctctttaca gtgaaatgcc ccaactaaat actaccgtat ggcccaccat 8400

aattaccccc atactcctta cactattcct catcacccaa ctaaaaatat taaacacaaa 8460

ctaccaccta cctccctcac caaagcccat aaaaataaaa aattataaca aaccctgaga 8520

accaaaatga acgaaaatct gttcgcttca ttcattgccc ccacaatcct aggcctaccc 8580

gccgcagtac tgatcattct atttccccct ctattgatcc ccacctccaa atatctcatc 8640

aacaaccgac taatcaccac ccaacaatga ctaatcaaac taacctcaaa acaaatgata 8700

accatacaca acactaaagg acgaacctga tctcttatac tagtatcctt aatcattttt 8760

attgccacaa ctaacctcct cggactcctg cctcactcat ttacaccaac cacccaacta 8820

tctataaacc tagccatggc catcccctta tgagcgggca cagtgattat aggctttcgc 8880

tctaagatta aaaatgccct agcccacttc ttaccacaag gcacacctac accccttatc 8940

cccatactag ttattatcga aaccatcagc ctactcattc aaccaatagc cctggccgta 9000

cgcctaaccg ctaacattac tgcaggccac ctactcatgc acctaattgg aagcgccacc 9060

ctagcaatat caaccattaa ccttccctct acacttatca tcttcacaat tctaattcta 9120

ctgactatcc tagaaatcgc tgtcgcctta atccaagcct acgttttcac acttctagta 9180

agcctctacc tgcacgacaa cacataatga cccaccaatc acatgcctat catatagtaa 9240

aacccagccc atgaccccta acaggggccc tctcagccct cctaatgacc tccggcctag9300

ccatgtgatt tcacttccac tccataacgc tcctcatact aggcctacta accaacacac 9360

taaccatata ccaatgatgg cgcgatgtaa cacgagaaag cacataccaa ggccaccaca 9420

caccacctgt ccaaaaaggc cttcgatacg ggataatcct atttattacc tcagaagttt 9480

ttttcttcgc aggatttttc tgagcctttt accactccag cctagcccct accccccaat 9540

taggagggca ctggccccca acaggcatca ccccgctaaa tcccctagaa gtcccactcc 9600

taaacacatc cgtattactc gcatcaggag tatcaatcac ctgagctcac catagtctaa 9660

tagaaaacaa ccgaaaccaa ataattcaag cactgcttat tacaatttta ctgggtctct 9720

attttaccct cctacaagcc tcagagtact tcgagtctcc cttcaccatt tccgacggca 9780

tctacggctc aacatttttt gtagccacag gcttccacgg acttcacgtc attattggct 9840

caactttcct cactatctgc ttcatccgcc aactaatatt tcactttaca tccaaacatc 9900

actttggctt cgaagccgcc gcctgatact ggcattttgt agatgtggtt tgactatttc 9960

tgtatgtctc catctattga tgagggtctt actcttttag tataaatagt accgttaact 10020

tccaattaac tagttttgac aacattcaaa aaagagtaat aaacttcgcc ttaattttaa 10080

taatcaacac cctcctagcc ttactactaa taattattac attttgacta ccacaactca 10140

acggctacat agaaaaatcc accccttacg agtgcggctt cgaccctata tcccccgccc10200

gcgtcccttt ctccataaaa ttcttcttag tagctattac cttcttatta tttgatctag 10260

aaattgccct ccttttaccc ctaccatgag ccctacaaac aactaacctg ccactaatag 10320

ttatgtcatc cctcttatta atcatcatcc tagccctaag tctggcctat gagtgactac 10380

aaaaaggatt agactgaacc gaattggtat atagtttaaa caaaacgaat gatttcgact 10440

cattaaatta tgataatcat atttaccaaa tgcccctcat ttacataaat attatactag 10500

catttaccat ctcacttcta ggaatactag tatatcgctc acacctcata tcctccctac 10560

tatgcctaga aggaataata ctatcgctgt tcattatagc tactctcata accctcaaca 10620

cccactccct cttagccaat attgtgccta ttgccatact agtctttgcc gcctgcgaag 10680

cagcggtggg cctagcccta ctagtctcaa tctccaacac atatggccta gactacgtac 10740

