CN103290109B - Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof - Google Patents
Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof Download PDFInfo
- Publication number
- CN103290109B CN103290109B CN201310133673.XA CN201310133673A CN103290109B CN 103290109 B CN103290109 B CN 103290109B CN 201310133673 A CN201310133673 A CN 201310133673A CN 103290109 B CN103290109 B CN 103290109B
- Authority
- CN
- China
- Prior art keywords
- primer
- dna
- pcr
- kit
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 230000035772 mutation Effects 0.000 title abstract description 10
- 206010020772 Hypertension Diseases 0.000 title description 9
- 230000002438 mitochondrial effect Effects 0.000 title description 6
- 108020005196 Mitochondrial DNA Proteins 0.000 claims abstract description 42
- 208000007530 Essential hypertension Diseases 0.000 claims abstract description 24
- 108091008146 restriction endonucleases Proteins 0.000 claims abstract description 24
- 108010067770 Endopeptidase K Proteins 0.000 claims abstract description 9
- 239000013641 positive control Substances 0.000 claims abstract description 8
- 238000007400 DNA extraction Methods 0.000 claims abstract description 7
- 239000013642 negative control Substances 0.000 claims abstract description 7
- 230000008859 change Effects 0.000 claims description 40
- 102000004190 Enzymes Human genes 0.000 claims description 26
- 108090000790 Enzymes Proteins 0.000 claims description 26
- 238000013461 design Methods 0.000 claims description 22
- 238000012360 testing method Methods 0.000 claims description 19
- 239000011259 mixed solution Substances 0.000 claims description 15
- IAZDPXIOMUYVGZ-UHFFFAOYSA-N Dimethylsulphoxide Chemical compound CS(C)=O IAZDPXIOMUYVGZ-UHFFFAOYSA-N 0.000 claims description 12
- 239000000243 solution Substances 0.000 claims description 10
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 claims description 8
- 239000012153 distilled water Substances 0.000 claims description 6
- 239000007788 liquid Substances 0.000 claims description 6
- 238000000197 pyrolysis Methods 0.000 claims description 6
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 4
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 4
- ISWSIDIOOBJBQZ-UHFFFAOYSA-N Phenol Chemical compound OC1=CC=CC=C1 ISWSIDIOOBJBQZ-UHFFFAOYSA-N 0.000 claims description 4
- 230000002596 correlated effect Effects 0.000 claims description 4
- 238000013016 damping Methods 0.000 claims description 4
- 239000012530 fluid Substances 0.000 claims description 4
- 108020004414 DNA Proteins 0.000 abstract description 31
- 238000000034 method Methods 0.000 abstract description 31
- 238000001514 detection method Methods 0.000 abstract description 25
- 210000004209 hair Anatomy 0.000 abstract description 16
- 210000003296 saliva Anatomy 0.000 abstract description 16
- 239000008280 blood Substances 0.000 abstract description 14
- 210000004369 blood Anatomy 0.000 abstract description 13
- 210000003780 hair follicle Anatomy 0.000 abstract description 11
- 238000007790 scraping Methods 0.000 abstract description 10
- 230000008569 process Effects 0.000 abstract description 9
- 210000002200 mouth mucosa Anatomy 0.000 abstract description 8
- 230000029087 digestion Effects 0.000 abstract description 5
- 238000000605 extraction Methods 0.000 abstract description 5
- 230000008901 benefit Effects 0.000 abstract description 3
- 208000002193 Pain Diseases 0.000 abstract description 2
- 230000005540 biological transmission Effects 0.000 abstract description 2
- 230000036407 pain Effects 0.000 abstract description 2
- 238000003776 cleavage reaction Methods 0.000 abstract 1
- 238000001976 enzyme digestion Methods 0.000 abstract 1
- 230000007017 scission Effects 0.000 abstract 1
- 239000000523 sample Substances 0.000 description 30
- 230000003321 amplification Effects 0.000 description 16
- 238000003199 nucleic acid amplification method Methods 0.000 description 16
- 238000012408 PCR amplification Methods 0.000 description 14
- 108090000623 proteins and genes Proteins 0.000 description 14
- 238000012797 qualification Methods 0.000 description 10
- 210000004027 cell Anatomy 0.000 description 8
- 239000003153 chemical reaction reagent Substances 0.000 description 8
- 230000000869 mutational effect Effects 0.000 description 8
- 238000007857 nested PCR Methods 0.000 description 8
- 238000005516 engineering process Methods 0.000 description 7
- 239000000284 extract Substances 0.000 description 7
- 208000024172 Cardiovascular disease Diseases 0.000 description 6
- 241000282414 Homo sapiens Species 0.000 description 6
- 238000006243 chemical reaction Methods 0.000 description 6
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 6
- 239000012634 fragment Substances 0.000 description 6
- 239000000047 product Substances 0.000 description 6
- 238000012163 sequencing technique Methods 0.000 description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 5
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 4
- 238000007605 air drying Methods 0.000 description 4
- 230000000875 corresponding effect Effects 0.000 description 4
- 238000005336 cracking Methods 0.000 description 4
- 201000010099 disease Diseases 0.000 description 4
- 210000003743 erythrocyte Anatomy 0.000 description 4
- 239000002773 nucleotide Substances 0.000 description 4
- 125000003729 nucleotide group Chemical group 0.000 description 4
- 229920000742 Cotton Polymers 0.000 description 3
- 206010011878 Deafness Diseases 0.000 description 3
- 206010064571 Gene mutation Diseases 0.000 description 3
- 238000000137 annealing Methods 0.000 description 3
- 239000002585 base Substances 0.000 description 3
- 239000000872 buffer Substances 0.000 description 3
- 231100000895 deafness Toxicity 0.000 description 3
- 208000016354 hearing loss disease Diseases 0.000 description 3
- 230000001631 hypertensive effect Effects 0.000 description 3
- 238000007689 inspection Methods 0.000 description 3
- 230000008774 maternal effect Effects 0.000 description 3
- 210000000214 mouth Anatomy 0.000 description 3
- 238000002703 mutagenesis Methods 0.000 description 3
- 231100000350 mutagenesis Toxicity 0.000 description 3
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 230000009182 swimming Effects 0.000 description 3
- 238000012546 transfer Methods 0.000 description 3
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 description 2
- 230000036772 blood pressure Effects 0.000 description 2
- 238000010241 blood sampling Methods 0.000 description 2
- 208000029078 coronary artery disease Diseases 0.000 description 2
- 230000006378 damage Effects 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000011010 flushing procedure Methods 0.000 description 2
- 238000013467 fragmentation Methods 0.000 description 2
- 238000006062 fragmentation reaction Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 230000036541 health Effects 0.000 description 2
- 239000012535 impurity Substances 0.000 description 2
- 210000000265 leukocyte Anatomy 0.000 description 2
- 230000002934 lysing effect Effects 0.000 description 2
- 210000003470 mitochondria Anatomy 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 230000008506 pathogenesis Effects 0.000 description 2
- 239000008188 pellet Substances 0.000 description 2
- 239000002504 physiological saline solution Substances 0.000 description 2
- 230000001376 precipitating effect Effects 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 238000005185 salting out Methods 0.000 description 2
- 230000001954 sterilising effect Effects 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 208000031229 Cardiomyopathies Diseases 0.000 description 1
- 206010008190 Cerebrovascular accident Diseases 0.000 description 1
- 238000000018 DNA microarray Methods 0.000 description 1
- 206010019280 Heart failures Diseases 0.000 description 1
- 125000003338 L-glutaminyl group Chemical group O=C([*])[C@](N([H])[H])([H])C([H])([H])C([H])([H])C(=O)N([H])[H] 0.000 description 1
- 208000006011 Stroke Diseases 0.000 description 1
- 239000007984 Tris EDTA buffer Substances 0.000 description 1
- 239000003513 alkali Substances 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000000890 antigenic effect Effects 0.000 description 1
- 210000004204 blood vessel Anatomy 0.000 description 1
- 235000019504 cigarettes Nutrition 0.000 description 1
- 239000013068 control sample Substances 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 238000002405 diagnostic procedure Methods 0.000 description 1
- 230000008034 disappearance Effects 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 238000004043 dyeing Methods 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 230000002526 effect on cardiovascular system Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000007849 functional defect Effects 0.000 description 1
- 208000019622 heart disease Diseases 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 238000009434 installation Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 239000003471 mutagenic agent Substances 0.000 description 1
- 231100000707 mutagenic chemical Toxicity 0.000 description 1
- 230000003505 mutagenic effect Effects 0.000 description 1
- 238000011330 nucleic acid test Methods 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 239000008363 phosphate buffer Substances 0.000 description 1
- 229920002401 polyacrylamide Polymers 0.000 description 1
- 238000002203 pretreatment Methods 0.000 description 1
- 230000003449 preventive effect Effects 0.000 description 1
- 238000012827 research and development Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 230000000391 smoking effect Effects 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 229940034610 toothpaste Drugs 0.000 description 1
- 239000000606 toothpaste Substances 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for detecting mitochondrial DNA T4353C mutation linked to primary hypertension. The kit is composed of DNA extraction mixed liquor, PCR mixed liquor, outer primers and inner primers specifically designed for T4353C, restriction endonuclease, a positive control, a negative control and a kit body. According to the invention, genomic DNAs are rapidly extracted from samples like a small amount of a blood specimen, hair with hair follicles, a mouth mucosa scraping smear and saliva by using a protease K digestion cleavage process, so problems in extraction of DNAs from blood of a patient with primary hypertension in the prior art are overcome, pains of a detected person are alleviated, and trans-regional sample transmission is realized; different sites formed by the specific restriction endonuclease enable specificity of enzyme digestion to be improved; the phenomenon of false negative results is avoided, and stability of detection results is improved; and the kit has the advantages of low detection cost, simple and fast detection flow, visually interpretable results and good practicality.
