CN103173544A - Mitochondrial T3866C detection kit of Leber disease, and application thereof - Google Patents

Abstract

The invention provides a mitochondrial T3866C detection kit of Leber disease, and an application thereof. The detection kit is composed of a DNA extraction mixed solution, a PCR mixed solution used for amplifying T3866C, outer primers and inner primers designed aiming at T3866C, a restriction endonuclease Bgl II, a positive control, and a negative control. According to the invention, genomic DNA is rapidly extracted from small amounts of samples such as blood samples, hair with follicle, oral mucosa smears, or saliva. Therefore, a problem of DNA extraction in primary Leber disease patient blood of traditional methods is solved, pain of patient to be detected is reduced, a problem of cross-region sample transferring is solved, enzyme digestion specificity is improved, false negative is avoided, and detection result stability is improved. The kit provided by the invention is rapid, simple, accurate, and economical. With the kit, primary-Leber-disease-related mtDNAT3866C mutation large-scale screening and preventive inspection can be implemented.

Description

Plastosome T3866C detection kit and the application of Leber disease

Technical field

The invention belongs to biological technical field, relate to the test kit for detection of the Mitochondrial DNA T3866C sudden change sick relevant to primary LeberShi, the detection method that also relates to the sick relevant mitochondrial gene mutation of a kind of and primary LeberShi, particularly detection line plastochondria ND1The method of T3866C sudden change, and aforesaid method or the above-mentioned application of test kit in detecting the Mitochondrial DNA T3866C sudden change sick relevant to primary LeberShi.

Background technology

Leber hereditary optic neuropathy (Leber's Hereditary Optic Neuropathy, LHON, be called for short LeberShi sick) be a type of optic neuropathy, mainly involve retina, lamina cribrosa of sclera front portion and look the papillomacular bundle fiber, cause the matrilinear inheritance of optic nerve degeneration sick, seriously influencing people and producing normally, live.Approximately have 7,100,000 according to the existing low eyesight population of health ministry (http://www.moh.gov.cn/) latest data statistics China, the blind person approximately has 5,000,000, accounts for 0.4% of total number of persons, becomes one of vision impairment in the world the most serious country.Wherein, be about 550,000 by what optic neuropathy caused.German ophthalmologist Theodor Leber reported first in 1871 should disease clinical symptom, sign and hereditary property.The mode of inheritance of the discovery LHON such as Erickson in 1972 is typical matrilinear inheritance feature.Wallace DC in 1988 etc. have found Mitochondrial Genome Overview DNA(mitochondria DNA, the mtDNA that first is relevant to LHON) mutational site ND4G11778A.Reported that at present 50 multiple line mitochondrial DNA mutational sites cause a disease relevant (http://www.mitomap.org/) to LHON, wherein the family of the LHON more than 90% is by due to the ND4 G11778A on the oxidative phosphorylation composite I subunit, ND1 G3460A and these 3 primary mutation points of ND6 T14484C.In order further to probe into the pathogenesis of LHON, collected a large amount of LHON familys in China, except above-mentioned 3 primary mutational sites, in succession found tRNA ^MetA4435G, ND4G11696A, tRNA ^ThrA15951G, ND1T3866C and ND5The T12338C sudden change is relevant to LHON, and clinical symptom is not obvious in early days for the primary LeberShi disease relevant to plastosome, and therefore early stage inspection usually can be delayed, especially at China's remote countryside area, this situation ubiquity.Therefore, carry out the mtDNA Mutation Screening in high risk population and Susceptible population, for the extremely important effect that has of prevention and the control primary LeberShi disease relevant to plastosome.

Since the relevant disease of self-discovery and mtDNA sudden change, the detection method in detection line plastochondria mutational site is still sequencing mainly.Direct sequencing is the golden standard of identifying sudden change, but this complex operation, somewhat expensive has limited its widespread use.

in recent years, domestic gene diagnosis kit and the detection method thereof of in succession reporting the Leber hereditary optic neuropathy, to satisfy the needs that extensive examination is carried out in sudden change to mitochondrial mutations, gene diagnosis kit and the detection method patent (patent No.: 200510006097.8) thereof of having applied in 2005 as Medical University Of Fujian, this invention is that the Mitochondrial DNA Mutation according to the Leber hereditary optic neuropathy patient more than 90% belongs to 3 primary pathogenic sites sudden change (G11778A, G3460A and T14484C), design and synthetic locus specificity PCR primer, directly make the DNA profiling of PCR with whole blood, utilize the allele-specific multiple PCR technique, the disposable PCR reaction of single tube, detect simultaneously 3 primary pathogenic mutation sites of LHON patient's Mitochondrial DNA, have easy to be quick, efficiently, expense is low, specificity is good, only need the advantages such as micro blood sample, for LHON patient's quick clinical gene diagnosis provides a kind of simple and easy, reliable method and test kit, has huge penetration and promotion using value.But the method exists the difficulty of Direct PCR amplification in blood to strengthen, and the conditional request of the multiplex PCR of taking in experiment will increase, and detection method does not have the difference of essence with common method.The excellent think of in Hangzhou in 2006 reaches bio tech ltd and sets up a kind of novel method (patent No.: 200610003429.1) with G11778A site mutation in single nucleotide polymorphism nucleic acid test paper rapid detection LHON Mitochondrial DNA.When application single nucleotide polymorphism detection of nucleic acids test strip is carried out the detection in polymorphic site or mutational site, need specificity of design to extend primer, 3 ' end base of this primer is close to polymorphism base or mutating alkali yl, it begins to extend under the effect of archaeal dna polymerase, is connected to antigenic mark two deoxymononucleotides (ddNTP) corresponding with template and extends on primer.Although the method can realize the detection positive site in the short period of time, the pcr amplification condition is strict, exists false-negative probability greatly to increase.

Summary of the invention

The objective of the invention is for present detection ND1The deficiency that the method for T3866C sudden change exists provides a kind of plastosome T3866C detection kit of Leber disease, is the test kit of the sick relevant Mitochondrial DNA T3866C sudden change of a kind of quick, easy, accurate, economic detection primary LeberShi.

Test kit provided by the invention is by the PCR mixed solution that is placed in DNA extraction mixed solution in box body, amplification T3866C, for the outer primer of T3866C design, consist of for inner primer, restriction enzyme, positive control and the negative control of T3866C design.Wherein, the DNA extraction mixed solution mainly is comprised of cell pyrolysis liquid and solution I (main component is Proteinase K); The PCR mixed solution of amplification T3866C is mainly by dNTP (deoxymononucleotide), 10 * PCR damping fluid, MgCl ₂, tri-distilled water and TaqEnzyme (archaeal dna polymerase) forms, and the outer primer that designs for T3866C has outer forward direction primers F: TACTTCACAAAGCGCCTTCC (SEQ ID NO:1) and outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); Inner primer for the T3866C design has interior forward direction primers F: CAACACAAGAACACCTCTGATTACTCCTGCCAT CATGACCCTTGGCCATAATATGATAGA (SEQ ID NO:3) and interior reverse primer R:GAGAGTGCGTCATATGTTGTTCCT AGGAAGA (SEQ ID NO:4); Restriction enzyme is restriction enzyme BglII; Positive sample contrast is to contain mtDNA sequence the 3866th site T occurs〉to cut sample, ' negative ' specimens contrast be not contain mtDNA sequence the 3866th site T occurs for the enzyme of C sudden change〉enzyme of C sudden change cuts sample.

In the mentioned reagent box, add in the PCR mixed solution of amplification T3866C for improving specific a little dimethyl sulfoxide (DMSO) of extension (0.1-0.2 μ l is advisable).