ataacctaaa cctactccaa tgctaaaact aatcgtccca acaattatat tactaccact 10800

gacatgactt tccaaaaaac acataatttg aatcaacaca accacccaca gcctaattat10860

tagcatcatc cctctactat tttttaacca aatcaacaac aacctattta gctgttcccc 10920

aaccttttcc tccgaccccc taacaacccc cctcctaata ctaactacct gactcctacc 10980

cctcacaatc atggcaagcc aacgccactt atccagtgaa ccactatcac gaaaaaaact11040

ctacctctct atactaatct ccctacaaat ctccttaatt ataacattca cagccacaga 11100

actaatcata ttttatatct tcttcgaaac cacacttatc cccaccttgg ctatcatcac 11160

ccgatgaggc aaccagccag aacgcctgaa cgcaggcaca tacttcctat tctacaccct 11220

agtaggctcc cttcccctac tcatcgcact aatttacact cacaacaccc taggctcact 11280

aaacattcta ctactcactc tcactgccca agaactatca aactcctgag ccaacaactt 11340

aatatgacta gcttacacaa tagcttttat agtaaagata cctctttacg gactccactt 11400

atgactccct aaagcccatg tcgaagcccc catcgctggg tcaatagtac ttgccgcagt 11460

actcttaaaa ctaggcggct atggtataat acgcctcaca ctcattctca accccctgac 11520

aaaacacata gcctacccct tccttgtact atccctatga ggcataatta taacaagctc 11580

catctgccta cgacaaacag acctaaaatc gctcattgca tactcttcaa tcagccacat 11640

agccctcgta gtaacagcca ttctcatcca aaccccctga agcttcaccg gcgcagtcat 11700

tctcataatc gcccacgggc ttacatcctc attactattc tgcctagcaa actcaaacta 11760

cgaacgcact cacagtcgca tcataatcct ctctcaagga cttcaaactc tactcccact 11820

aatagctttt tgatgacttc tagcaagcct cgctaacctc gccttacccc ccactattaa 11880

cctactggga gaactctctg tgctagtaac cacgttctcc tgatcaaata tcactctcct 11940

acttacagga ctcaacatac tagtcacagc cctatactcc ctctacatat ttaccacaac 12000

acaatggggc tcactcaccc accacattaa caacataaaa ccctcattca cacgagaaaa 12060

caccctcatg ttcatacacc tatcccccat tctcctccta tccctcaacc ccgacatcat 12120

taccgggttt tcctcttgta aatatagttt aaccaaaaca tcagattgtg aatctgacaa 12180

cagaggctta cgacccctta tttaccgaga aagctcacaa gaactgctaa ctcatgcccc 12240

catgtctaac aacatggctt tctcaacttt taaaggataa cagctatcca ttggtcttag 12300

gccccaaaaa ttttggtgca actccaaata aaagtaataa ccatgcacac tactataacc 12360

accctaaccc tgacttccct aattcccccc atccttacca ccctcgttaa ccctaacaaa 12420

aaaaactcat acccccatta tgtaaaatcc attgtcgcat ccacctttat tatcagtctc 12480

ttccccacaa caatattcat gtgcctagac caagaagtta ttatctcgaa ctgacactga 12540

gccacaaccc aaacaaccca gctctcccta agcttcaaac tagactactt ctccataata 12600

ttcatccctg tagcattgtt cgttacatgg tccatcatag aattctcact gtgatatata 12660

aactcagacc caaacattaa tcagttcttc aaatatctac tcatcttcct aattaccata 12720

ctaatcttag ttaccgctaa caacctattc caactgttca tcggctgaga gggcgtagga 12780

attatatcct tcttgctcat cagttgatga tacgcccgag cagatgccaa cacagcagcc 12840

attcaagcaa tcctatacaa ccgtatcggc gatatcggtt tcatcctcgc cttagcatga 12900

tttatcctac actccaactc atgagaccca caacaaatag cccttctaaa cgctaatcca 12960

agcctcaccc cactactagg cctcctccta gcagcagcag gcaaatcagc ccaattaggt 13020

ctccacccct gactcccctc agccatagaa ggccccaccc cagtctcagc cctactccac 13080

tcaagcacta tagttgtagc aggaatcttc ttactcatcc gcttccaccc cctagcagaa 13140