Description
Technical field
The invention belongs to biological technical field, relating to the test kit suddenlyd change for detecting the Mitochondrial DNA T4353C relevant to essential hypertension, also relating to a kind of detection method of the mitochondrial gene mutation relevant to essential hypertension, particularly detect mitochondrial tRNA
glnthe method of T4353C sudden change, and aforesaid method or above-mentioned test kit are detecting the application in the Mitochondrial DNA T4353C sudden change relevant to essential hypertension.
Background technology
Cardiovascular disorder is the murderous main reason of global range, comprises a series of diseases relating to the recycle system (mainly heart and blood vessel) such as coronary heart disease, hypertension, heart trouble, apoplexy, myocardosis and heart failure.The World Health Organization (WHO) adds up, and within 2008, about has 1,730 ten thousand people to die from cardiovascular diseases, accounts for 30% of global dead population." Chinese cardiovascular diseases report 2011 " display, current China cardiovascular patient up to 2.3 hundred million, wherein hyperpietic 1.6 hundred million.Annual about 3,000,000 people die from cardiovascular disorder, wherein coronary heart disease death number about 1,000,000.Cardiovascular disorder has become the serious health safety issues of China, brings great burden to country and society.Cardiovascular disorder is a quasi-complexity disease, by inherited genetic factors, environmental factors or caused by both interact.Part high blood pressure disease is maternal inheritance characteristics, and prompting mtDNA may be one of molecular basis of these high blood pressure diseases morbidity extremely.Over the past two years, our subject study group found that essential hypertension and Mitochondrial DNA (Mitochondria DNA, mtDNA) suddenlyd change and there is dependency.Late Cambrian to be caused the pathogenesis of essential hypertension by the chondriogen functional defect of matrilinear inheritance in the world.These genetic flaws comprise tRNA
ilea4263G, tRNA
glnt4353C, tRNA
gln/ tRNA
meta4401G, tRNA
meta4435G, tRNA
alathe sudden changes such as T5655C, have annotated the hypertensive pathogenesis of matrilinear inheritance, for hypertensive early diagnosis, intervention and control provide new theoretical foundation.
Self-discovery has suddenlyd change since relevant disease to mtDNA, the main still sequencing of detection method in detection line plastochondria mutational site.Direct sequencing is the golden standard of qualification sudden change, but this complex operation, and somewhat expensive limits its widespread use.
In recent years, domestic in succession reporting detects the relevant technology of mitochondrial mutations, to meet needs mitochondrial mutations being carried out to extensive examination, as " detection method of matrilineal inherited deafness chondriogen 1555 A → G sudden changes and test kit thereof " (publication number: CN1490415) of people's research and development such as Dai Piao, " for probe detecting matrilinear inheritance chondriosome deafness gene A 1555 G and uses thereof " (publication number: CN1987462), " for Taqman MGB probe detecting matrilinear inheritance chondriosome deafness gene C 1494 T mutation and uses thereof " (publication number: CN1987463).Although these detection methods reduce cost to a certain extent, operation steps is easy not enough, can not detect that mtDNA A1555G and C1494T suddenlys change simultaneously; To some degree, testing cost or higher, this is still a no small spending concerning the people of many families Ji difficulty.You Sida bio tech ltd, Hangzhou in 2006 sets up a kind of with the method (patent No.: 200610003429. 1) of G11778A site mutation in single nucleotide polymorphism nucleic acid test paper rapid detection LHON Mitochondrial DNA.When applying single nucleotide polymorphism (SNP) nucleic acid detection test strip and carrying out the detection in polymorphic site or mutational site, the extension primer that a specific requirements is higher need be designed, 3 ' end base of this primer is close to polymorphic base or mutating alkali yl, it starts to extend under the effect of archaeal dna polymerase, now utilizes and is connected on extension primer with two deoxymononucleotides (ddNTP) that antigenic mark is corresponding with template.Although the method can realize the positive site of detection in the short period of time, pcr amplification condition is strict, and there is false-negative probability increases greatly.Traditionally, the method obtaining primary hypertension patient genomic dna extracts from blood, and everyone approximately needs 3 ~ 5ml.This blood-sampling method brings some painful and injuries to a lot of examinee especially infant, and there is certain risk and trouble when trans-regional transfer samples.Therefore, in the urgent need to a kind of method and a kind of quick, easy, accurate, economic plastosome associated gene mutation detection method of the acquisition primary hypertension patient genomic dna to human body fanout free region, no pain, to meet needs mitochondrial gene mutation being carried out to extensive examination.
Summary of the invention
The object of the invention is for detecting tRNA at present
glnthe shortcoming existing for method of T4353C sudden change, the test kit that the Mitochondrial DNA T4353C providing a kind of quick, easy, accurate, economic detection essential hypertension to be correlated with suddenlys change.(see figure 5)
Test kit provided by the invention, is made up of the PCR mixed solution of DNA extraction mixed solution, amplification T4353C fragment, a pair outer primer designed for T4353C, a pair inner primer, restriction enzyme, positive control, negative control and the box body that design for T4353C.Wherein, extract DNA extraction mixed solution to form primarily of cell pyrolysis liquid and solution I; The PCR mixed solution reagent of amplification T4353C fragment comprises dNTP (deoxymononucleotide), 10 × PCR damping fluid, MgCl
2, tri-distilled water and
taqenzyme (archaeal dna polymerase), outer primer for T4353C design comprises outer forward direction primers F: TGGCTCCTTTAACCTCTC CA (SEQ ID NO:1), outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); Inner primer for T4353C design comprises interior forward direction primers F: TGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTA GGACTATGAGAATCG AACGGA (SEQ ID NO:3), interior reverse primer R:ATGGTAGAGTAGATGACGGGTT (SEQ ID NO:4); Restriction enzyme comprises restriction enzyme
bamHi; Positive control is that the enzyme containing mtDNA sequence the 4353rd site generation T>C sudden change cuts sample; Negative control is that the enzyme not containing mtDNA sequence the 4353rd site generation T>C sudden change cuts sample.Solution I is made up of Proteinase K, chloroform, phenol, raw spirit.
In mentioned reagent box, add for improving the specific a little dimethyl sulfoxide (DMSO) of extension (0.1-0.2 μ l is advisable) in the PCR mixed solution of amplification T4353C.
Another object of the present invention is to provide described test kit and is detecting the chondriogen relevant to essential hypertension
nD1application in T4353C sudden change.Realized by following steps:
(1) extraction of genomic dna: use protease K digesting cracking process, extracts genomic dna from the sample of the hair of a small amount of blood preparation, band hair follicle, oral mucosa scraping blade or saliva;
(2) specific PCR amplification: use Primer 5.0 software and the primers F designed by the homo mitochondrion gene sequence of Oligo7.0 software according to SEQ ID NO:5
outward/ R
outward, F
in/ R
inthe fragment that can amplify the mitochondrial mutations site comprising above-mentioned essential hypertension, F is outer/R outside amplify Nucleotide 3777-4679 into Mitochondrial DNA, its sequence is the SEQ ID NO:1,2 in sequence table; In F/R in amplify Nucleotide 4291-4507 into Mitochondrial DNA, its sequence is the SEQ ID NO:3,4 in sequence table
(3) enzyme cuts qualification: by above-mentioned PCR primer restriction enzyme
bamHi pair of T4353C mutational site place carries out enzyme and cuts;
(4) abrupt climatic change: polyacrylamide gel electrophoresis detects, directly cuts DNA fragmentation quantity and the DNA fragmentation size of PCR primer generation according to enzyme, detect mtDNA and whether T4353C sudden change occurs.