Another object of the present invention is to provide described test kit and is detecting the chondriogen sick relevant to matrilinear inheritance primary LeberShi ND1Application in the T3866C sudden change.Realize by following steps:

(1) extraction of genomic dna: use the protease K digesting cracking process, extract genomic dna from a small amount of blood preparation, the sample of hair, oral mucosa scraping blade or saliva with hair follicle;

(2) specific PCR amplification: use Primer 5.0 softwares and Oligo7.0 software according to the designed primers F of homo mitochondrion gene sequence shown in SEQ ID NO:5 _Outward/ R _Outward, F _In/ R _InThe fragment that can amplify the mitochondrial mutations site that comprises above-mentioned primary LeberShi disease, F is outer/and R amplifies the Nucleotide 3150-4679 into Mitochondrial DNA outward, and its sequence is the SEQ ID NO:1,2 in sequence table; F _In/ R _InAmplify the Nucleotide 3806-4058 for Mitochondrial DNA, its sequence is the SEQ ID NO:3,4 in sequence table;

(3) enzyme is cut evaluation: with above-mentioned PCR product restriction enzyme BglII is carried out enzyme to place, T3866C mutational site and is cut;

(4) sudden change detects: polyacrylamide gel electrophoresis detects, and directly cuts according to enzyme DNA fragmentation quantity and the DNA fragmentation size that the PCR product produces, and detects mtDNA whether the T3866C sudden change occurs.

In the method for above-mentioned detection mtDNA T3866C sudden change, can be from blood specimen (bleeding as), the sample of hair, oral mucosa scraping blade or saliva with hair follicle the rapid extraction genomic dna, different according to sampling mode or tested sample form, different samples are carried out corresponding pre-treatment, and treatment process is as follows:

(1) blood specimen (bleeding as): get 20～200 a small amount of blood specimen of μ l (bleeding as) or 1cm ²The blood filter paper put into 1.5ml EP pipe (centrifuge tube), add 900 μ l erythrocyte splitting damping fluid (20mmol/L Tris-HCl, pH 7.6) the standing 10min of (tris-HCI buffer) room temperature, abundant splitting erythrocyte, the centrifugal 1min of 12000rpm collects the white corpuscle precipitation;

(2) with the hair of hair follicle: wash with the hair of hair follicle 1 time with 70% ethanol, after use again the distilled water flushing hair 2 times.Put into respectively 2～4 hairs in 1.5ml EP pipe, hair follicle is placed in bottom the EP pipe, cuts off hair higher than the part of EP pipe with clean scissors;

(3) oral mucosa scraping blade or saliva: before collecting saliva, must allow the person of being collected gargle.To remove the materials such as aged cells too much in the oral cavity, swill, toothpaste, coffee, cigarette.Do not drink water in half an hour, feed, smoking, then begin to collect oral mucosa scraping blade or saliva, visual condition selects following method to collect saliva sample: 1. tongue is around oral cavity scraping mucomembranous cell, and about 0.1ml saliva is directly told in the EP pipe; 2. physiological saline is gargled, and tells in the EP pipe, draws PBS solution to the EP pipe that the saliva sample of collecting by above-mentioned any method is housed, and after piping and druming, the centrifugal 5min of 12000rpm removes supernatant, repeats this process once repeatedly; 3. repeatedly scrape the cheek inwall 6 times with cotton swab, then air drying carefully tears its outside surface off with the tweezers of sterilizing, and puts into the EP pipe; 4. saliva is told on filter paper, form salivary stain after air drying, then be cut into big or small approximately 1cm with clean scissors ²A scrap of paper is placed in the EP pipe.

Then with cell pyrolysis liquid and Proteinase K, above-mentioned sample is digested cracking, utilize salting-out process to remove the impurity such as albumen, isopropanol precipitating DNA is at last with saving backup in-20 ℃ after autoclaving water or the dissolving of TE damping fluid.

In embodiments of the invention, the guiding theory of design of primers is, position for mtDNA T3866C site existence is adjoining, and amplification is on a bar segment, therefore should design the 3' end upstream primer corresponding with 3866 site wild-type T and 3866 site mutation type C; For the 3866 sites designs 3' ends downstream primer (referring to Fig. 2) corresponding with 3866 site wild-type T and 4263 site mutation type C respectively.

The inventor is for (Fig. 3) after specific PCR amplification, and mtDNA T3866C site has formed the disappearance of restriction enzyme site.Restriction enzyme site is caused disappearing by mtDNA T3866C sudden change, and restriction enzyme wherein is BglII, its site are the SEQ ID NO:3,4 in sequence table;

With the primer of above design, take the corresponding DNA that is detected sample as template, by obtaining respectively the constant amplified band of big or small approximately 253bp limpid in sight after pcr amplification, 3866 mutational sites are corresponding to the 60th of amplified fragments.

In the method for the sick sudden change of above-mentioned detection chondriogen primary LeberShi, binding specificity round pcr and enzyme incision technology, every part of DNA sample is that primers F/R carries out the regular-PCR amplification in the PCR reaction tubes with Auele Specific Primer respectively, then carry out the enzyme at place, mutational site and cut, just can detect the sick relevant mtDNA T3866C sudden change of primary LeberShi by a PCR in several hours.

In theory, the genomic dna sample reacts through a PCR, namely only adds in system for after mutant site T3866C primers F/R, adds for the new restriction enzyme that forms in mutational site BglII is carried out enzyme and is cut, and just can detect.That is to say, same gene group DNA sample is cut through a PCR-enzyme, thereby makes detected result more accurate, credible.

The primer sequence that the inventor designs in also according to the present invention, obtain primer by synthetic (entrusting biotech firm), and primer is mixed according to a certain percentage, combine with the reagent that extracts sample genomic dna, pcr amplification reaction reagent, positive sample contrast, ' negative ' specimens contrast and working instructions, made the test kit that is used for the sick chondriogen mtDNA of vitro detection matrilinear inheritance primary LeberShi T3866C sudden change, made that sample DNA extracts, specific PCR amplification and enzyme cut and can complete smoothly on test kit provides reagent basis.Wherein, the reagent of extraction sample DNA mainly is comprised of cell pyrolysis liquid and solution I (main component is Proteinase K); Pcr amplification reaction reagent comprises dNTP, 10 * PCR damping fluid, MgCl ₂, tri-distilled water and Taq enzyme, restriction enzyme comprises restriction enzyme BglII.

Have following characteristics with the sick relevant chondriogen mtDNA T3866C sudden change of the vitro detection primary LeberShi of method of the present invention and preparation thereof test kit:

1. the method that obtains traditionally primary LeberShi patient genomic dna is to extract from blood, and everyone approximately needs 3～5ml.This blood-sampling method has brought some painful and injuries to a lot of examinees especially infant, and has certain risk and trouble when trans-regional transfer samples.The present invention uses the protease K digesting cracking process, rapid extraction genomic dna from a small amount of blood preparation (bleeding as), hair, oral mucosa scraping blade or saliva equal samples with hair follicle.The method has not only solved extracts the problem of DNA traditionally from primary LeberShi patient blood, alleviate examinee's misery; But also having solved the problem of trans-regional transfer samples, blood filter paper, hair and oral mucosa scraping blade (cotton swab) or salivary stain filter paper etc. can be placed in envelope easily, and can be by the trans-regional transmission of mode of mailing.

2. the relevant matrilinear inheritance disease gene diagnostic method of several plastosomes is arranged at present both at home and abroad, as direct sequencing fluorescent quantitative PCR detection method, gene chip detection method etc., due to the defective of himself, as waste time and energy, complex operation and testing cost higher and be difficult for promoting clinical.Compare with these methods, the PCR-enzyme incision technology combines specific PCR technology and both advantages of enzyme incision technology, every part of DNA sample is that primers F/R carries out the specific PCR amplification in the PCR reaction tubes with Auele Specific Primer, cuts by a PCR-enzyme and just can detect simultaneously mtDNA T3866C sudden change in several hours.It is worth mentioning that in addition, present method primer used all designs through careful.At first, between normal and mutation allele, to cut at enzyme the site that in process, the specificity restriction enzyme is formed different for different base, thereby greatly improved the specificity that enzyme is cut; Be can be used as in addition the molecule internal control index of whole PCR reaction by the product of normal control and blank, thereby avoid the appearance of false negative result, improve the stability of detected result.Concentration and ratio by adjusting different primers and the PCR reaction conditions is optimized is with specificity and the stability of guaranteeing result.