aatagcccac taatccaaac tctaacacta tgcttaggcg ctatcaccac tctgttcgca 13200

gcagtctgcg cccttacaca aaatgacatc aaaaaaatcg tagccttctc cacttcaagt 13260

caactaggac tcataatagt tacaatcggc atcaaccaac cacacctagc attcctgcac 13320

atctgtaccc acgccttctt caaagccata ctatttatgt gctccgggtc catcatccac 13380

aaccttaaca atgaacaaga tattcgaaaa ataggaggac tactcaaaac catacctctc 13440

acttcaacct ccctcaccat tggcagccta gcattagcag gaataccttt cctcacaggt 13500

ttctactcca aagaccacat catcgaaacc gcaaacatat catacacaaa cgcctgagcc 13560

ctatctatta ctctcatcgc tacctccctg acaagcgcct atagcactcg aataattctt 13620

ctcaccctaa caggtcaacc tcgcttcccc acccttacta acattaacga aaataacccc 13680

accctactaa accccattaa acgcctggca gccggaagcc tattcgcagg atttctcatt 13740

actaacaaca tttcccccgc atcccccttc caaacaacaa tccccctcta cctaaaactc 13800

acagccctcg ctgtcacttt cctaggactt ctaacagccc tagacctcaa ctacctaacc 13860

aacaaactta aaataaaatc cccactatgc acattttatt tctccaacat actcggattc 13920

taccctagca tcacacaccg cacaatcccc tatctaggcc ttcttacgag ccaaaacctg 13980

cccctactcc tcctagacct aacctgacta gaaaagctat tacctaaaac aatttcacag 14040

caccaaatct ccacctccat catcacctca acccaaaaag gcataattaa actttacttc 14100

ctctctttct tcttcccact catcctaacc ctactcctaa tcacataacc tattcccccg 14160

agcaatctca attacaatat atacaccaac aaacaatgtt caaccagtaa ctactactaa 14220

tcaacgccca taatcataca aagcccccgc accaatagga tcctcccgaa tcaaccctga 14280

cccctctcct tcataaatta ttcagcttcc tacactatta aagtttacca caaccaccac 14340

cccatcatac tctttcaccc acagcaccaa tcctacctcc atcgctaacc ccactaaaac 14400

actcaccaag acctcaaccc ctgaccccca tgcctcagga tactcctcaa tagccatcgc 14460

tgtagtatat ccaaagacaa ccatcattcc ccctaaataa attaaaaaaa ctattaaacc 14520

catataacct cccccaaaat tcagaataat aacacacccg accacaccgc taacaatcaa 14580

tactaaaccc ccataaatag gagaaggctt agaagaaaac cccacaaacc ccattactaa 14640

acccacactc aacagaaaca aagcatacat cattattctc gcacggacta caaccacgac 14700

caatgatatg aaaaaccatc gttgtatttc aactacaaga acaccaatga ccccaatacg 14760

caaaactaac cccctaataa aattaattaa ccactcattc atcgacctcc ccaccccatc 14820

caacatctcc gcatgatgaa acttcggctc actccttggc gcctgcctga tcctccaaat 14880

caccacagga ctattcctag ccatgcacta ctcaccagac gcctcaaccg ccttttcatc 14940

aatcgcccac atcactcgag acgtaaatta tggctgaatc atccgctacc ttcacgccaa 15000

tggcgcctca atattcttta tctgcctctt cctacacatc gggcgaggcc tatattacgg 15060

atcatttctc tactcagaaa cctgaaacat cggcattatc ctcctgcttg caactatagc 15120

aacagccttc ataggctatg tcctcccgtg aggccaaata tcattctgag gggccacagt 15180

aattacaaac ttactatccg ccatcccata cattgggaca gacctagttc aatgaatctg 15240

aggaggctac tcagtagaca gtcccaccct cacacgattc tttacctttc acttcatctt 15300

gcccttcatt attgcagccc tagcaacact ccacctccta ttcttgcacg aaacgggatc 15360

aaacaacccc ctaggaatca cctcccattc cgataaaatc accttccacc cttactacac 15420

aatcaaagac gccctcggct tacttctctt ccttctctcc ttaatgacat taacactatt 15480