In the method that above-mentioned detection mtDNA T4353C suddenlys change, can from the sample of blood specimen (as bleeds), the band hair of hair follicle, oral mucosa scraping blade or saliva rapid extraction genomic dna, according to sampling mode or tested sample form difference, carry out corresponding pre-treatment to different sample, treatment process is as follows:
(1) blood specimen (as bleeds): get a small amount of blood specimen of 20 ~ 200 μ l (as bleeds) or 1cm
2blood filter paper put into 1.5ml EP manage (centrifuge tube), add 900 μ l erythrocyte lysing buffer (20mmol/L Tris-HCl, pH 7.6) (tris-HCI buffer) room temperature leaves standstill 10min, abundant splitting erythrocyte, the centrifugal 1min of 12000rpm, collects leukocyte cell pellet;
(2) be with the hair of hair follicle: wash the hair 1 time being with hair follicle with 70% ethanol, after use distilled water flushing hair again 2 times.In 1.5ml EP pipe, put into 2 ~ 4 hairs respectively, hair follicle is placed in bottom EP pipe, cuts off the part of hair higher than EP pipe with clean scissors;
(3) oral mucosa scraping blade or saliva: before collecting saliva, the person of being collected must be allowed to gargle.To remove the materials such as aged cells too much in oral cavity, swill, toothpaste, coffee, cigarette.Do not drink water in half an hour, take food, smoking, then start to collect oral mucosa scraping blade or saliva, visual condition select following method collect saliva sample: 1. tongue is around oral cavity scraping mucomembranous cell, about 0.1ml saliva is directly told in EP pipe; 2. physiological saline is gargled, and tells in EP pipe, draws phosphate buffer soln (PBS solution) in the EP pipe that the saliva sample collected by any one method above-mentioned is housed, repeatedly after piping and druming, and the centrifugal 5min of 12000rpm, removing supernatant, repeats this process once; 3. repeatedly scrape cheek inwall 6 times, air drying with cotton swab, then carefully tear its outside surface off with the tweezers of sterilizing, put into EP pipe; 4. saliva is told on filter paper, after air drying, form salivary stain, then be cut into size with clean scissors and be about 1cm
2a scrap of paper is placed in EP pipe.
Then carry out digestion cracking with cell pyrolysis liquid and Proteinase K to above-mentioned sample, utilize salting-out process to remove the impurity such as albumen, isopropanol precipitating DNA, finally saves backup in-20 DEG C with after autoclaving water dissolution.
In embodiments of the invention, the guiding theory of design of primers is, the position existed for mtDNA T4353C site is adjoining, increases in a bar segment, therefore should design the 3' end upstream primer corresponding with 4353 site wild-type T and 4353 site mutation type C; For the downstream primer (with reference to Fig. 2) that 4353 site design 3' ends are corresponding with 4353 site wild-type T and 4353 site mutation type C respectively.
The present inventor is for after specific PCR amplification (Fig. 3), and mtDNA T4353C site defines the disappearance of restriction enzyme site.Restriction enzyme site is suddenlyd change by mtDNA T4353C and causes disappearing, and restriction enzyme is wherein
bamH 1, its site is the SEQ ID NO:3,4 in sequence table.
With the primer of above design, to be detected the DNA of sample accordingly for template, be about the constant amplified band of 216bp by obtaining size limpid in sight after pcr amplification respectively, 4353 mutational sites correspond to the 63rd of amplified fragments.
In the method for above-mentioned detection line mitochondrial genes essential hypertension sudden change, binding specificity round pcr and enzyme incision technology, every part of DNA sample carries out regular-PCR amplification with Auele Specific Primer and primers F/R respectively in PCR reaction tubes, then the enzyme carrying out mutational site place is cut, and the mtDNA T4353C that just can detect essential hypertension relevant in several hours by PCR suddenlys change.
In theory, genomic dna sample reacts through a PCR, namely only adds in system for after the T4353C primers F/R of saltant type site, adds the restriction enzyme newly formed for mutational site
bamHi carries out enzyme cuts, and just can detect.That is, same gene group DNA sample is cut through a PCR-enzyme, thus makes detected result more accurate, credible.
The present inventor is also according to the primer sequence designed in the present invention, primer is obtained by synthetic (entrusting biotech firm), and primer is mixed according to a certain percentage, with extract sample genomic dna reagent, pcr amplification reaction reagent, positive sample contrasts, ' negative ' specimens contrasts and working instructions combine, make the test kit suddenlyd change for vitro detection matrilinear inheritance essential hypertension chondriogen mtDNA T4353C, such that sample DNA extracts, specific PCR amplification and enzyme cut on the reagent basis that can provide at test kit and completed smoothly.Wherein, the reagent of sample DNA is extracted primarily of cell pyrolysis liquid and Proteinase K, chloroform, phenol, raw spirit composition; Pcr amplification reaction reagent comprises dNTP, 10 × PCR damping fluid, MgCl
2, tri-distilled water and Taq enzyme, restriction enzyme comprises restriction enzyme
bamHi.
The chondriogen mtDNA T4353C mutagenesis kit relevant by the vitro detection essential hypertension of method of the present invention and preparation thereof has following characteristics:
1. the method obtaining primary hypertension patient genomic dna traditionally extracts from blood, and everyone approximately needs 3 ~ 5ml.This blood-sampling method brings some painful and injuries to a lot of examinee especially infant, and there is certain risk and trouble when trans-regional transfer samples.The present invention uses protease K digesting cracking process, rapid extraction genomic dna from a small amount of blood preparation (as bleeds), the hair being with hair follicle, oral mucosa scraping blade or saliva equal samples.The method not only solves the problem extracting DNA traditionally from primary hypertension patient blood, alleviates the misery of examinee; But also solving the problem of trans-regional transfer samples, blood filter paper, hair and oral mucosa scraping blade (cotton swab) or salivary stain filter paper etc. can be placed in envelope easily, and the trans-regional transmission of mode by posting.
2. there is the matrilinear inheritance disease gene diagnostic method that several plastosome is relevant both at home and abroad at present, as direct sequencing fluorescent quantitative PCR detection method, gene chip detection method etc., due to the defect of himself, as wasted time and energy, complex operation and testing cost higher and not easily promote clinical.Compared with these methods, PCR-enzyme incision technology then combines the advantage of both specific PCR technology and enzyme incision technology, every part of DNA sample Auele Specific Primer and primers F/R carry out specific PCR amplification in PCR reaction tubes, cut in several hours, just can detect mtDNA T4353C simultaneously suddenly change by PCR-enzyme.It is worth mentioning that in addition, present method primer used is all through carefully design.First, it is different that bases different between normal and mutation allele cuts through at enzyme the site formed specific restriction restriction endonuclease in journey, thus substantially increases the specificity that enzyme is cut; Can be used as by the product of normal control and blank the molecule internal control index that whole PCR reacts in addition, thus avoid the appearance of false negative result, improve the stability of detected result.By adjusting concentration and the ratio of different primers and being optimized PCR reaction conditions, to guarantee specificity and the stability of result.
3. apply test kit provided by the invention and carry out mtDNA T4353C abrupt climatic change, cost is lower compared with other detection methods; Testing process is easy, quick, and result interpretation is directly perceived; To experimental installation and operator without particular requirement, be adapted at general hospital, molecular biosciences labs, be convenient in China extensive examination and preventive inspection that the mtDNA T4353C sudden change that essential hypertension is correlated with is carried out in particularly low developed area.
Accompanying drawing explanation
Fig. 1 is the structural representation of a kind of test kit of the present invention.
Fig. 2 is specificity nido PCR primer schematic diagram of the present invention.
Fig. 3 is specificity nested PCR amplification scheme schematic diagram of the present invention.
Fig. 4 carries T4353C Mutagen Essential hypertension family tree figure.
Fig. 5 is the 7% polyacrylamide gel electrophoresis figure of gene specific nested PCR amplification qualification mtDNA T4353C.
Nomenclature:
In Fig. 2 and 3: F is outward the forward primer of specificity nest-type PRC first time amplification; R is outward the reverse primer of specificity nest-type PRC first time amplification, matches outward use with F; Be the forward primer of specificity nest-type PRC second time amplification in F, be the reverse primer that specificity nest-type PRC increases for the second time in R, uses with matching in F; T4353C is expressed as Mitochondrial DNA the 4353rd, and wild-type is T, is C after producer sudden change.
In Fig. 4: is that normal male is individual; Zero is that normal female is individual; ■ is that affected males is individual; ● be morbidity female individual; ◥ is propositus; / be the individuality of dead; I is the first-generation member of this family; II is the s-generation member of this family; III is the third generation member of this family; IV is the forth generation member of this family.
In Fig. 5: B1 is that mark contrasts band; B2 is positive control person; B3 is the daughter-in-law (III-2) of propositus; B4 is the grandson (IV-1) of propositus the elder son family; B5 is the grandson (IV-2) of propositus second son family; B6 represents that propositus carries the electrophorogram that the pcr amplification product enzyme detected in T4353C mutational site cuts qualification; B7 is the son (III-1) of the propositus carrying T4353C sudden change; B8 is the daughter (III-6) of propositus; B9 represents the electrophorogram cut through the non-enzyme of pcr amplification product.
Embodiment
Below in conjunction with the drawings and specific embodiments, the invention will be further described, can better understand the present invention and can be implemented, but illustrated embodiment is not as a limitation of the invention to make those skilled in the art.