3. use test kit provided by the invention and carry out mtDNA T3866C sudden change detection, cost is lower than other detection methods; Testing process is easy, quick, and interpretation is directly perceived as a result; To experimental installation and operator without particular requirement, be adapted at general hospital, molecular biosciences laboratory and carry out, be convenient in China extensive examination and preventive inspection that the sick relevant mtDNA T3866C sudden change of primary LeberShi is carried out in low developed area particularly.

Description of drawings

Fig. 1 is test kit structural representation of the present invention.

Fig. 2 is specificity nest-type PRC primer schematic diagram of the present invention.

Fig. 3 is specificity nest-type PRC amplification scheme schematic diagram of the present invention.

Fig. 4 is that to carry T3866C sudden change primary LeberShi patient and his family be family tree.

Fig. 5 is the 7% polyacrylamide gel electrophoresis figure that mtDNA T3866C is identified in the amplification of gene specific nest-type PRC.

Nomenclature:

In Fig. 2 and 3: the forward primer that F increases for the first time for the specificity nest-type PRC outward; The reverse primer that R increases for the first time for the specificity nest-type PRC outward matches use outward with F; The reverse primer that increases for the second time for the specificity nest-type PRC in the forward primer that increases for the second time for the specificity nest-type PRC in F, R uses with pairing in F; T3866C is expressed as the 4263rd of Mitochondrial DNA, and wild-type is A, is G after the producer sudden change.

In Fig. 4: is that normal male is individual; Zero is that normal female is individual; ■ is the morbidity male individual; ● be the morbidity female individual; ◥ is the propositus; / be the individuality of dead; I is the first-generation member of this family; II is the s-generation member of this family; III is the third generation member of this family; IV is the 4th generation member of this family.

In Fig. 5: N1 represents through the pcr amplification product electrophorogram cut of enzyme not; N2 represents that the propositus carries the pcr amplification product enzyme that the T3866C mutational site detects and cuts the electrophorogram of evaluation; N3 is mother propositus who carries the T3866C sudden change; N4, N5 and N6 are respectively three younger brothers that carry T3866C sudden change, and N7 represents that the propositus carries the T3866C mutational site but the maternal member of morbidity not; N8 is the propositus husband who carries the T3866C sudden change; N9, N10 and N11 are respectively its three children.

Embodiment

The invention will be further described below in conjunction with the drawings and specific embodiments, can be implemented so that those skilled in the art can better understand the present invention also, but illustrated embodiment is not as a limitation of the invention.

The test kit of 1 one kinds of detection line mitochondrial DNA T3866C sudden changes of embodiment

Referring to Fig. 1, test kit provided by the invention, by the PCR mixed solution 2 of DNA extraction mixed solution 1, amplification T3866C, for the outer primer 3 of T3866C design, consist of for inner primer 4, restriction enzyme 5, positive control 6, negative control 7 and the box body 8 of T3866C design, the PCR mixed solution 2 of DNA extraction mixed solution 1, amplification T3866C, for the outer primer 3 of T3866C design, be placed in respectively in box body 8 for inner primer 4, restriction enzyme 5, positive control 6, the negative control 7 of T3866C design.Wherein, DNA extraction mixed solution 1 mainly is comprised of cell pyrolysis liquid and solution I (main component is Proteinase K); The PCR mixed solution 2 of amplification T3866C is mainly by dNTP (deoxymononucleotide), 10 * PCR damping fluid, MgCl ₂, tri-distilled water and TaqEnzyme (archaeal dna polymerase) forms, and the outer primer 3 that designs for T3866C has outer forward direction primers F: TACTTCACAAAGCGCCTTCC (SEQ ID NO:1) and outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); Inner primer 4 for the T3866C design has interior forward direction primers F: CAACACAAGAACACCTCTGATTACTCCTGCCAT CATGACCCTTGGCCATAATATGATAGA (SEQ ID NO:3) and interior reverse primer R:GAGAGTGCGTCATATGTTGTTCCT AGGAAGA (SEQ ID NO:4); Restriction enzyme 5 is restriction enzyme BglII; Positive control 6 is to contain mtDNA sequence the 3866th site T occurs〉to cut sample, negative control 7 be not contain mtDNA sequence the 3866th site T occurs for the enzyme of C sudden change〉enzyme of C sudden change cuts sample;

In the mentioned reagent box, add in the PCR mixed solution 2 of amplification T3866C for improving specific a little dimethyl sulfoxide (DMSO) of extension (0.1-0.2 μ l is advisable).

Embodiment 2 carries the detection of the primary LeberShi patient and his family system of chondriogen T3866C sudden change

1. detection sample

Select 1 primary LeberShi patient and his family system of carrying the T3866C sudden change.Its pedigree chart is referring to Fig. 4.This family presents typical matrilinear inheritance, sends out the patient all take elevation of blood pressure as unique clinical symptom, but each morbidity member's elevation of blood pressure varying degree in family.This family total number of persons is 58 people, and wherein maternal number of members is 27 people, and suffering from LeberShi patient has 8 people.

2. the extraction of genomic dna

Obtain respectively sample (venous blood filter paper of capillary vessel that comprises collection III-1, II-2, III-3, III-7 and IV-1 of 10 persons under inspection; IV-2 and 3 are the hair with hair follicle), the blood filter paper is put into 1.5ml EP pipe (Eppendorf pipe) with a scrap of paper that clean scissors is cut into big or small approximately 1cm2, add 900 μ l erythrocyte splitting damping fluid (20mmol/L Tris-HCl, pH 7.6) the standing 10min of room temperature, abundant splitting erythrocyte, the centrifugal 1min of 12000rpm collects the white corpuscle precipitation; Wash with the hair of hair follicle 1 time with 70% ethanol with the hair swatch of hair follicle, after use again the distilled water flushing hair 2 times.Put into respectively 2～4 hairs in 1.5ml EP pipe, hair follicle is placed in bottom the EP pipe, cuts off hair higher than the part of EP pipe with clean scissors.Then add 600 μ l cell pyrolysis liquids, add the solution I after mixing again, the working concentration that makes Proteinase K is 20 μ g/ml.The impurity such as albumen are then removed in fully 55 ℃ of digestion cracking after mixing with salting-out process, isopropanol precipitating DNA is at last with saving backup in-20 ℃ after autoclaving water or the dissolving of TE damping fluid.

3. design of primers

Use Primer 5.0 softwares and Oligo7.0 software assistance design improved primer, design according to published homo mitochondrion gene Cambridge reference sequences (SEQ ID NO:5), the design (see figure 2) of primer is as follows:

For mtDNA 3866 sites, guarantee the specificity of design of primers, outside we design two pairs of primers F of nest-type PRC outer/R, in F/R in; Their length, the close experiment condition of being convenient to of annealing temperature are stablized, to strengthen specificity.The nest-type PRC primer in 4263 sites of designing thus is outer forward direction primers F: TACTTCACAAAGCGCCTTCC (SEQ ID NO:1), outer reverse primer R:AAGGATTATGGATGCGGTTG (SEQ ID NO:2); Interior forward direction primers F: CAACACAAGAACACCTCTGATTACTCCTGCCAT CATGACCCTTGGCCATAATATGATAGA (SEQ ID NO:3), interior reverse primer R:GAGAGTGCGTCATATGTTGTTCCT AGGAAGA (SEQ ID NO:4).

The guiding theory of design of primers is that adjoining for the position of mtDNA T3866C site existence, amplification is on a bar segment, therefore should design the 3' end upstream primer corresponding with 3866 site wild-type T and 3866 site mutation type C; For the 3866 sites designs 3' ends downstream primer (referring to Fig. 2) corresponding with 3866 site wild-type T and 4263 site mutation type C respectively.