ctcaccagac ctcctaggcg acccagacaa ttatacccta gccaacccct taaacacccc 15540

tccccacatc aagcccgaat gatatttcct attcgcctac acaattctcc gatccgtccc 15600

taacaaacta ggaggcgtcc ttgccctatt actatccatc ctcatcctag caataatccc 15660

catcctccat atatccaaac aacaaagcat aatatttcgc ccactaagcc aatcacttta 15720

ttgactccta gccgcagacc tcctcattct aacctgaatc ggaggacaac cagtaagcta 15780

cccttttacc atcattggac aagtagcatc cgtactatac ttcacaacaa tcctaatcct 15840

aataccaact atctccctaa ttgaaaacaa aatactcaaa tgggcctgtc cttgtagtat 15900

aaactaatac accagtcttg taaaccggag atgaaaacct ttttccaagg acaaatcaga 15960

gaaaaagtct ttaactccac cattagcacc caaagctaag attctaattt aaactattct 16020

ctgttctttc atggggaagc agatttgggt accacccaag tattgactca cccatcaaca 16080

accgctatgt atttcgtaca ttactgccag ccaccatgaa tattgtacgg taccataaat 16140

acttgaccac ctgtagtaca taaaaaccca atccacatca aaaccccctc cccatgctta 16200

caagcaagta cagcaatcaa ccctcaacta tcacacatca actgcaactc caaagccacc 16260

cctcacccac taggatacca acaaacctac ccacccttaa cagtacatag tacataaagc 16320

catttaccgt acatagcaca ttacagtcaa atcccttctc gtccccatgg atgacccccc 16380

tcagataggg gtcccttgac caccatcctc cgtgaaatca atatcccgca caagagtgct 16440

actctcctcg ctccgggccc ataacacttg ggggtagcta aagtgaactg tatccgacat 16500

ctggttccta cttcagggtc ataaagccta aatagcccac acgttcccct taaataagac 16560

atcacgatg 16569

Claims (2)

1. the plastosome T3866C detection kit of a Leber disease, be made up of the PCR mixed solution (2) of the DNA extraction mixed solution (1) be placed in box body (8), amplification T3866C, a pair outer primer (3) designed for T3866C, a pair inner primer (4) designed for T3866C, restriction enzyme (5), positive control (6) and negative control (7), wherein DNA extraction mixed solution (1) is made up of cell pyrolysis liquid and solution I, and the PCR mixed solution of amplification T3866C is by deoxymononucleotide, 10 × PCR damping fluid, MgCl ₂, tri-distilled water and archaeal dna polymerase composition, it is characterized in that, a pair outer primer for T3866C design has outer forward direction primers F: TACTTCACAAAGCGCCTTCC and outer reverse primer R:AAGGATTATGGATGCGGTTG, a pair inner primer for T3866C design has interior forward direction primers F: CAACACAAGAACACCTCTGATTACTCCTGCCAT CATGACCCTTGGCCATAATATGATAGA and interior reverse primer R:GAGAGTGCGTCATATGTTGTTCCT AGGAAGA, restriction enzyme is restriction enzyme bgliI, positive control (6) is that the enzyme containing mtDNA sequence the 3866th site generation T>C sudden change cuts sample, negative control (7) is that the enzyme not containing mtDNA sequence the 3866th site generation T>C sudden change cuts sample, and the composition of solution I is Proteinase K.

2. the plastosome T3866C detection kit of a kind of Leber disease according to claim 1, is characterized in that, adds 0.1-0.2 μ l dimethyl sulfoxide (DMSO) in the PCR mixed solution (2) of amplification T3866C.