A kind of test kit of embodiment 1 the present invention
See Fig. 1, test kit provided by the invention, be made up of the PCR mixed solution 2 of DNA extraction mixed solution 1, amplification T4353C fragment, a pair outer primer 3 designed for T4353C, the inner primer 4, restriction enzyme 5, positive control 6, negative control 7 and the box body 8 that design for T4353C, wherein, extract DNA extraction mixed solution 1 to form primarily of cell pyrolysis liquid and solution I, solution I is containing Proteinase K, chloroform, phenol, raw spirit; The PCR mixed solution 2 of amplification T4353C fragment comprises dNTP (deoxymononucleotide), 10 × PCR damping fluid, MgCl
2, tri-distilled water and
taqenzyme (archaeal dna polymerase), the outer primer 3 for T4353C design has outer forward direction primers F: TGGCTCCTTTAACCTCTC CA (SEQ ID NO:1) and outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); A pair inner primer 4 for T4353C design has interior forward direction primers F: TGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTA GGACTATGAGAATCG AACGGA (SEQ ID NO:3) and interior reverse primer R:ATGGTAGAGTAGATGACGGGTT (SEQ ID NO:4); Restriction enzyme 5 comprises restriction enzyme
bamHi; Positive control 6 is that the enzyme containing mtDNA sequence the 4353rd site generation T>C sudden change cuts sample; Negative control 7 is that the enzyme not containing mtDNA sequence the 4353rd site generation T>C sudden change cuts sample.
In mentioned reagent box, add for improving the specific a little dimethyl sulfoxide (DMSO) of extension (0.1-0.2 μ l is advisable) in the PCR mixed solution 2 of amplification T4353C.
Embodiment 2 carries mitochondrial tRNA
alathe detection of the essential hypertension family of T4353C sudden change
1. detection sample
See Fig. 4, select 1 essential hypertension family of carrying T4353C sudden change.This family presents typical matrilinear inheritance, send out patient all with the clinical symptom that elevation of blood pressure is unique, but in family each morbidity member elevation of blood pressure varying degree.This family total number of persons is 28 people, and wherein maternal number of members is 13 people, and hypertensive has 7 people.
2. the extraction of genomic dna
The sample obtaining 6 persons under inspection respectively (comprises capillary vessel venous blood filter paper of collection II-2, III-1; III-2, III-6 is oral mucosa scraping blade or saliva; IV-1, IV-2 is the hair being with hair follicle), blood filter paper is cut into clean scissors a scrap of paper that size is about 1cm2 put into 1.5ml EP and manage (Eppendorf pipe), add 900 μ l erythrocyte lysing buffer (20mmol/L Tris-HCl, pH 7.6) room temperature leaves standstill 10min, abundant splitting erythrocyte, the centrifugal 1min of 12000rpm, collects leukocyte cell pellet; Collect saliva sample: 1. tongue is around oral cavity scraping mucomembranous cell, about 0.1ml saliva is directly told in EP pipe; 2. physiological saline is gargled, and tells in EP pipe, draws PBS solution in the EP pipe that the saliva sample collected by any one method above-mentioned is housed, repeatedly after piping and druming, and the centrifugal 5min of 12000rpm, removing supernatant, repeats this process once; 3. repeatedly scrape cheek inwall 6 times, air drying with cotton swab, then carefully tear its outside surface off with the tweezers of sterilizing, put into EP pipe; 4. saliva is told on filter paper, after air drying, form salivary stain, then be cut into size with clean scissors and be about 1cm
2a scrap of paper is placed in EP pipe; The hair 1 time of band hair follicle washed by hair swatch with hair follicle 70% ethanol, after use distilled water flushing hair again 2 times.In 1.5ml EP pipe, put into 2 ~ 4 hairs respectively, hair follicle is placed in bottom EP pipe, cuts off the part of hair higher than EP pipe with clean scissors.Then add 600 μ l cell pyrolysis liquids, after mixing, add solution I again, make the working concentration of Proteinase K be 20 μ g/ml.The rear 55 DEG C of digestion cracking of abundant mixing, then remove the impurity such as albumen with salting-out process, isopropanol precipitating DNA, finally saves backup in-20 DEG C with after autoclaving water or TE buffer solution.
3. design of primers
Use Primer 5.0 software and Oligo7.0 software assistance to design meliorated primer, design according to published homo mitochondrion gene Cambridge reference sequences (SEQ ID NO:5), the design (see figure 2) of primer is as follows:
For mtDNA 4353 site, ensure the specificity of design of primers, outside we design nest-type PRC two pairs of primers F outer/R, in F/R in; The close experiment condition of being convenient to of their length, annealing temperature is stablized, to strengthen specificity.The nest-type PRC primer in 4263 sites designed thus comprises outer forward direction primers F: TGGCTCCTTTAACCTCTC CA (SEQ ID NO:1), outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); Inner primer for T4353C design comprises interior forward direction primers F: TGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTAGGACTATGAGAATCG AACGGA (SEQ ID NO:3), interior reverse primer R:ATGGTAGAGTAGATGACGGGTT (SEQ ID NO:4).
4. gene specific nested PCR amplification
According to 4 primer sequences of above-mentioned design, 2 pairs of primers are obtained by synthetic (entrusting biotech firm), with the tested sample genomic dna of said extracted for template, carry out gene specific nested PCR amplification and 7% polyacrylamide gel electrophoresis enzyme cut qualification (see Fig. 3).
Nest-type PRC loop parameter uses outer primer to be 94 DEG C of denaturation 5min, then 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, after recirculation 30 times, then use inner primer 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, after recirculation 30 times, finally extend 5 min again in 72 DEG C.PCR primer 5 ~ 10 μ l electrophoresis in the polyacrylamide gel of 7%, observes and photographic recording result after EB dyeing on gel imaging instrument.
5. result
According to Fig. 5, when the genomic dna of propositus and normal control sample is respectively through 2 pairs of primers F
outward/ R
outward, F
in/ R
inafter nest-type PRC enzyme cuts qualification, only produce a constant amplified band of 216bp, through restriction enzyme
bamHafter I enzyme cuts qualification, constant being limited property of the amplified band restriction endonuclease of generation is cut into two sections (see Fig. 5 swimming lane B2), proves that propositus's sample does not carry mtDNA T4353C and suddenlys change; And after digestion with restriction enzyme qualification, the constant amplified band of generation being not limited property restriction endonuclease is cut into two sections (see Fig. 5 swimming lane B6), prove that this sample carries mtDNA T4353C and suddenlys change.The genomic dna of family propositus (III-14) is through 2 pairs of primers F
outward/ R
outward, F
in/ R
inafter carrying out nest-type PRC, there is the constant amplified band (see Fig. 5 swimming lane B9) of 1 216bp; And after digestion with restriction enzyme, this band does not have enzyme to cut, demonstrate this sample and carry mtDNA T4353C and suddenly change.B3 is the daughter-in-law (III-2) of propositus; B4 is the grandson (IV-1) of propositus the elder son family; B5 is the grandson (IV-2) of propositus second son family; B6 represents that propositus carries the electrophorogram that the pcr amplification product enzyme detected in T4353C mutational site cuts qualification; B7 is the son (III-1) of the propositus carrying T4353C sudden change; B8 is the daughter (III-6) of propositus; B9 represents the electrophorogram cut through the non-enzyme of pcr amplification product.
6. the inspection of gene specific nested PCR amplification detection method reliability
After gene specific nested PCR amplification enzyme cuts qualification, we detect and carry T4353C sudden change positive individuals in the maternal member of family.Further the pcr amplification product of these samples is carried out sequencing analysis, sequencing result and gene specific nested PCR amplification result match, and the reliability and stability using the inventive method detection line mitochondrial genes T4353C sudden change are described.
Gene specific Nested PCR Technique tool compared with fluorescent quantitative PCR technique, order-checking and biochip technology has the following advantages (see table 2).
The above embodiment is only that protection scope of the present invention is not limited thereto in order to absolutely prove the preferred embodiment that the present invention lifts.The equivalent alternative or conversion that those skilled in the art do on basis of the present invention, all within protection scope of the present invention.