The inventor is for (Fig. 3) after specific PCR amplification, and mtDNA T3866C site has formed the disappearance of restriction enzyme site.Restriction enzyme site is caused disappearing by mtDNA T3866C sudden change, and restriction enzyme wherein is BglII, its site are the SEQ ID NO:3,4 in sequence table.

With the primer of above design, take the corresponding DNA that is detected sample as template, by obtaining respectively the constant amplified band of big or small approximately 253bp limpid in sight after pcr amplification, 3866 mutational sites are corresponding to the 60th of amplified fragments.

4. gene specific nest-type PRC amplification

4 primer sequences according to above-mentioned design, obtain 2 pairs of primers by synthetic (entrusting biotech firm), take the tested sample genomic dna of said extracted as template, carry out the polyacrylamide gel electrophoresis enzyme of the amplification of gene specific nest-type PRC and 7% and cut evaluation.

It is 94 ℃ of denaturation 5min that the nest-type PRC loop parameter is used outer primer, follow 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 30s, after recirculation 30 times, then use 94 ℃ of sex change 30s of inner primer, 55 ℃ of annealing 30s, 72 ℃ are extended 30s, after recirculation 30 times, extend 5 min in 72 ℃ at last again.PCR product 5～10 μ l electrophoresis in 7% polyacrylamide gel is observed and the photographic recording result on the gel imaging instrument after EB dyeing.

5. result

According to Fig. 5 as can be known, when the genomic dna of propositus and normal control sample respectively through 2 pairs of primers F _Outward/ R _Outward, F _In/ R _InAfter the nest-type PRC enzyme is cut evaluation, only produce a constant amplified band of 253bp, after digestion with restriction enzyme was identified, constant being limited property of the amplified band restriction endonuclease of generation was cut into two sections (referring to Fig. 5 swimming lane N8), proved that propositus's sample does not carry mtDNA T3866C sudden change; And after digestion with restriction enzyme was identified, the constant amplified band of generation not being limited property restriction endonuclease was cut into two sections (referring to Fig. 5 swimming lane N2, N3), proved that this sample carries mtDNA T3866C sudden change.Family propositus's (III-14) genomic dna is through 2 pairs of primers F _Outward/ R _Outward, F _In/ R _InAfter carrying out nest-type PRC, the constant amplified band (referring to Fig. 5 swimming lane N2) of 1 253bp has appearred; And after digestion with restriction enzyme, this band does not have enzyme to cut, and has proved that this sample carries mtDNA T3866C sudden change.N2 represents that the propositus carries the pcr amplification product enzyme that the T3866C mutational site detects and cuts the electrophorogram of evaluation; N3 is mother propositus who carries the T3866C sudden change; N4, N5 and N6 are respectively three younger brothers that carry T3866C sudden change, and N7 represents that the propositus carries the T3866C mutational site but the maternal member of morbidity not; N8 is the propositus husband who carries the T3866C sudden change; N9, N10 and N11 are respectively its three children.

6. the check of gene specific nest-type PRC amplification detection method reliability

After gene specific nest-type PRC amplification enzyme was cut evaluation, we detected in the maternal member of family and carry T3866C sudden change positive individuals.Further the pcr amplification product with these samples carries out sequencing analysis, and sequencing result and gene specific nest-type PRC amplification match, and the reliability and stability of using the inventive method to detect chondriogen T3866C sudden change are described.

The gene specific Nested PCR Technique is compared with fluorescent quantitative PCR technique, order-checking and biochip technology has following advantage (seeing Table 2).

The above embodiment is the preferred embodiment that proves absolutely that the present invention lifts, and protection scope of the present invention is not limited to this.Being equal to that those skilled in the art do on basis of the present invention substitutes or conversion, all within protection scope of the present invention.

＜110〉Zhejiang University

＜120〉plastosome T3866C detection kit and the application of Leber disease

<160> 5

<210> 1

<211> 20

<212> DNA

＜213〉people (homo sapiens)

<400> 1

TACTTCACAAAGCGCCTTCC

<210> 2

<211> 20

<212> DNA

＜213〉people (homo sapiens)

<400> 2

AAGGATTATGGATGCGGTTG

<210> 3

<211> 20

<212> DNA

＜213〉people (homo sapiens)

<400> 3

CAACACAAGAACACCTCTGATTACTCCTGCCAT ATGACCCTTGGCCATAATATGATAGA

<210> 4

<211> 20

<212> DNA

＜213〉people (homo sapiens)

<400> 4

GAGAGTGCGTCATATGTTGTTCCTAGGAAGA

<210> 5

<211> 16569

<212> DNA

<213> Homo sapiens

<221> misc_feature

<222> (3107)..(3107)

<223> n is a, c, g, or t

<400> 5

gatcacaggt ctatcaccct attaaccact cacgggagct ctccatgcat ttggtatttt 60

cgtctggggg gtatgcacgc gatagcattg cgagacgctg gagccggagc accctatgtc 120

gcagtatctg tctttgattc ctgcctcatc ctattattta tcgcacctac gttcaatatt 180

acaggcgaac atacttacta aagtgtgtta attaattaat gcttgtagga cataataata 240

acaattgaat gtctgcacag ccactttcca cacagacatc ataacaaaaa atttccacca 300

aaccccccct cccccgcttc tggccacagc acttaaacac atctctgcca aaccccaaaa 360

acaaagaacc ctaacaccag cctaaccaga tttcaaattt tatcttttgg cggtatgcac 420

ttttaacagt caccccccaa ctaacacatt attttcccct cccactccca tactactaat 480

ctcatcaata caacccccgc ccatcctacc cagcacacac acaccgctgc taaccccata 540

ccccgaacca accaaacccc aaagacaccc cccacagttt atgtagctta cctcctcaaa 600

gcaatacact gaaaatgttt agacgggctc acatcacccc ataaacaaat aggtttggtc 660

ctagcctttc tattagctct tagtaagatt acacatgcaa gcatccccgt tccagtgagt 720

tcaccctcta aatcaccacg atcaaaagga acaagcatca agcacgcagc aatgcagctc 780

aaaacgctta gcctagccac acccccacgg gaaacagcag tgattaacct ttagcaataa 840

acgaaagttt aactaagcta tactaacccc agggttggtc aatttcgtgc cagccaccgc 900

ggtcacacga ttaacccaag tcaatagaag ccggcgtaaa gagtgtttta gatcaccccc 960

tccccaataa agctaaaact cacctgagtt gtaaaaaact ccagttgaca caaaatagac 1020

tacgaaagtg gctttaacat atctgaacac acaatagcta agacccaaac tgggattaga 1080

taccccacta tgcttagccc taaacctcaa cagttaaatc aacaaaactg ctcgccagaa 1140

cactacgagc cacagcttaa aactcaaagg acctggcggt gcttcatatc cctctagagg 1200

agcctgttct gtaatcgata aaccccgatc aacctcacca cctcttgctc agcctatata 1260

ccgccatctt cagcaaaccc tgatgaaggc tacaaagtaa gcgcaagtac ccacgtaaag 1320

acgttaggtc aaggtgtagc ccatgaggtg gcaagaaatg ggctacattt tctaccccag 1380

aaaactacga tagcccttat gaaacttaag ggtcgaaggt ggatttagca gtaaactaag 1440

agtagagtgc ttagttgaac agggccctga agcgcgtaca caccgcccgt caccctcctc 1500

aagtatactt caaaggacat ttaactaaaa cccctacgca tttatataga ggagacaagt 1560

cgtaacatgg taagtgtact ggaaagtgca cttggacgaa ccagagtgta gcttaacaca 1620

aagcacccaa cttacactta ggagatttca acttaacttg accgctctga gctaaaccta 1680

gccccaaacc cactccacct tactaccaga caaccttagc caaaccattt acccaaataa 1740

agtataggcg atagaaattg aaacctggcg caatagatat agtaccgcaa gggaaagatg 1800

aaaaattata accaagcata atatagcaag gactaacccc tataccttct gcataatgaa 1860

ttaactagaa ataactttgc aaggagagcc aaagctaaga cccccgaaac cagacgagct 1920

acctaagaac agctaaaaga gcacacccgt ctatgtagca aaatagtggg aagatttata 1980

ggtagaggcg acaaacctac cgagcctggt gatagctggt tgtccaagat agaatcttag 2040

ttcaacttta aatttgccca cagaaccctc taaatcccct tgtaaattta actgttagtc 2100

caaagaggaa cagctctttg gacactagga aaaaaccttg tagagagagt aaaaaattta 2160

acacccatag taggcctaaa agcagccacc aattaagaaa gcgttcaagc tcaacaccca 2220

ctacctaaaa aatcccaaac atataactga actcctcaca cccaattgga ccaatctatc 2280

accctataga agaactaatg ttagtataag taacatgaaa acattctcct ccgcataagc 2340

ctgcgtcaga ttaaaacact gaactgacaa ttaacagccc aatatctaca atcaaccaac 2400

aagtcattat taccctcact gtcaacccaa cacaggcatg ctcataagga aaggttaaaa 2460

aaagtaaaag gaactcggca aatcttaccc cgcctgttta ccaaaaacat cacctctagc 2520

atcaccagta ttagaggcac cgcctgccca gtgacacatg tttaacggcc gcggtaccct 2580

aaccgtgcaa aggtagcata atcacttgtt ccttaaatag ggacctgtat gaatggctcc 2640

acgagggttc agctgtctct tacttttaac cagtgaaatt gacctgcccg tgaagaggcg 2700

ggcataacac agcaagacga gaagacccta tggagcttta atttattaat gcaaacagta 2760

cctaacaaac ccacaggtcc taaactacca aacctgcatt aaaaatttcg gttggggcga 2820

cctcggagca gaacccaacc tccgagcagt acatgctaag acttcaccag tcaaagcgaa2880

ctactatact caattgatcc aataacttga ccaacggaac aagttaccct agggataaca 2940

gcgcaatcct attctagagt ccatatcaac aatagggttt acgacctcga tgttggatca 3000

ggacatcccg atggtgcagc cgctattaaa ggttcgtttg ttcaacgatt aaagtcctac 3060

gtgatctgag ttcagaccgg agtaatccag gtcggtttct atctacnttc aaattcctcc 3120

ctgtacgaaa ggacaagaga aataaggcct acttcacaaa gcgccttccc ccgtaaatga 3180

tatcatctca acttagtatt atacccacac ccacccaaga acagggtttg ttaagatggc 3240

agagcccggt aatcgcataa aacttaaaac tttacagtca gaggttcaat tcctcttctt 3300

aacaacatac ccatggccaa cctcctactc ctcattgtac ccattctaat cgcaatggca 3360

ttcctaatgc ttaccgaacg aaaaattcta ggctatatac aactacgcaa aggccccaac 3420

gttgtaggcc cctacgggct actacaaccc ttcgctgacg ccataaaact cttcaccaaa 3480

gagcccctaa aacccgccac atctaccatc accctctaca tcaccgcccc gaccttagct 3540

ctcaccatcg ctcttctact atgaaccccc ctccccatac ccaaccccct ggtcaacctc 3600

aacctaggcc tcctatttat tctagccacc tctagcctag ccgtttactc aatcctctga 3660

tcagggtgag catcaaactc aaactacgcc ctgatcggcg cactgcgagc agtagcccaa 3720

acaatctcat atgaagtcac cctagccatc attctactat caacattact aataagtggc 3780

tcctttaacc tctccaccct tatcacaaca caagaacacc tctgattact cctgccatca 3840

tgacccttgg ccataatatg atttatctcc acactagcag agaccaaccg aacccccttc 3900

gaccttgccg aaggggagtc cgaactagtc tcaggcttca acatcgaata cgccgcaggc 3960

cccttcgccc tattcttcat agccgaatac acaaacatta ttataataaa caccctcacc 4020

actacaatct tcctaggaac aacatatgac gcactctccc ctgaactcta cacaacatat 4080

tttgtcacca agaccctact tctaacctcc ctgttcttat gaattcgaac agcatacccc 4140

cgattccgct acgaccaact catacacctc ctatgaaaaa acttcctacc actcacccta 4200

gcattactta tatgatatgt ctccataccc attacaatct ccagcattcc ccctcaaacc 4260

taagaaatat gtctgataaa agagttactt tgatagagta aataatagga gcttaaaccc 4320

ccttatttct aggactatga gaatcgaacc catccctgag aatccaaaat tctccgtgcc 4380

acctatcaca ccccatccta aagtaaggtc agctaaataa gctatcgggc ccataccccg 4440

aaaatgttgg ttataccctt cccgtactaa ttaatcccct ggcccaaccc gtcatctact 4500

ctaccatctt tgcaggcaca ctcatcacag cgctaagctc gcactgattt tttacctgag 4560

taggcctaga aataaacatg ctagctttta ttccagttct aaccaaaaaa ataaaccctc 4620

gttccacaga agctgccatc aagtatttcc tcacgcaagc aaccgcatcc ataatccttc 4680

taatagctat cctcttcaac aatatactct ccggacaatg aaccataacc aatactacca 4740

atcaatactc atcattaata atcataatag ctatagcaat aaaactagga atagccccct 4800

ttcacttctg agtcccagag gttacccaag gcacccctct gacatccggc ctgcttcttc 4860

tcacatgaca aaaactagcc cccatctcaa tcatatacca aatctctccc tcactaaacg 4920

taagccttct cctcactctc tcaatcttat ccatcatagc aggcagttga ggtggattaa 4980

accaaaccca gctacgcaaa atcttagcat actcctcaat tacccacata ggatgaataa 5040

tagcagttct accgtacaac cctaacataa ccattcttaa tttaactatt tatattatcc 5100

taactactac cgcattccta ctactcaact taaactccag caccacgacc ctactactat 5160

ctcgcacctg aaacaagcta acatgactaa cacccttaat tccatccacc ctcctctccc 5220

taggaggcct gcccccgcta accggctttt tgcccaaatg ggccattatc gaagaattca 5280

caaaaaacaa tagcctcatc atccccacca tcatagccac catcaccctc cttaacctct 5340

acttctacct acgcctaatc tactccacct caatcacact actccccata tctaacaacg 5400

taaaaataaa atgacagttt gaacatacaa aacccacccc attcctcccc acactcatcg 5460

cccttaccac gctactccta cctatctccc cttttatact aataatctta tagaaattta 5520

ggttaaatac agaccaagag ccttcaaagc cctcagtaag ttgcaatact taatttctgt 5580

aacagctaag gactgcaaaa ccccactctg catcaactga acgcaaatca gccactttaa5640

ttaagctaag cccttactag accaatggga cttaaaccca caaacactta gttaacagct 5700

aagcacccta atcaactggc ttcaatctac ttctcccgcc gccgggaaaa aaggcgggag 5760

aagccccggc aggtttgaag ctgcttcttc gaatttgcaa ttcaatatga aaatcacctc 5820

ggagctggta aaaagaggcc taacccctgt ctttagattt acagtccaat gcttcactca 5880

gccattttac ctcaccccca ctgatgttcg ccgaccgttg actattctct acaaaccaca 5940

aagacattgg aacactatac ctattattcg gcgcatgagc tggagtccta ggcacagctc 6000

taagcctcct tattcgagcc gagctgggcc agccaggcaa ccttctaggt aacgaccaca 6060

tctacaacgt tatcgtcaca gcccatgcat ttgtaataat cttcttcata gtaataccca 6120

tcataatcgg aggctttggc aactgactag ttcccctaat aatcggtgcc cccgatatgg 6180

cgtttccccg cataaacaac ataagcttct gactcttacc tccctctctc ctactcctgc 6240

tcgcatctgc tatagtggag gccggagcag gaacaggttg aacagtctac cctcccttag 6300

cagggaacta ctcccaccct ggagcctccg tagacctaac catcttctcc ttacacctag 6360

caggtgtctc ctctatctta ggggccatca atttcatcac aacaattatc aatataaaac 6420

cccctgccat aacccaatac caaacgcccc tcttcgtctg atccgtccta atcacagcag 6480

tcctacttct cctatctctc ccagtcctag ctgctggcat cactatacta ctaacagacc 6540

gcaacctcaa caccaccttc ttcgaccccg ccggaggagg agaccccatt ctataccaac 6600

acctattctg atttttcggt caccctgaag tttatattct tatcctacca ggcttcggaa 6660

taatctccca tattgtaact tactactccg gaaaaaaaga accatttgga tacataggta 6720

tggtctgagc tatgatatca attggcttcc tagggtttat cgtgtgagca caccatatat 6780

ttacagtagg aatagacgta gacacacgag catatttcac ctccgctacc ataatcatcg 6840

ctatccccac cggcgtcaaa gtatttagct gactcgccac actccacgga agcaatatga 6900

aatgatctgc tgcagtgctc tgagccctag gattcatctt tcttttcacc gtaggtggcc 6960

tgactggcat tgtattagca aactcatcac tagacatcgt actacacgac acgtactacg 7020

ttgtagccca cttccactat gtcctatcaa taggagctgt atttgccatc ataggaggct 7080

tcattcactg atttccccta ttctcaggct acaccctaga ccaaacctac gccaaaatcc 7140

atttcactat catattcatc ggcgtaaatc taactttctt cccacaacac tttctcggcc 7200

tatccggaat gccccgacgt tactcggact accccgatgc atacaccaca tgaaacatcc 7260

tatcatctgt aggctcattc atttctctaa cagcagtaat attaataatt ttcatgattt 7320

gagaagcctt cgcttcgaag cgaaaagtcc taatagtaga agaaccctcc ataaacctgg 7380

agtgactata tggatgcccc ccaccctacc acacattcga agaacccgta tacataaaat 7440

ctagacaaaa aaggaaggaa tcgaaccccc caaagctggt ttcaagccaa ccccatggcc 7500

tccatgactt tttcaaaaag gtattagaaa aaccatttca taactttgtc aaagttaaat 7560

tataggctaa atcctatata tcttaatggc acatgcagcg caagtaggtc tacaagacgc 7620

tacttcccct atcatagaag agcttatcac ctttcatgat cacgccctca taatcatttt 7680

ccttatctgc ttcctagtcc tgtatgccct tttcctaaca ctcacaacaa aactaactaa 7740

tactaacatc tcagacgctc aggaaataga aaccgtctga actatcctgc ccgccatcat 7800

cctagtcctc atcgccctcc catccctacg catcctttac ataacagacg aggtcaacga 7860

tccctccctt accatcaaat caattggcca ccaatggtac tgaacctacg agtacaccga 7920

ctacggcgga ctaatcttca actcctacat acttccccca ttattcctag aaccaggcga 7980

cctgcgactc cttgacgttg acaatcgagt agtactcccg attgaagccc ccattcgtat 8040

aataattaca tcacaagacg tcttgcactc atgagctgtc cccacattag gcttaaaaac 8100

agatgcaatt cccggacgtc taaaccaaac cactttcacc gctacacgac cgggggtata 8160

ctacggtcaa tgctctgaaa tctgtggagc aaaccacagt ttcatgccca tcgtcctaga 8220

attaattccc ctaaaaatct ttgaaatagg gcccgtattt accctatagc accccctcta 8280

ccccctctag agcccactgt aaagctaact tagcattaac cttttaagtt aaagattaag 8340

agaaccaaca cctctttaca gtgaaatgcc ccaactaaat actaccgtat ggcccaccat 8400

aattaccccc atactcctta cactattcct catcacccaa ctaaaaatat taaacacaaa 8460

ctaccaccta cctccctcac caaagcccat aaaaataaaa aattataaca aaccctgaga 8520

accaaaatga acgaaaatct gttcgcttca ttcattgccc ccacaatcct aggcctaccc 8580

gccgcagtac tgatcattct atttccccct ctattgatcc ccacctccaa atatctcatc 8640

aacaaccgac taatcaccac ccaacaatga ctaatcaaac taacctcaaa acaaatgata 8700

accatacaca acactaaagg acgaacctga tctcttatac tagtatcctt aatcattttt 8760

attgccacaa ctaacctcct cggactcctg cctcactcat ttacaccaac cacccaacta 8820

tctataaacc tagccatggc catcccctta tgagcgggca cagtgattat aggctttcgc 8880

tctaagatta aaaatgccct agcccacttc ttaccacaag gcacacctac accccttatc 8940

cccatactag ttattatcga aaccatcagc ctactcattc aaccaatagc cctggccgta 9000

cgcctaaccg ctaacattac tgcaggccac ctactcatgc acctaattgg aagcgccacc 9060

ctagcaatat caaccattaa ccttccctct acacttatca tcttcacaat tctaattcta 9120

ctgactatcc tagaaatcgc tgtcgcctta atccaagcct acgttttcac acttctagta 9180

agcctctacc tgcacgacaa cacataatga cccaccaatc acatgcctat catatagtaa 9240

aacccagccc atgaccccta acaggggccc tctcagccct cctaatgacc tccggcctag9300

ccatgtgatt tcacttccac tccataacgc tcctcatact aggcctacta accaacacac 9360

taaccatata ccaatgatgg cgcgatgtaa cacgagaaag cacataccaa ggccaccaca 9420

caccacctgt ccaaaaaggc cttcgatacg ggataatcct atttattacc tcagaagttt 9480

ttttcttcgc aggatttttc tgagcctttt accactccag cctagcccct accccccaat 9540

taggagggca ctggccccca acaggcatca ccccgctaaa tcccctagaa gtcccactcc 9600

taaacacatc cgtattactc gcatcaggag tatcaatcac ctgagctcac catagtctaa 9660

tagaaaacaa ccgaaaccaa ataattcaag cactgcttat tacaatttta ctgggtctct 9720

attttaccct cctacaagcc tcagagtact tcgagtctcc cttcaccatt tccgacggca 9780

tctacggctc aacatttttt gtagccacag gcttccacgg acttcacgtc attattggct 9840

caactttcct cactatctgc ttcatccgcc aactaatatt tcactttaca tccaaacatc 9900

actttggctt cgaagccgcc gcctgatact ggcattttgt agatgtggtt tgactatttc 9960

tgtatgtctc catctattga tgagggtctt actcttttag tataaatagt accgttaact 10020

tccaattaac tagttttgac aacattcaaa aaagagtaat aaacttcgcc ttaattttaa 10080

taatcaacac cctcctagcc ttactactaa taattattac attttgacta ccacaactca 10140

acggctacat agaaaaatcc accccttacg agtgcggctt cgaccctata tcccccgccc10200

gcgtcccttt ctccataaaa ttcttcttag tagctattac cttcttatta tttgatctag 10260

aaattgccct ccttttaccc ctaccatgag ccctacaaac aactaacctg ccactaatag 10320

ttatgtcatc cctcttatta atcatcatcc tagccctaag tctggcctat gagtgactac 10380

aaaaaggatt agactgaacc gaattggtat atagtttaaa caaaacgaat gatttcgact 10440

cattaaatta tgataatcat atttaccaaa tgcccctcat ttacataaat attatactag 10500

catttaccat ctcacttcta ggaatactag tatatcgctc acacctcata tcctccctac 10560

tatgcctaga aggaataata ctatcgctgt tcattatagc tactctcata accctcaaca 10620

cccactccct cttagccaat attgtgccta ttgccatact agtctttgcc gcctgcgaag 10680

cagcggtggg cctagcccta ctagtctcaa tctccaacac atatggccta gactacgtac 10740

ataacctaaa cctactccaa tgctaaaact aatcgtccca acaattatat tactaccact 10800

gacatgactt tccaaaaaac acataatttg aatcaacaca accacccaca gcctaattat10860

tagcatcatc cctctactat tttttaacca aatcaacaac aacctattta gctgttcccc 10920

aaccttttcc tccgaccccc taacaacccc cctcctaata ctaactacct gactcctacc 10980

cctcacaatc atggcaagcc aacgccactt atccagtgaa ccactatcac gaaaaaaact11040

ctacctctct atactaatct ccctacaaat ctccttaatt ataacattca cagccacaga 11100

actaatcata ttttatatct tcttcgaaac cacacttatc cccaccttgg ctatcatcac 11160

ccgatgaggc aaccagccag aacgcctgaa cgcaggcaca tacttcctat tctacaccct 11220

agtaggctcc cttcccctac tcatcgcact aatttacact cacaacaccc taggctcact 11280

aaacattcta ctactcactc tcactgccca agaactatca aactcctgag ccaacaactt 11340

aatatgacta gcttacacaa tagcttttat agtaaagata cctctttacg gactccactt 11400

atgactccct aaagcccatg tcgaagcccc catcgctggg tcaatagtac ttgccgcagt 11460

actcttaaaa ctaggcggct atggtataat acgcctcaca ctcattctca accccctgac 11520

aaaacacata gcctacccct tccttgtact atccctatga ggcataatta taacaagctc 11580

catctgccta cgacaaacag acctaaaatc gctcattgca tactcttcaa tcagccacat 11640

agccctcgta gtaacagcca ttctcatcca aaccccctga agcttcaccg gcgcagtcat 11700

tctcataatc gcccacgggc ttacatcctc attactattc tgcctagcaa actcaaacta 11760

cgaacgcact cacagtcgca tcataatcct ctctcaagga cttcaaactc tactcccact 11820

aatagctttt tgatgacttc tagcaagcct cgctaacctc gccttacccc ccactattaa 11880

cctactggga gaactctctg tgctagtaac cacgttctcc tgatcaaata tcactctcct 11940

acttacagga ctcaacatac tagtcacagc cctatactcc ctctacatat ttaccacaac 12000

acaatggggc tcactcaccc accacattaa caacataaaa ccctcattca cacgagaaaa 12060

caccctcatg ttcatacacc tatcccccat tctcctccta tccctcaacc ccgacatcat 12120

taccgggttt tcctcttgta aatatagttt aaccaaaaca tcagattgtg aatctgacaa 12180

cagaggctta cgacccctta tttaccgaga aagctcacaa gaactgctaa ctcatgcccc 12240

catgtctaac aacatggctt tctcaacttt taaaggataa cagctatcca ttggtcttag 12300

gccccaaaaa ttttggtgca actccaaata aaagtaataa ccatgcacac tactataacc 12360

accctaaccc tgacttccct aattcccccc atccttacca ccctcgttaa ccctaacaaa 12420

aaaaactcat acccccatta tgtaaaatcc attgtcgcat ccacctttat tatcagtctc 12480

ttccccacaa caatattcat gtgcctagac caagaagtta ttatctcgaa ctgacactga 12540

gccacaaccc aaacaaccca gctctcccta agcttcaaac tagactactt ctccataata 12600

ttcatccctg tagcattgtt cgttacatgg tccatcatag aattctcact gtgatatata 12660

aactcagacc caaacattaa tcagttcttc aaatatctac tcatcttcct aattaccata 12720

ctaatcttag ttaccgctaa caacctattc caactgttca tcggctgaga gggcgtagga 12780

attatatcct tcttgctcat cagttgatga tacgcccgag cagatgccaa cacagcagcc 12840

attcaagcaa tcctatacaa ccgtatcggc gatatcggtt tcatcctcgc cttagcatga 12900

tttatcctac actccaactc atgagaccca caacaaatag cccttctaaa cgctaatcca 12960

agcctcaccc cactactagg cctcctccta gcagcagcag gcaaatcagc ccaattaggt 13020

ctccacccct gactcccctc agccatagaa ggccccaccc cagtctcagc cctactccac 13080

tcaagcacta tagttgtagc aggaatcttc ttactcatcc gcttccaccc cctagcagaa 13140

aatagcccac taatccaaac tctaacacta tgcttaggcg ctatcaccac tctgttcgca 13200

gcagtctgcg cccttacaca aaatgacatc aaaaaaatcg tagccttctc cacttcaagt 13260

caactaggac tcataatagt tacaatcggc atcaaccaac cacacctagc attcctgcac 13320

atctgtaccc acgccttctt caaagccata ctatttatgt gctccgggtc catcatccac 13380

aaccttaaca atgaacaaga tattcgaaaa ataggaggac tactcaaaac catacctctc 13440

acttcaacct ccctcaccat tggcagccta gcattagcag gaataccttt cctcacaggt 13500

ttctactcca aagaccacat catcgaaacc gcaaacatat catacacaaa cgcctgagcc 13560

ctatctatta ctctcatcgc tacctccctg acaagcgcct atagcactcg aataattctt 13620

ctcaccctaa caggtcaacc tcgcttcccc acccttacta acattaacga aaataacccc 13680

accctactaa accccattaa acgcctggca gccggaagcc tattcgcagg atttctcatt 13740

actaacaaca tttcccccgc atcccccttc caaacaacaa tccccctcta cctaaaactc 13800

acagccctcg ctgtcacttt cctaggactt ctaacagccc tagacctcaa ctacctaacc 13860

aacaaactta aaataaaatc cccactatgc acattttatt tctccaacat actcggattc 13920

taccctagca tcacacaccg cacaatcccc tatctaggcc ttcttacgag ccaaaacctg 13980

cccctactcc tcctagacct aacctgacta gaaaagctat tacctaaaac aatttcacag 14040

caccaaatct ccacctccat catcacctca acccaaaaag gcataattaa actttacttc 14100

ctctctttct tcttcccact catcctaacc ctactcctaa tcacataacc tattcccccg 14160

agcaatctca attacaatat atacaccaac aaacaatgtt caaccagtaa ctactactaa 14220

tcaacgccca taatcataca aagcccccgc accaatagga tcctcccgaa tcaaccctga 14280

cccctctcct tcataaatta ttcagcttcc tacactatta aagtttacca caaccaccac 14340

cccatcatac tctttcaccc acagcaccaa tcctacctcc atcgctaacc ccactaaaac 14400

actcaccaag acctcaaccc ctgaccccca tgcctcagga tactcctcaa tagccatcgc 14460

tgtagtatat ccaaagacaa ccatcattcc ccctaaataa attaaaaaaa ctattaaacc 14520

catataacct cccccaaaat tcagaataat aacacacccg accacaccgc taacaatcaa 14580

tactaaaccc ccataaatag gagaaggctt agaagaaaac cccacaaacc ccattactaa 14640

acccacactc aacagaaaca aagcatacat cattattctc gcacggacta caaccacgac 14700

caatgatatg aaaaaccatc gttgtatttc aactacaaga acaccaatga ccccaatacg 14760

caaaactaac cccctaataa aattaattaa ccactcattc atcgacctcc ccaccccatc 14820

caacatctcc gcatgatgaa acttcggctc actccttggc gcctgcctga tcctccaaat 14880

caccacagga ctattcctag ccatgcacta ctcaccagac gcctcaaccg ccttttcatc 14940

aatcgcccac atcactcgag acgtaaatta tggctgaatc atccgctacc ttcacgccaa 15000

tggcgcctca atattcttta tctgcctctt cctacacatc gggcgaggcc tatattacgg 15060

atcatttctc tactcagaaa cctgaaacat cggcattatc ctcctgcttg caactatagc 15120

aacagccttc ataggctatg tcctcccgtg aggccaaata tcattctgag gggccacagt 15180

aattacaaac ttactatccg ccatcccata cattgggaca gacctagttc aatgaatctg 15240

aggaggctac tcagtagaca gtcccaccct cacacgattc tttacctttc acttcatctt 15300

gcccttcatt attgcagccc tagcaacact ccacctccta ttcttgcacg aaacgggatc 15360

aaacaacccc ctaggaatca cctcccattc cgataaaatc accttccacc cttactacac 15420

aatcaaagac gccctcggct tacttctctt ccttctctcc ttaatgacat taacactatt 15480

ctcaccagac ctcctaggcg acccagacaa ttatacccta gccaacccct taaacacccc 15540

tccccacatc aagcccgaat gatatttcct attcgcctac acaattctcc gatccgtccc 15600

taacaaacta ggaggcgtcc ttgccctatt actatccatc ctcatcctag caataatccc 15660

catcctccat atatccaaac aacaaagcat aatatttcgc ccactaagcc aatcacttta 15720

ttgactccta gccgcagacc tcctcattct aacctgaatc ggaggacaac cagtaagcta 15780

cccttttacc atcattggac aagtagcatc cgtactatac ttcacaacaa tcctaatcct 15840

aataccaact atctccctaa ttgaaaacaa aatactcaaa tgggcctgtc cttgtagtat 15900

aaactaatac accagtcttg taaaccggag atgaaaacct ttttccaagg acaaatcaga 15960

gaaaaagtct ttaactccac cattagcacc caaagctaag attctaattt aaactattct 16020

ctgttctttc atggggaagc agatttgggt accacccaag tattgactca cccatcaaca 16080

accgctatgt atttcgtaca ttactgccag ccaccatgaa tattgtacgg taccataaat 16140

acttgaccac ctgtagtaca taaaaaccca atccacatca aaaccccctc cccatgctta 16200

caagcaagta cagcaatcaa ccctcaacta tcacacatca actgcaactc caaagccacc 16260

cctcacccac taggatacca acaaacctac ccacccttaa cagtacatag tacataaagc 16320

catttaccgt acatagcaca ttacagtcaa atcccttctc gtccccatgg atgacccccc 16380

tcagataggg gtcccttgac caccatcctc cgtgaaatca atatcccgca caagagtgct 16440

actctcctcg ctccgggccc ataacacttg ggggtagcta aagtgaactg tatccgacat 16500

ctggttccta cttcagggtc ataaagccta aatagcccac acgttcccct taaataagac 16560

atcacgatg 16569

Claims (5)

1. the plastosome T3866C detection kit of a Leber disease, it is characterized in that, by the PCR mixed solution (2) that is placed in DNA extraction mixed solution (1) in box body (8), amplification T3866C, for a pair of outer primer (3) of T3866C design, a pair of inner primer (4), restriction enzyme (5), positive control (6) and negative control (7) formation for the T3866C design, wherein DNA extraction mixed solution (1) is comprised of cell pyrolysis liquid and solution I, and the PCR mixed solution of amplification T3866C is by deoxymononucleotide, 10 * PCR damping fluid, MgCl ₂, tri-distilled water and archaeal dna polymerase form, a pair of outer primer for the T3866C design has outer forward direction primers F: TACTTCACAAAGCGCCTTCC and outer reverse primer R:AAGGATTATGGATGCGGTTG, a pair of inner primer for the T3866C design has interior forward direction primers F: CAACACAAGAACACCTCTGATTACTCCTGCCAT CATGACCCTTGGCCATAATATGATAGA and interior reverse primer R:GAGAGTGCGTCATATGTTGTTCCT AGGAAGA, restriction enzyme is restriction enzyme BglII, positive control (6) they are to contain mtDNA sequence the 3866th site T occurs〉enzyme of C sudden change cuts sample, negative control (7) is not contain mtDNA sequence the 3866th site T occurs〉enzyme of C sudden change cuts sample, the composition of solution I is Proteinase K.

2. the plastosome T3866C detection kit of a kind of Leber disease according to claim 1, is characterized in that, adds 0.1-0.2 μ l dimethyl sulfoxide (DMSO) in the PCR mixed solution (2) of amplification T3866C.

3. the plastosome T3866C detection kit of a kind of Leber disease according to claim 1 and 2 is detecting the chondriogen sick relevant to matrilinear inheritance primary LeberShi ND1Application in the T3866C sudden change.

4. application according to claim 3, is characterized in that, realizes by following steps:

(1) extraction of genomic dna: use the protease K digesting cracking process, extract genomic dna from a small amount of blood preparation, the sample of hair, oral mucosa scraping blade or saliva with hair follicle;

(2) specific PCR amplification: use Primer 5.0 softwares and Oligo7.0 software according to the designed primers F of homo mitochondrion gene sequence shown in SEQ ID NO:5 _Outward/ R _Outward, F _In/ R _InThe fragment that can amplify the mitochondrial mutations site that comprises above-mentioned primary LeberShi disease, F is outer/and R amplifies the Nucleotide 3150-4679 into Mitochondrial DNA outward, and its sequence is the SEQ ID NO:1,2 in sequence table; F _In/ R _InAmplify the Nucleotide 3806-4058 for Mitochondrial DNA, its sequence is the SEQ ID NO:3,4 in sequence table;

(3) enzyme is cut evaluation: with above-mentioned PCR product restriction enzyme BglII is carried out enzyme to place, T3866C mutational site and is cut;

(4) sudden change detects: polyacrylamide gel electrophoresis detects, and directly cuts according to enzyme DNA fragmentation quantity and the DNA fragmentation size that the PCR product produces, and detects mtDNA whether the T3866C sudden change occurs.

5. application according to claim 4, is characterized in that, step (1) described from blood specimen, the sample of hair, oral mucosa scraping blade or saliva with hair follicle the rapid extraction genomic dna, obtain by the following method:

(1) blood specimen: get 20～200 μ l blood specimen or 1cm ²The blood filter paper put into the 1.5ml centrifuge tube, add 900 μ l erythrocyte splitting damping fluids, the 20mmol/L tris-HCI buffer, pH 7.6, the standing 10min of room temperature, abundant splitting erythrocyte, the centrifugal 1min of 12000rpm collects the white corpuscle precipitation;

(2) with the hair of hair follicle: wash with the hair of hair follicle 1 time with volume ratio 70% ethanol, after use again the distilled water flushing hair 2 times, put into respectively 2～4 hairs in the 1.5ml centrifuge tube, hair follicle is placed in bottom centrifuge tube, cuts off hair higher than the part of centrifuge tube with clean scissors;

(3) oral mucosa scraping blade or saliva: before collecting saliva, must allow the person of being collected gargle, to remove the materials such as aged cells too much in the oral cavity, swill, toothpaste, coffee, cigarette, do not drink water in half an hour, feed, smoking, then begin to collect oral mucosa scraping blade or saliva, select following method to collect saliva sample: 1. tongue is around oral cavity scraping mucomembranous cell, and about 0.1ml saliva is directly told in the EP pipe; 2. physiological saline is gargled, and tells in centrifuge tube, draws PBS solution to the centrifuge tube that the saliva sample of collecting by above-mentioned any method is housed, and after piping and druming, the centrifugal 5min of 12000rpm removes supernatant, repeats this process once repeatedly; 3. repeatedly scrape the cheek inwall 6 times with cotton swab, then air drying carefully tears its outside surface off with the tweezers of sterilizing, and puts into centrifuge tube; 4. saliva is told on filter paper, form salivary stain after air drying, then be cut into big or small approximately 1cm with clean scissors ²A scrap of paper is placed in centrifuge tube;

Then with cell pyrolysis liquid and Proteinase K, above-mentioned sample is digested cracking, utilize salting-out process to remove impurity, isopropanol precipitating DNA is at last with saving backup in-20 ℃ after autoclaving water or the dissolving of TE damping fluid.

Images