<110> Zhejiang University
<120> detects the relevant plastosome T4353C mutagenesis kit of hypertension and application
<160> 5
<210> 1
<211> 20
<212> DNA
<213> people (homo sapiens)
<400> 1
TGGCTCCTTTAACCTCTCCA
<210> 2
<211> 20
<212> DNA
<213> people (homo sapiens)
<400> 2
AAGGATTATGGATGCGGTTG
<210> 3
<211> 62
<212> DNA
<213> people (homo sapiens)
<400> 3
TGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTAGGACTATGAGAATCGAACGGA
<210> 4
<211> 22
<212> DNA
<213> people (homo sapiens)
<400> 4
ATGGTAGAGTAGATGACGGGTT
<210> 5
<211> 16569
<212> DNA
<213> Homo sapiens
<221> misc_feature
<222> (3107)..(3107)
<223> n is a, c, g, or t
<400> 5
gatcacaggt ctatcaccct attaaccact cacgggagct ctccatgcat ttggtatttt 60
cgtctggggg gtatgcacgc gatagcattg cgagacgctg gagccggagc accctatgtc 120
gcagtatctg tctttgattc ctgcctcatc ctattattta tcgcacctac gttcaatatt 180
acaggcgaac atacttacta aagtgtgtta attaattaat gcttgtagga cataataata 240
acaattgaat gtctgcacag ccactttcca cacagacatc ataacaaaaa atttccacca 300
aaccccccct cccccgcttc tggccacagc acttaaacac atctctgcca aaccccaaaa 360
acaaagaacc ctaacaccag cctaaccaga tttcaaattt tatcttttgg cggtatgcac 420
ttttaacagt caccccccaa ctaacacatt attttcccct cccactccca tactactaat 480
ctcatcaata caacccccgc ccatcctacc cagcacacac acaccgctgc taaccccata 540
ccccgaacca accaaacccc aaagacaccc cccacagttt atgtagctta cctcctcaaa 600
gcaatacact gaaaatgttt agacgggctc acatcacccc ataaacaaat aggtttggtc 660
ctagcctttc tattagctct tagtaagatt acacatgcaa gcatccccgt tccagtgagt 720
tcaccctcta aatcaccacg atcaaaagga acaagcatca agcacgcagc aatgcagctc 780
aaaacgctta gcctagccac acccccacgg gaaacagcag tgattaacct ttagcaataa 840
acgaaagttt aactaagcta tactaacccc agggttggtc aatttcgtgc cagccaccgc 900
ggtcacacga ttaacccaag tcaatagaag ccggcgtaaa gagtgtttta gatcaccccc 960
tccccaataa agctaaaact cacctgagtt gtaaaaaact ccagttgaca caaaatagac 1020
tacgaaagtg gctttaacat atctgaacac acaatagcta agacccaaac tgggattaga 1080
taccccacta tgcttagccc taaacctcaa cagttaaatc aacaaaactg ctcgccagaa 1140
cactacgagc cacagcttaa aactcaaagg acctggcggt gcttcatatc cctctagagg 1200
agcctgttct gtaatcgata aaccccgatc aacctcacca cctcttgctc agcctatata 1260
ccgccatctt cagcaaaccc tgatgaaggc tacaaagtaa gcgcaagtac ccacgtaaag 1320
acgttaggtc aaggtgtagc ccatgaggtg gcaagaaatg ggctacattt tctaccccag 1380
aaaactacga tagcccttat gaaacttaag ggtcgaaggt ggatttagca gtaaactaag 1440
agtagagtgc ttagttgaac agggccctga agcgcgtaca caccgcccgt caccctcctc 1500
aagtatactt caaaggacat ttaactaaaa cccctacgca tttatataga ggagacaagt 1560
cgtaacatgg taagtgtact ggaaagtgca cttggacgaa ccagagtgta gcttaacaca 1620
aagcacccaa cttacactta ggagatttca acttaacttg accgctctga gctaaaccta 1680
gccccaaacc cactccacct tactaccaga caaccttagc caaaccattt acccaaataa 1740
agtataggcg atagaaattg aaacctggcg caatagatat agtaccgcaa gggaaagatg 1800
aaaaattata accaagcata atatagcaag gactaacccc tataccttct gcataatgaa 1860
ttaactagaa ataactttgc aaggagagcc aaagctaaga cccccgaaac cagacgagct 1920
acctaagaac agctaaaaga gcacacccgt ctatgtagca aaatagtggg aagatttata 1980
ggtagaggcg acaaacctac cgagcctggt gatagctggt tgtccaagat agaatcttag 2040
ttcaacttta aatttgccca cagaaccctc taaatcccct tgtaaattta actgttagtc 2100
caaagaggaa cagctctttg gacactagga aaaaaccttg tagagagagt aaaaaattta 2160
acacccatag taggcctaaa agcagccacc aattaagaaa gcgttcaagc tcaacaccca 2220
ctacctaaaa aatcccaaac atataactga actcctcaca cccaattgga ccaatctatc 2280
accctataga agaactaatg ttagtataag taacatgaaa acattctcct ccgcataagc 2340
ctgcgtcaga ttaaaacact gaactgacaa ttaacagccc aatatctaca atcaaccaac 2400
aagtcattat taccctcact gtcaacccaa cacaggcatg ctcataagga aaggttaaaa 2460
aaagtaaaag gaactcggca aatcttaccc cgcctgttta ccaaaaacat cacctctagc 2520
atcaccagta ttagaggcac cgcctgccca gtgacacatg tttaacggcc gcggtaccct 2580
aaccgtgcaa aggtagcata atcacttgtt ccttaaatag ggacctgtat gaatggctcc 2640
acgagggttc agctgtctct tacttttaac cagtgaaatt gacctgcccg tgaagaggcg 2700
ggcataacac agcaagacga gaagacccta tggagcttta atttattaat gcaaacagta 2760
cctaacaaac ccacaggtcc taaactacca aacctgcatt aaaaatttcg gttggggcga 2820
cctcggagca gaacccaacc tccgagcagt acatgctaag acttcaccag tcaaagcgaa2880
ctactatact caattgatcc aataacttga ccaacggaac aagttaccct agggataaca 2940
gcgcaatcct attctagagt ccatatcaac aatagggttt acgacctcga tgttggatca 3000
ggacatcccg atggtgcagc cgctattaaa ggttcgtttg ttcaacgatt aaagtcctac 3060
gtgatctgag ttcagaccgg agtaatccag gtcggtttct atctacnttc aaattcctcc 3120
ctgtacgaaa ggacaagaga aataaggcct acttcacaaa gcgccttccc ccgtaaatga 3180
tatcatctca acttagtatt atacccacac ccacccaaga acagggtttg ttaagatggc 3240
agagcccggt aatcgcataa aacttaaaac tttacagtca gaggttcaat tcctcttctt 3300
aacaacatac ccatggccaa cctcctactc ctcattgtac ccattctaat cgcaatggca 3360
ttcctaatgc ttaccgaacg aaaaattcta ggctatatac aactacgcaa aggccccaac 3420
gttgtaggcc cctacgggct actacaaccc ttcgctgacg ccataaaact cttcaccaaa 3480
gagcccctaa aacccgccac atctaccatc accctctaca tcaccgcccc gaccttagct 3540
ctcaccatcg ctcttctact atgaaccccc ctccccatac ccaaccccct ggtcaacctc 3600
aacctaggcc tcctatttat tctagccacc tctagcctag ccgtttactc aatcctctga 3660
tcagggtgag catcaaactc aaactacgcc ctgatcggcg cactgcgagc agtagcccaa 3720
acaatctcat atgaagtcac cctagccatc attctactat caacattact aataagtggc 3780
tcctttaacc tctccaccct tatcacaaca caagaacacc tctgattact cctgccatca 3840
tgacccttgg ccataatatg atttatctcc acactagcag agaccaaccg aacccccttc 3900
gaccttgccg aaggggagtc cgaactagtc tcaggcttca acatcgaata cgccgcaggc 3960
cccttcgccc tattcttcat agccgaatac acaaacatta ttataataaa caccctcacc 4020
actacaatct tcctaggaac aacatatgac gcactctccc ctgaactcta cacaacatat 4080
tttgtcacca agaccctact tctaacctcc ctgttcttat gaattcgaac agcatacccc 4140
cgattccgct acgaccaact catacacctc ctatgaaaaa acttcctacc actcacccta 4200
gcattactta tatgatatgt ctccataccc attacaatct ccagcattcc ccctcaaacc 4260
taagaaatat gtctgataaa agagttactt tgatagagta aataatagga gcttaaaccc 4320
ccttatttct aggactatga gaatcgaacc catccctgag aatccaaaat tctccgtgcc 4380
acctatcaca ccccatccta aagtaaggtc agctaaataa gctatcgggc ccataccccg 4440
aaaatgttgg ttataccctt cccgtactaa ttaatcccct ggcccaaccc gtcatctact 4500
ctaccatctt tgcaggcaca ctcatcacag cgctaagctc gcactgattt tttacctgag 4560
taggcctaga aataaacatg ctagctttta ttccagttct aaccaaaaaa ataaaccctc 4620
gttccacaga agctgccatc aagtatttcc tcacgcaagc aaccgcatcc ataatccttc 4680
taatagctat cctcttcaac aatatactct ccggacaatg aaccataacc aatactacca 4740
atcaatactc atcattaata atcataatag ctatagcaat aaaactagga atagccccct 4800
ttcacttctg agtcccagag gttacccaag gcacccctct gacatccggc ctgcttcttc 4860
tcacatgaca aaaactagcc cccatctcaa tcatatacca aatctctccc tcactaaacg 4920
taagccttct cctcactctc tcaatcttat ccatcatagc aggcagttga ggtggattaa 4980
accaaaccca gctacgcaaa atcttagcat actcctcaat tacccacata ggatgaataa 5040
tagcagttct accgtacaac cctaacataa ccattcttaa tttaactatt tatattatcc 5100
taactactac cgcattccta ctactcaact taaactccag caccacgacc ctactactat 5160
ctcgcacctg aaacaagcta acatgactaa cacccttaat tccatccacc ctcctctccc 5220
taggaggcct gcccccgcta accggctttt tgcccaaatg ggccattatc gaagaattca 5280
caaaaaacaa tagcctcatc atccccacca tcatagccac catcaccctc cttaacctct 5340
acttctacct acgcctaatc tactccacct caatcacact actccccata tctaacaacg 5400
taaaaataaa atgacagttt gaacatacaa aacccacccc attcctcccc acactcatcg 5460
cccttaccac gctactccta cctatctccc cttttatact aataatctta tagaaattta 5520
ggttaaatac agaccaagag ccttcaaagc cctcagtaag ttgcaatact taatttctgt 5580
aacagctaag gactgcaaaa ccccactctg catcaactga acgcaaatca gccactttaa5640
ttaagctaag cccttactag accaatggga cttaaaccca caaacactta gttaacagct 5700
aagcacccta atcaactggc ttcaatctac ttctcccgcc gccgggaaaa aaggcgggag 5760
aagccccggc aggtttgaag ctgcttcttc gaatttgcaa ttcaatatga aaatcacctc 5820
ggagctggta aaaagaggcc taacccctgt ctttagattt acagtccaat gcttcactca 5880
gccattttac ctcaccccca ctgatgttcg ccgaccgttg actattctct acaaaccaca 5940
aagacattgg aacactatac ctattattcg gcgcatgagc tggagtccta ggcacagctc 6000
taagcctcct tattcgagcc gagctgggcc agccaggcaa ccttctaggt aacgaccaca 6060
tctacaacgt tatcgtcaca gcccatgcat ttgtaataat cttcttcata gtaataccca 6120
tcataatcgg aggctttggc aactgactag ttcccctaat aatcggtgcc cccgatatgg 6180
cgtttccccg cataaacaac ataagcttct gactcttacc tccctctctc ctactcctgc 6240
tcgcatctgc tatagtggag gccggagcag gaacaggttg aacagtctac cctcccttag 6300
cagggaacta ctcccaccct ggagcctccg tagacctaac catcttctcc ttacacctag 6360
caggtgtctc ctctatctta ggggccatca atttcatcac aacaattatc aatataaaac 6420
cccctgccat aacccaatac caaacgcccc tcttcgtctg atccgtccta atcacagcag 6480
tcctacttct cctatctctc ccagtcctag ctgctggcat cactatacta ctaacagacc 6540
gcaacctcaa caccaccttc ttcgaccccg ccggaggagg agaccccatt ctataccaac 6600
acctattctg atttttcggt caccctgaag tttatattct tatcctacca ggcttcggaa 6660
taatctccca tattgtaact tactactccg gaaaaaaaga accatttgga tacataggta 6720
tggtctgagc tatgatatca attggcttcc tagggtttat cgtgtgagca caccatatat 6780
ttacagtagg aatagacgta gacacacgag catatttcac ctccgctacc ataatcatcg 6840
ctatccccac cggcgtcaaa gtatttagct gactcgccac actccacgga agcaatatga 6900
aatgatctgc tgcagtgctc tgagccctag gattcatctt tcttttcacc gtaggtggcc 6960
tgactggcat tgtattagca aactcatcac tagacatcgt actacacgac acgtactacg 7020
ttgtagccca cttccactat gtcctatcaa taggagctgt atttgccatc ataggaggct 7080
tcattcactg atttccccta ttctcaggct acaccctaga ccaaacctac gccaaaatcc 7140
atttcactat catattcatc ggcgtaaatc taactttctt cccacaacac tttctcggcc 7200
tatccggaat gccccgacgt tactcggact accccgatgc atacaccaca tgaaacatcc 7260
tatcatctgt aggctcattc atttctctaa cagcagtaat attaataatt ttcatgattt 7320
gagaagcctt cgcttcgaag cgaaaagtcc taatagtaga agaaccctcc ataaacctgg 7380
agtgactata tggatgcccc ccaccctacc acacattcga agaacccgta tacataaaat 7440
ctagacaaaa aaggaaggaa tcgaaccccc caaagctggt ttcaagccaa ccccatggcc 7500
tccatgactt tttcaaaaag gtattagaaa aaccatttca taactttgtc aaagttaaat 7560
tataggctaa atcctatata tcttaatggc acatgcagcg caagtaggtc tacaagacgc 7620
tacttcccct atcatagaag agcttatcac ctttcatgat cacgccctca taatcatttt 7680
ccttatctgc ttcctagtcc tgtatgccct tttcctaaca ctcacaacaa aactaactaa 7740
tactaacatc tcagacgctc aggaaataga aaccgtctga actatcctgc ccgccatcat 7800
cctagtcctc atcgccctcc catccctacg catcctttac ataacagacg aggtcaacga 7860
tccctccctt accatcaaat caattggcca ccaatggtac tgaacctacg agtacaccga 7920
ctacggcgga ctaatcttca actcctacat acttccccca ttattcctag aaccaggcga 7980
cctgcgactc cttgacgttg acaatcgagt agtactcccg attgaagccc ccattcgtat 8040
aataattaca tcacaagacg tcttgcactc atgagctgtc cccacattag gcttaaaaac 8100
agatgcaatt cccggacgtc taaaccaaac cactttcacc gctacacgac cgggggtata 8160
ctacggtcaa tgctctgaaa tctgtggagc aaaccacagt ttcatgccca tcgtcctaga 8220
attaattccc ctaaaaatct ttgaaatagg gcccgtattt accctatagc accccctcta 8280
ccccctctag agcccactgt aaagctaact tagcattaac cttttaagtt aaagattaag 8340
agaaccaaca cctctttaca gtgaaatgcc ccaactaaat actaccgtat ggcccaccat 8400
aattaccccc atactcctta cactattcct catcacccaa ctaaaaatat taaacacaaa 8460
ctaccaccta cctccctcac caaagcccat aaaaataaaa aattataaca aaccctgaga 8520
accaaaatga acgaaaatct gttcgcttca ttcattgccc ccacaatcct aggcctaccc 8580
gccgcagtac tgatcattct atttccccct ctattgatcc ccacctccaa atatctcatc 8640
aacaaccgac taatcaccac ccaacaatga ctaatcaaac taacctcaaa acaaatgata 8700
accatacaca acactaaagg acgaacctga tctcttatac tagtatcctt aatcattttt 8760
attgccacaa ctaacctcct cggactcctg cctcactcat ttacaccaac cacccaacta 8820
tctataaacc tagccatggc catcccctta tgagcgggca cagtgattat aggctttcgc 8880
tctaagatta aaaatgccct agcccacttc ttaccacaag gcacacctac accccttatc 8940
cccatactag ttattatcga aaccatcagc ctactcattc aaccaatagc cctggccgta 9000
cgcctaaccg ctaacattac tgcaggccac ctactcatgc acctaattgg aagcgccacc 9060
ctagcaatat caaccattaa ccttccctct acacttatca tcttcacaat tctaattcta 9120
ctgactatcc tagaaatcgc tgtcgcctta atccaagcct acgttttcac acttctagta 9180
agcctctacc tgcacgacaa cacataatga cccaccaatc acatgcctat catatagtaa 9240
aacccagccc atgaccccta acaggggccc tctcagccct cctaatgacc tccggcctag9300
ccatgtgatt tcacttccac tccataacgc tcctcatact aggcctacta accaacacac 9360
taaccatata ccaatgatgg cgcgatgtaa cacgagaaag cacataccaa ggccaccaca 9420
caccacctgt ccaaaaaggc cttcgatacg ggataatcct atttattacc tcagaagttt 9480
ttttcttcgc aggatttttc tgagcctttt accactccag cctagcccct accccccaat 9540
taggagggca ctggccccca acaggcatca ccccgctaaa tcccctagaa gtcccactcc 9600
taaacacatc cgtattactc gcatcaggag tatcaatcac ctgagctcac catagtctaa 9660
tagaaaacaa ccgaaaccaa ataattcaag cactgcttat tacaatttta ctgggtctct 9720
attttaccct cctacaagcc tcagagtact tcgagtctcc cttcaccatt tccgacggca 9780
tctacggctc aacatttttt gtagccacag gcttccacgg acttcacgtc attattggct 9840
caactttcct cactatctgc ttcatccgcc aactaatatt tcactttaca tccaaacatc 9900
actttggctt cgaagccgcc gcctgatact ggcattttgt agatgtggtt tgactatttc 9960
tgtatgtctc catctattga tgagggtctt actcttttag tataaatagt accgttaact 10020
tccaattaac tagttttgac aacattcaaa aaagagtaat aaacttcgcc ttaattttaa 10080
taatcaacac cctcctagcc ttactactaa taattattac attttgacta ccacaactca 10140
acggctacat agaaaaatcc accccttacg agtgcggctt cgaccctata tcccccgccc10200
gcgtcccttt ctccataaaa ttcttcttag tagctattac cttcttatta tttgatctag 10260
aaattgccct ccttttaccc ctaccatgag ccctacaaac aactaacctg ccactaatag 10320
ttatgtcatc cctcttatta atcatcatcc tagccctaag tctggcctat gagtgactac 10380
aaaaaggatt agactgaacc gaattggtat atagtttaaa caaaacgaat gatttcgact 10440
cattaaatta tgataatcat atttaccaaa tgcccctcat ttacataaat attatactag 10500
catttaccat ctcacttcta ggaatactag tatatcgctc acacctcata tcctccctac 10560
tatgcctaga aggaataata ctatcgctgt tcattatagc tactctcata accctcaaca 10620
cccactccct cttagccaat attgtgccta ttgccatact agtctttgcc gcctgcgaag 10680
cagcggtggg cctagcccta ctagtctcaa tctccaacac atatggccta gactacgtac 10740
ataacctaaa cctactccaa tgctaaaact aatcgtccca acaattatat tactaccact 10800
gacatgactt tccaaaaaac acataatttg aatcaacaca accacccaca gcctaattat10860
tagcatcatc cctctactat tttttaacca aatcaacaac aacctattta gctgttcccc 10920
aaccttttcc tccgaccccc taacaacccc cctcctaata ctaactacct gactcctacc 10980
cctcacaatc atggcaagcc aacgccactt atccagtgaa ccactatcac gaaaaaaact11040
ctacctctct atactaatct ccctacaaat ctccttaatt ataacattca cagccacaga 11100
actaatcata ttttatatct tcttcgaaac cacacttatc cccaccttgg ctatcatcac 11160
ccgatgaggc aaccagccag aacgcctgaa cgcaggcaca tacttcctat tctacaccct 11220
agtaggctcc cttcccctac tcatcgcact aatttacact cacaacaccc taggctcact 11280
aaacattcta ctactcactc tcactgccca agaactatca aactcctgag ccaacaactt 11340
aatatgacta gcttacacaa tagcttttat agtaaagata cctctttacg gactccactt 11400
atgactccct aaagcccatg tcgaagcccc catcgctggg tcaatagtac ttgccgcagt 11460
actcttaaaa ctaggcggct atggtataat acgcctcaca ctcattctca accccctgac 11520
aaaacacata gcctacccct tccttgtact atccctatga ggcataatta taacaagctc 11580
catctgccta cgacaaacag acctaaaatc gctcattgca tactcttcaa tcagccacat 11640
agccctcgta gtaacagcca ttctcatcca aaccccctga agcttcaccg gcgcagtcat 11700
tctcataatc gcccacgggc ttacatcctc attactattc tgcctagcaa actcaaacta 11760
cgaacgcact cacagtcgca tcataatcct ctctcaagga cttcaaactc tactcccact 11820
aatagctttt tgatgacttc tagcaagcct cgctaacctc gccttacccc ccactattaa 11880
cctactggga gaactctctg tgctagtaac cacgttctcc tgatcaaata tcactctcct 11940
acttacagga ctcaacatac tagtcacagc cctatactcc ctctacatat ttaccacaac 12000
acaatggggc tcactcaccc accacattaa caacataaaa ccctcattca cacgagaaaa 12060
caccctcatg ttcatacacc tatcccccat tctcctccta tccctcaacc ccgacatcat 12120
taccgggttt tcctcttgta aatatagttt aaccaaaaca tcagattgtg aatctgacaa 12180
cagaggctta cgacccctta tttaccgaga aagctcacaa gaactgctaa ctcatgcccc 12240
catgtctaac aacatggctt tctcaacttt taaaggataa cagctatcca ttggtcttag 12300
gccccaaaaa ttttggtgca actccaaata aaagtaataa ccatgcacac tactataacc 12360
accctaaccc tgacttccct aattcccccc atccttacca ccctcgttaa ccctaacaaa 12420
aaaaactcat acccccatta tgtaaaatcc attgtcgcat ccacctttat tatcagtctc 12480
ttccccacaa caatattcat gtgcctagac caagaagtta ttatctcgaa ctgacactga 12540
gccacaaccc aaacaaccca gctctcccta agcttcaaac tagactactt ctccataata 12600
ttcatccctg tagcattgtt cgttacatgg tccatcatag aattctcact gtgatatata 12660
aactcagacc caaacattaa tcagttcttc aaatatctac tcatcttcct aattaccata 12720
ctaatcttag ttaccgctaa caacctattc caactgttca tcggctgaga gggcgtagga 12780
attatatcct tcttgctcat cagttgatga tacgcccgag cagatgccaa cacagcagcc 12840
attcaagcaa tcctatacaa ccgtatcggc gatatcggtt tcatcctcgc cttagcatga 12900
tttatcctac actccaactc atgagaccca caacaaatag cccttctaaa cgctaatcca 12960
agcctcaccc cactactagg cctcctccta gcagcagcag gcaaatcagc ccaattaggt 13020
ctccacccct gactcccctc agccatagaa ggccccaccc cagtctcagc cctactccac 13080
tcaagcacta tagttgtagc aggaatcttc ttactcatcc gcttccaccc cctagcagaa 13140
aatagcccac taatccaaac tctaacacta tgcttaggcg ctatcaccac tctgttcgca 13200
gcagtctgcg cccttacaca aaatgacatc aaaaaaatcg tagccttctc cacttcaagt 13260
caactaggac tcataatagt tacaatcggc atcaaccaac cacacctagc attcctgcac 13320
atctgtaccc acgccttctt caaagccata ctatttatgt gctccgggtc catcatccac 13380
aaccttaaca atgaacaaga tattcgaaaa ataggaggac tactcaaaac catacctctc 13440
acttcaacct ccctcaccat tggcagccta gcattagcag gaataccttt cctcacaggt 13500
ttctactcca aagaccacat catcgaaacc gcaaacatat catacacaaa cgcctgagcc 13560
ctatctatta ctctcatcgc tacctccctg acaagcgcct atagcactcg aataattctt 13620
ctcaccctaa caggtcaacc tcgcttcccc acccttacta acattaacga aaataacccc 13680
accctactaa accccattaa acgcctggca gccggaagcc tattcgcagg atttctcatt 13740
actaacaaca tttcccccgc atcccccttc caaacaacaa tccccctcta cctaaaactc 13800
acagccctcg ctgtcacttt cctaggactt ctaacagccc tagacctcaa ctacctaacc 13860
aacaaactta aaataaaatc cccactatgc acattttatt tctccaacat actcggattc 13920
taccctagca tcacacaccg cacaatcccc tatctaggcc ttcttacgag ccaaaacctg 13980
cccctactcc tcctagacct aacctgacta gaaaagctat tacctaaaac aatttcacag 14040
caccaaatct ccacctccat catcacctca acccaaaaag gcataattaa actttacttc 14100
ctctctttct tcttcccact catcctaacc ctactcctaa tcacataacc tattcccccg 14160
agcaatctca attacaatat atacaccaac aaacaatgtt caaccagtaa ctactactaa 14220
tcaacgccca taatcataca aagcccccgc accaatagga tcctcccgaa tcaaccctga 14280
cccctctcct tcataaatta ttcagcttcc tacactatta aagtttacca caaccaccac 14340
cccatcatac tctttcaccc acagcaccaa tcctacctcc atcgctaacc ccactaaaac 14400
actcaccaag acctcaaccc ctgaccccca tgcctcagga tactcctcaa tagccatcgc 14460
tgtagtatat ccaaagacaa ccatcattcc ccctaaataa attaaaaaaa ctattaaacc 14520
catataacct cccccaaaat tcagaataat aacacacccg accacaccgc taacaatcaa 14580
tactaaaccc ccataaatag gagaaggctt agaagaaaac cccacaaacc ccattactaa 14640
acccacactc aacagaaaca aagcatacat cattattctc gcacggacta caaccacgac 14700
caatgatatg aaaaaccatc gttgtatttc aactacaaga acaccaatga ccccaatacg 14760
caaaactaac cccctaataa aattaattaa ccactcattc atcgacctcc ccaccccatc 14820
caacatctcc gcatgatgaa acttcggctc actccttggc gcctgcctga tcctccaaat 14880
caccacagga ctattcctag ccatgcacta ctcaccagac gcctcaaccg ccttttcatc 14940
aatcgcccac atcactcgag acgtaaatta tggctgaatc atccgctacc ttcacgccaa 15000
tggcgcctca atattcttta tctgcctctt cctacacatc gggcgaggcc tatattacgg 15060
atcatttctc tactcagaaa cctgaaacat cggcattatc ctcctgcttg caactatagc 15120
aacagccttc ataggctatg tcctcccgtg aggccaaata tcattctgag gggccacagt 15180
aattacaaac ttactatccg ccatcccata cattgggaca gacctagttc aatgaatctg 15240
aggaggctac tcagtagaca gtcccaccct cacacgattc tttacctttc acttcatctt 15300
gcccttcatt attgcagccc tagcaacact ccacctccta ttcttgcacg aaacgggatc 15360
aaacaacccc ctaggaatca cctcccattc cgataaaatc accttccacc cttactacac 15420
aatcaaagac gccctcggct tacttctctt ccttctctcc ttaatgacat taacactatt 15480
ctcaccagac ctcctaggcg acccagacaa ttatacccta gccaacccct taaacacccc 15540
tccccacatc aagcccgaat gatatttcct attcgcctac acaattctcc gatccgtccc 15600
taacaaacta ggaggcgtcc ttgccctatt actatccatc ctcatcctag caataatccc 15660
catcctccat atatccaaac aacaaagcat aatatttcgc ccactaagcc aatcacttta 15720
ttgactccta gccgcagacc tcctcattct aacctgaatc ggaggacaac cagtaagcta 15780
cccttttacc atcattggac aagtagcatc cgtactatac ttcacaacaa tcctaatcct 15840
aataccaact atctccctaa ttgaaaacaa aatactcaaa tgggcctgtc cttgtagtat 15900
aaactaatac accagtcttg taaaccggag atgaaaacct ttttccaagg acaaatcaga 15960
gaaaaagtct ttaactccac cattagcacc caaagctaag attctaattt aaactattct 16020
ctgttctttc atggggaagc agatttgggt accacccaag tattgactca cccatcaaca 16080
accgctatgt atttcgtaca ttactgccag ccaccatgaa tattgtacgg taccataaat 16140
acttgaccac ctgtagtaca taaaaaccca atccacatca aaaccccctc cccatgctta 16200
caagcaagta cagcaatcaa ccctcaacta tcacacatca actgcaactc caaagccacc 16260
cctcacccac taggatacca acaaacctac ccacccttaa cagtacatag tacataaagc 16320
catttaccgt acatagcaca ttacagtcaa atcccttctc gtccccatgg atgacccccc 16380
tcagataggg gtcccttgac caccatcctc cgtgaaatca atatcccgca caagagtgct 16440
actctcctcg ctccgggccc ataacacttg ggggtagcta aagtgaactg tatccgacat 16500
ctggttccta cttcagggtc ataaagccta aatagcccac acgttcccct taaataagac 16560
atcacgatg 16569
Claims (2)
1. detect the test kit that Mitochondrial DNA T4353C that essential hypertension is correlated with suddenlys change, this test kit is made up of DNA extraction mixed solution (1), PCR mixed solution (2), a pair outer primer (3) designed for T4353C, a pair inner primer (4), restriction enzyme (5), positive control (6), negative control (7) and the box body (8) that design for T4353C; Wherein, DNA extraction mixed solution (1) is made up of cell pyrolysis liquid and solution I, and PCR mixed solution (2) has deoxymononucleotide, 10 × PCR damping fluid, MgCl
2, tri-distilled water and archaeal dna polymerase, it is characterized in that, a pair outer primer (3) for T4353C design has outer forward direction primers F: TGGCTCCTTTAACCTCTC CA and outer reverse primer R:AAGGATTATGGATGCGGTTG, a pair inner primer for T4353C design has interior forward direction primers F: TGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTA GGACTATGAGAATCG AACGGA and interior reverse primer R:ATGGTAGAGTAGATGACGGGTT, restriction enzyme (5) is restriction enzyme
bamHi, positive control (6) is that the enzyme containing mtDNA sequence the 4353rd site generation T>C sudden change cuts sample, and negative control (7) is that the enzyme not containing mtDNA sequence the 4353rd site generation T>C sudden change cuts sample; Solution I is made up of Proteinase K, chloroform, phenol and raw spirit.
2. detect a test kit for the Mitochondrial DNA T4353C sudden change that essential hypertension is correlated with, it is characterized in that, in PCR mixed solution (2), add 0.1-0.2 μ l dimethyl sulfoxide (DMSO).
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310133673.XA CN103290109B (en) | 2013-04-17 | 2013-04-17 | Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310133673.XA CN103290109B (en) | 2013-04-17 | 2013-04-17 | Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103290109A CN103290109A (en) | 2013-09-11 |
CN103290109B true CN103290109B (en) | 2015-01-28 |
Family
ID=49091636
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310133673.XA Active CN103290109B (en) | 2013-04-17 | 2013-04-17 | Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103290109B (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003018775A2 (en) * | 2001-08-30 | 2003-03-06 | Emory University | Human mitochondrial dna polymorphisms, haplogroups, associations with physiological conditions, and genotyping arrays |
CN102747152A (en) * | 2012-06-24 | 2012-10-24 | 浙江大学 | Kit for detecting regulon of Leber disease and use thereof |
CN103031379A (en) * | 2012-12-17 | 2013-04-10 | 浙江大学 | Kit for detecting mitochondria DNA A4401G related to hypertension and application |
CN103031380A (en) * | 2012-12-17 | 2013-04-10 | 浙江大学 | Kit for detecting mitochondria DNA A4263G related to hypertension and application |
-
2013
- 2013-04-17 CN CN201310133673.XA patent/CN103290109B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003018775A2 (en) * | 2001-08-30 | 2003-03-06 | Emory University | Human mitochondrial dna polymorphisms, haplogroups, associations with physiological conditions, and genotyping arrays |
CN102747152A (en) * | 2012-06-24 | 2012-10-24 | 浙江大学 | Kit for detecting regulon of Leber disease and use thereof |
CN103031379A (en) * | 2012-12-17 | 2013-04-10 | 浙江大学 | Kit for detecting mitochondria DNA A4401G related to hypertension and application |
CN103031380A (en) * | 2012-12-17 | 2013-04-10 | 浙江大学 | Kit for detecting mitochondria DNA A4263G related to hypertension and application |
Non-Patent Citations (4)
Title |
---|
Mitochondrial tRNA Mutations are Associated with Maternally Inherited Hypertension in two Han Chinese Pedigrees;Qiaomeng Qiu等;《HUMAN MUTATION》;20120530;第33卷(第8期);1285-1293 * |
中国汉族原发性高血压患者线粒体tRNA~(Met)基因突变;李宗斌等;《遗传》;20110630(第06期);601-606 * |
线粒体tRNAGln对中国汉族人原发性高血压发病的影响;李宗斌 等;《中华老年多器官疾病杂志》;20110628;第10卷(第3期);210-214 * |
高血压相关的线粒体DNA突变;薛凌等;《遗传》;20110930(第09期);911-918 * |
Also Published As
Publication number | Publication date |
---|---|
CN103290109A (en) | 2013-09-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101768637B (en) | Kit for simultaneously detecting mutations in mitochondria DNA A1555G and C1494T and using method thereof | |
CN102747152A (en) | Kit for detecting regulon of Leber disease and use thereof | |
KR101363032B1 (en) | Mitochondrial mutations and rearrangements as a diagnostic tool for the detection of sun exposure, prostate cancer and other cancers | |
CN103266169B (en) | Kit for detecting deaf related mitochondrial T7505C mutation, and application thereof | |
CN102242212A (en) | HCM (Hypertrophic Cardiomyopathy) genotyping method and kit | |
CN103290114B (en) | Kit for detecting mutation of mitochondria T12201C related with epicophosis and application | |
CN103031379A (en) | Kit for detecting mitochondria DNA A4401G related to hypertension and application | |
CN103173544B (en) | Mitochondrial T3866C detection kit of Leber disease, and application thereof | |
CN106755399B (en) | A kind of I type neurofibromatosis pathogenic mutation gene and the Etiologic reagent based on this mutated gene | |
CN103031380B (en) | Kit for detecting mitochondria DNA A4263G related to hypertension and application | |
CN106834434A (en) | For detecting COX 1, the nucleic acid of COX 2 and GPIIIa gene pleiomorphisms, kit and method | |
CN103290109B (en) | Kit for detecting mitochondrial T4353C mutation linked to hypertension and application thereof | |
CN103290110B (en) | Kit for detecting mitochondrial T5655C mutation linked to hypertension and application thereof | |
CN103173545B (en) | The plastosome T12338C detection kit of Leber disease and application | |
CN109825585A (en) | A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation | |
CN109536623A (en) | It is a kind of that schistosoma japonicum cercariae method for distinguishing is identified using Multiplex PCR | |
CN109837349A (en) | A kind of Primer composition, kit and detection method | |
CN104774926A (en) | T3394C kit for detecting Leber disease | |
CN104774927A (en) | Mitochondrion T14502C kit for detecting Leber disease | |
CN107083429B (en) | A kind of SNP parting kit and its application for the detection of atrial fibrillation tumor susceptibility gene | |
CN106884048A (en) | One kind detection fish Streptococcus iniae fluorescent PCR kit and its application | |
CN105316350B (en) | Mycobacterium tuberculosis EmbB mutators and application thereof | |
JP4347609B2 (en) | Bladder cancer test kit | |
CN107236798A (en) | The method that loop-mediated isothermal amplification technique detects mycoplasma pneumoniae | |
Vural et al. | Species determination of ancient bone DNA from fossil skeletal remains of Turkey using molecular techniques |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |