CN103169986A - Mosaic type DNA (Deoxyribonucleic Acid) vaccine pVAXI-Hsp 70/CD 80 for preventing and immunologically treating tuberculosis - Google Patents

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a tubercular mosaic type DNA (Deoxyribonucleic Acid) vaccine. The tubercular mosaic type DNA vaccine solves the technical problems of nonideal medicine effect and bad safety of the traditional mosaic vaccine. The technical scheme is as follows: the mosaic type DNA vaccine contains the encoding gene of HSP 70/CD 80 mosaic protein and can express the encoding gene in vivo. After using a pVAXI carrier, the tubercular mosaic type DNA vaccine disclosed by the invention has a better effect on the prevention and treatment of tuberculosis and can especially be used for inducing stronger Th1 type reaction and better prevent and treat tuberculosis; and besides, the pVAXI carrier has kanamycin resistance, cannot cause any anaphylactic reaction and can better prevent and immunologically treat tuberculosis.

Description

The mosaic type DNA vaccine in use pVAXI-Hsp70/CD80 that is used for tuberculosis prophylaxis and immunization therapy

Technical field

The invention belongs to biomedicine field, the tool invention relates to a kind of Vaccinum Calmette-Guerini, relates in particular to a kind of chimeric dna molecule that can induce and strengthen protective immune response (humoral immunization and cellular immunization) in human or animal body.This DNA molecular can be used as vaccine, is used for prevention lungy and treatment.

Background technology

After twice tuberculosis peak in rebound occurring with the World War II whole world for the first time, the mid-80, because sharply worsening again, tuberculosis epidemic situation in world wide forms peak in rebound for the third time, according to " World Health Organization's bulletin ", global institute has age death toll in 1996, after tuberculosis is held in both hands and is listed in the dead number of cases of ischemic heart desease, cerebrovascular disease and acute lower respiratory infection, occupy the 4th, account for single sick kind the in the whole world and cause first of dead number of cases, the tidemark of wound one-hundred-year history.Die from the lame number of tuberculosis and reach 3,000,000 global every year, have every day 8000 people to die from tuberculosis, it is lame that every 10 seconds kinds just have 1 people to die from tuberculosis. and poverty, recurrent population, anti-multiple medicines tuberculosis increase and the popular tuberculosis that makes of AIDS becomes global serious public health problem (Cole ST.Why sequence the genome of Mycobacterium tuberculosis Tubercle Lung.Dis.1996 more; 77:486-490.), thereby cause the very big concern of international community.The secret of using modern molecular biology method announcement minute skill bacillus is the central issue of present research strategy. will obtain the bio information of a large amount of relevant tubercule bacillus by analyzing tubercle bacillus gene group DNA sequence, use these information and can understand generation lungy, evolution, and can strengthen research to diagnosis lungy, treatment and the new measure of prevention.

Bacillus calmette-guerin vaccine (BCO) is to be to the phthisical vaccine of unique prevention that goes through to use so far, and use over 100,000,000 doses in annual market.But bacillus calmette-guerin vaccine is not but desirable vaccine.Although bacillus calmette-guerin vaccine has certain protective effect to the child, it does not have effectiveness to the adult.

Bacillus calmette-guerin vaccine is live bacterial vaccines.Since bacillus calmette-guerin vaccine by the Frenchman after 1908-1921 succeeds in developing, bacterial strain is by the continuous passage in culture fluid of various countries' laboratory, until the appearance of low temperature (subzero 80 degree) refrigerator in 1961 is just by cryopreservation.Nearest gene bank (Genome) studies show that; tens kinds of bacillus calmette-guerin vaccines that use in the whole world at present have been no longer same bacterial strains; many genetic fragments are lost. and this is to cause one of reason that the bacillus calmette-guerin vaccine protective effect weakens; also explained the why clinical experiment of drought period; bacillus calmette-guerin vaccine shows good protectiveness (nineteen thirty; Britain; 80% protective rate); and later stage bacillus calmette-guerin vaccine result far unsatisfactory (India in 1970; 0% protective rate) (Liu Jun, Canadian national health institute.National defence consumptive disease magazine in the diagnosis of pulmonary tuberculosis (TB) and prevention new technique.2003,25, supplementary issue: 20-22): 1995 every WHO also issue a statement and point out, the BCG multiple cropping does not have scientific basis, so do not advocate multiple cropping.the BCG immuning failure is (Baldwin SL relevant to following factors also, D, Souza C, Roberts A D, et al.Evaluation of new vaccines in the mouse and guinea pigmodel of tuberculosis.Infect 1mmun 1998, 66 (6): 2951-2959): (1) BCG can not improve the level of protection that has had the immunity crowd due to other factors, (2) individuality with age, might continue to touch the mycobacterium antigen of surrounding, thereby (Here it is, and BCG prevention childhood tuberculosis is respond well to push this immunoreation to the Th2 type from the Thl type, and to adult weak effect main cause).In light of this situation, a kind of qualified novel vaccine should return to the protectiveness Shan memory immune state of Thl type; Therefore, safe, effective, the inexpensive vaccine of new generation of development becomes a urgent and important job.

Heat shock protein (heat shock protein, hsp) is the protein that a class has the high conservative of important biomolecule and immunologic function, is present in protokaryon and eukaryotic cell.mycobacterium hsp70 comprises a plurality of T cells and B cell epitope, immunogenicity is very strong, characteristics with immunodominance antigen (immunodominant antigen), can induce the cell effect of specificity T hl type, and generation IFN-r (r-IFN) and interleukin 12, attack to tubercule bacillus can produce stronger protective immunity effect (Mckenzie.KR, Adams E, Britton WJ, et a1, Sequence and immunogenicity of the 70-kDa heat shock protein ofMycobacterium leprae.J.Immune.1991, 147:312-319.).

B7-1 (B7-1) is one of important costimulatory molecules with immune activation function (costimulatory molecule).Studies show that immunoregulation in recent years, during the T cell activation, essential two signals, to be φt cell receptor (TCR) be combined with the MHC-Ag on antigen presenting cell (APCs) the surface first signal that produces, with the secondary signal that is provided by costimulatory molecules (costimulatory signal), if the shortage costimulatory signal, the T cells can not be activated fully and be presented state of anergy (Anergy), apoptosis (Apoptosis) perhaps occurs.B7-1

(costimulatory receptor CD28 common with it and, or the CTLA-4 interphase interaction can provide the T cell activation necessary costimulatory signal, inducing T cell produces r-IFN, humoral immunization and cellular immunization had comprehensive activation, systemic autoimmune encephalomyelitis (EAE) model, prove that B7-1 can promote Thl type cell effect (Orme 1 M.Progress in the development of new vaccines against tuberculosis.Inl.J.Tuberc.Lung.Dis.1997 by experiment; 1 (2): 95-100 and Lenschow D J, Walunas T L andBluestone J A.CD28/B7system of T cell costimulation.Annu.Rev.Iramunol.1996; 14:233.).

R-IFN is mainly produced by the T cell; Main activity is to participate in immunomodulating, is important immunoregulatory factor in body, realizes its antiviral, antitumor action by enhancing human body immunity mechanism, booster immunization supervisory role.The immunoregulation effect of r-IFN shows the impact on the activity of host immune cell, as making the expression of its surperficial mhc class ii molecule to macrophage, strengthens its antigen presentation ability; Can also strengthen in addition Macrophage Surface and express the Fc receptor, promote the macrophage phagocytic immunity to bring back to life pathogen and the tumor cell of thing, antibody sandwich.Simultaneously, differentiation to B cell and CD8+T cell has facilitation, can strengthen the activity of Thl cell, strengthen cellular immune function (HathcockKS, Laszlo GJ Pucillo C, et alComparitive analysisofB7-1andB7-2costimulatoryligands:Expressionandf unction.J.Exp.Med 1994; 180:631-640.).

Because BCG can not turn to the THI type from the TH2 type with immune state, caused BCG as the existing defective of vaccine prevention tuberculosis, chimeric through selecting mycobacterium hsp70 gene and people B7-l gene to carry out at molecular level, be built into the novel tuberculosis DNA vaccination; Wherein hsp70 provides the immunologic opsonin signal, induces the cell effect of specificity T hl type, produces r-IFN and IL-12; It is costimulatory signal that B7-1 provides secondary signal, and indirect induction T cell produces r-IFN, comprehensively activating cell and humoral immunization.By both combineds effect, push the immune state of humans and animals to the Thl type by the Th2 type, reach the effect of prevention and treatment tuberculosis and other infectious disease.

Summary of the invention

The technical problem to be solved in the present invention is to provide a kind of new mosaic type DNA vaccine in use.This mosaic type DNA vaccine in use for contain following protein (a) or encoding gene (b) and can be in vivo with its expression the pVAXI plasmid:

(a) protein that forms of the described aminoacid sequence of SEQ ID No.2;

(b) process replaces, lacks and/or add one or several aminoacid and have the protein that has same or similar function with (a) described protein in the aminoacid sequence that SEQ ID No.2 limits.

Wherein, it is described that the nucleotides sequence of the encoding gene of above-mentioned protein is classified SEQ ID No.1 as.

Wherein, above-mentioned encoding gene is connected on the pVAXI plasmid, controls its expression by the CMV promoter of pVAXI plasmid.Specifically can be connected on the multiple clone site of pVAXI plasmid, handle its expression by the CMV promoter; As use the mode of Xba1 and Hind III double digestion to be connected into.

Wherein, above-mentioned mosaic type DNA vaccine in use, nucleotides sequence classify as shown in SEQ ID No.3.

The present invention also provides the purposes of mosaic type DNA vaccine in use in preparation prevention or immunization therapy tuberculosis, described mosaic type DNA vaccine in use for contain following protein (a) or encoding gene (b) and can be in vivo with its expression the pVAXI plasmid:

(a) protein that forms of the described aminoacid sequence of SEQ ID No.2;

(b) process replaces, lacks and/or add one or several aminoacid and have the protein that has same or similar function with (a) described protein in the aminoacid sequence that SEQ ID No.2 limits.

Wherein, the nucleotides sequence of the encoding gene of described protein is classified as shown in SEQ ID No.1.

Wherein, the encoding gene of described protein is controlled its expression by the CMV promoter on the pVAXI plasmid.

Wherein, the nucleotides sequence of described pVAXI plasmid is classified as shown in SEQ ID No.3.

Further, the nucleotides sequence of described mosaic type DNA vaccine in use is classified as shown in SEQ ID No.4.

The present invention also provides prevention or the immunization therapy tuberculosis that is prepared into take above-mentioned mosaic type DNA vaccine in use as main active simultaneously.

Protein coding gene sequence in above-mentioned mosaic type DNA vaccine in use is operationally to be connected in the pVAXI plasmid, can start transcribing of this protein coding gene sequence.Generally to handle its expression by the CMV promoter.Be connected in the pVAXI plasmid as the mode that can use Xba1 and Hind III double digestion, handle its expression by the CMV promoter.

The carrier of the pcDNA3.1-HSP70/CD80 chimeric that uses in the tuberculosis prevention and treatment research of former report is pcDNA3.1 (+), but the resistance that has ampicillin due to this carrier, can cause amp-S Producer anaphylaxis with the process that is used for pharmaceutical production at extensive this carrier of preparation, so consider that in follow-up research other carrier of conversion carries out the preparation of mosaic type DNA vaccine in use.Find unexpectedly in R﹠D process, use the pVAXI carrier to replace the mosaic type DNA vaccine in use that pcDNA3.1 (+) carrier loads the prepared one-tenth of encoding gene of tulase HSP70/ people CD80 chimeric protein, has obviously better effect for tuberculosis prophylaxis and treatment, especially can induce stronger Th1 type reaction, the IFN-γ of experimental subject is obviously increased, and proved that through zoopery the effect of its epidemic prevention and immunization therapy all obviously is better than pcDNA3.1-HSP70/CD8 and bacillus calmette-guerin vaccine.Therefore use pVAXI-HSP70/CD80 to prepare the tuberculosis chimeric when having improved safety, also the beat all drug effect that improved significantly, have better application prospect.

Description of drawings

Fig. 1, the pVAXI-Hsp70/CD80 sepharose electrophoresis figure before and after restriction endonuclease Hind III and Xba I double digestion.

Fig. 2, Western blot detect protein 24,46,72 hours eukaryotic expression results of pVAX1/Hsp70/CD80 transfection 293T cell.A: transfection 24,293T cell Hsp70 protein expression after 48,72 hours, M is Marker, and 1,3 and 5 is untransfected, and 2 for transfection after 24 hours, and 4 for after transfection 48, and 6 for transfection after 72 hours; B: transfection 24,293T cell CD80 protein expression after 46,72 hours, each swimming lane same A that distributes; C: stable transfection 293T cell Hsp70 protein expression, M is Marker, and 1 is untransfected, and 2 is stable transfection; D: stable transfection 293T cell CD80 protein expression, the same C of each swimming lane distribution.

The RT-PCR result that Fig. 3, pVAXI-Hsp70/CD80mRNA day part expression in vivo distribute.PVAXI-Hsp70/CD80mRNA expression in vivo distribution RT-PCR detects inoculation 7 days and inoculation 15 days muscle, lymph node, bone marrow, spleen, liver, lung, kidney, thymic tissues all have Hsp70 and CD80 to express.Inoculating 30 days has Hsp70 to express at muscle, lung regulating liver-QI, has no CD80 and expresses.Hsp70/CD80 did not all detect expression in 180 days.

Fig. 4, Rear time PCR detect the result of IFN-γ and IL-4 gene expression.

The specific embodiment

In following embodiment, all unreceipted concrete experiment conditions, be according to normal condition well known to those skilled in the art, Sambrook J for example, Russell D.W., 2001, Molecular Cloning:A laboratory manual (3rd ed), the condition described in Spring Harbor Laboratory Press.Or the usual experiment condition of the conditioned disjunction this area of advising according to manufacturer.

Embodiment one pVAXI-Hsp70/CD80 Vector construction of the present invention and evaluation and biological activity

(1) material and reagent:

1.1 material and facility

PVAXI plasmid g is enough in invitrogen company; The LIPOFECTAMINE2000 lipofectamine is enough in invitrogen company; The pcDNA3.1-Hsp70/CD80 eukaryotic expression builds preservation in earlier stage for this laboratory, also can build (Chinese patent ZL200410001785.0, publication number CN1562362) according to the record of prior art; Competent cell E.coli DH5 α is available from Invitrogen company; HEKC 293T is available from Chinese Academy of Sciences's cell bank; 20 of female Sexual health BALB/c mouse of SPF level are available from Third Military Medical University; Restricted enzyme HindIII, XbaI, T4 ligase are available from New England Biolabs(NEB company); DNA fragmentation reclaims test kit available from the precious biotech firm in Dalian; Endofree Plasmid Giga Kit is available from Qiagen company; Lipofectamine LTX and Plus Reagen is available from Invitrogen company; Mouse-anti tubercule bacillus Hsp70 monoclonal antibody is available from Lifespan Biosciences company; Mouse-anti people CD80 monoclonal antibody is available from abcam company; Western blot reagent is available from the green skies, Shanghai biotech firm; Total RNA extraction reagent box (centrifugal column type) is biochemical available from sky, Beijing root; TaKaRa RNA PCR Kit (AMV) Ver.3.0 is precious biological available from Dalian; Sso Fast Eva Green Supermix is available from Bio-Rad company; Nucleic acid-protein imager: BIO-ROD; Real-Time pcr amplification instrument: iCycler iQ.

1.2 method

1.2.1 the Construction and identification of recombiant plasmid pVAXI-Hsp70/CD80

With Hind III and former plasmid pcDNA3.1-Hsp70/CD80 and the carrier PVAX1 that builds of XbaI double digestion, with the T4 ligase, genes of interest Hsp70/CD80 orientation is connected in Hind III and the good PVAX1 of XbaI double digestion, build plasmid PVAX1-Hsp70/CD80.Enzyme action is identified and is served sea living work biotech firm and checks order.

The sepharose electrophoresis figure of pVAXI-Hsp70/CD80 before and after restriction endonuclease Hind III and Xba I double digestion sees Fig. 1.Electrophoresis result meets expection, shows that it is successfully established.Serve the sea and give birth to this plasmid construction success of the rear confirmation of work biotech firm's order-checking, its nucleotide sequence is seen SEQ ID No.4.

The PVAX1-Hsp70/CD80 plasmid is transformed into DH5 α according to a conventional method.Go endotoxin level plasmid to extract in a large number test kit by specification method with QIAGEN company and extract plasmid DNA purification.

1.2.2pVAX1-Hsp70/CD80 external transient expression is collected the 293T cell of exponential phase, is inoculated in 6 porocyte culture plates.When making cell degree of converging reach 50%-80%, press Lipofectamine LTX and Plus Reagen transfection reagent description, carry out transfection.Respectively at 24 hours, 48 hours, 72 hours harvestings after transfection, add lysate to discharge protein, centrifuging and taking supernatant and 5x sample-loading buffer mixing also boil and make protein denaturation.SDS-page electrophoresis, transferring film.Add respectively Hsp70,4 ℃ of overnight incubation of CD80 primary antibodie, wash two anti-hatching one hour after film.Add chemical illuminating reagent to be placed in the imaging of nucleic acid-protein imager.

1.2.3PVAX1-Hsp70/CD80 cultivated 24 hours after external stably express transfection, by 1 * 10 ⁴/ hole is inoculated in 96 porocyte culture plates, and carries out limiting dilution.Cultivate and add 1000mg G418 screening after 24 hours.Screen after 10～14 days, a large amount of cell deaths are arranged, as seen have the clone of resistance to occur, keep amplification cultivation with 500mg G418.The stably transfected cell line called after 293T-HSP70/CD80 that obtains.Western blot detects Hsp70, CD80 protein expression, and method is the same, the results are shown in accompanying drawing 2

Embodiment two, PVAX1-Hsp70/CD80 distribution and the expression in Mice Body

1, zoopery inbred line BALB/c mouse is 20, raises in independent ventilation air exchanging cage (individually ventilated IVC) system.Animal is by being divided into 5 groups (3 every group) inject time: organized, organized in 15 days, organized in 30 days, organized and negative control group in 180 days in 7 days.Be respectively each time point mice quadriceps femoris injection chimeric and 7.5g/L bupivacaine suspension (4: 1) 125 μ l, contain plasmid 100 μ g.Matched group injection normal saline 125 μ l.Got in 7,15,30 and 180 days after injection eyeball blood and muscle, lymph node, bone marrow, spleen, liver, lung, kidney, thymic tissue frozen-80 ℃ standby.

Extract RNA 1.2.4.2RT-PCR detect Hsp70 and the expression of CD80 in Mice Body from muscle, lymph node, bone marrow, spleen, liver, lung, kidney, thymic tissue, by day root total RNA extraction reagent box (centrifugal column type) description operation.By the precious biological TaKaRa RNA PCR Kit description in Dalian, preparation cDNA template, the performing PCR of going forward side by side reaction.

Primer sequence is:

HSP70 forward primer (SEQ ID No.5): CGTCGTCTC GGTTCTGGAAGGTG,

HSP70 downstream primer (SEQ ID No.6): CATTGAAGTAGGCGGGCGTCGTG:

CD80 forward primer (SEQ ID No.7): ACACGGAGGCAGGGAACATCACC,

CD80 downstream primer (SEQ ID No.8): TGGGCGCAGAGCCAGGATCACA.

The PCR result is carried out the agarose gel electrophoresis analysis.

1, Real-time PCR detects IFN-γ and LI-4 expression total RNA of extraction from spleen in the mouse spleen tissue, and reverse transcription prepares cDNA.Carry out Real-time PCR reaction.

Primer sequence is:

IFN-γ forward primer (SEQ ID No.9): AACTCAAGTGGCATAGATGTGGAAG;

IFN-γ downstream primer (SEQ ID No.10): GACGCTTATGTTGTTGCTGATGG.

IL-4 forward primer (SEQ ID No.11): TTTTGAACGAGGTCACAGGAGAGG;

IL-4 downstream primer (SEQ ID No.12): CCTTGGAAGCCCTACAGACGAG.

β-actin forward primer (SEQ ID No.13): AGGGTGTGATGGTGGGAAT;

β-actin downstream primer (SEQ ID No.14): CTCGGTGAGCAGCACAGG.

After reaction is completed, analyze with Bio-Rad iQ5 software, calculate relative expression quantity according to the Pfaffl method.The results are shown in Figure 3.

The experiment grouping: laboratory animal is divided into 5 groups (3 every group) by inoculation time: 7 days groups, 15 days groups, 30 days groups and 180 days groups; The negative control mice is the normal saline group.

Bupivacaine (Bbupivacaine) is combined rear formation complex protection and can released dna with plasmid DNA; a kind of anesthetis simultaneously; can stimulate the myocyte to regenerate, thereby improve the ability that the muscular tissue cell sucks DNA and expression, thus in this experiment as adjuvant.Respectively at each time point (7 days, 15 days, 30 days, 180 days) for mice quadriceps femoris injection chimeric 100 μ l and 7.5g/L step than caine suspension 25 μ l, and (4: 1), totally 125 μ l, contain plasmid 100 μ g.Matched group water for injection 100 μ l.

The separation of RNA: after pVAX1-Hsp70/CD80 chimeric Mice Inoculated respectively at getting eyeball blood and muscle, lymph node, bone marrow, spleen, liver, lung, kidney, thymic tissue in 7,15,30,180 days, frozen-80 ℃.The extraction of total RNA is extracted test kit according to sky, Beijing root Bioisystech Co., Ltd total RNA from animal tissues and is carried out, and RT-PCR cell total rna reverse transcription oligo dT primer is undertaken by the Dalian precious RT-PCR of biotech firm test kit description.

The RT-PCR result: inoculating 7 days groups and inoculating 15 days group muscle, lymph node, bone marrow, spleen, liver, lung, kidney, thymic tissues all has Hsp70 and CD80 to express.Inoculating 30 days groups has Hsp70 to express at muscle, lung regulating liver-QI, has no CD80 and expresses.Group did not detect expression in Hsp70/CD80 days in 180 days.Result is referring to Fig. 3.

The Real-time-PCR(PCR in real time) result: get 7 days and 15 days and 30 days and 180 days group mouse spleen cDNA and detect IFN-γ (IFN-γ) and LI-4(interleukin-4 with Real-time-PCR). its result is that seven days and 15 days IFN-γ have high level expression, and result is referring to Fig. 4.

Embodiment three pvAXI-Hsp70/CD80 Chimeric DNA vaccines are to tuberculosis immanoprotection action and Mechanism Study

(1) test method.

1, experiment material:

Go to endotoxin level plasmid purification system (Qiagen company).IFN-γ, IL-4, (Miltenyi Biotec company).

The preparation of DNA plasmid: spend endotoxin level plasmid purification system and prepare pVAXI-Hsp70/CD80 and PcDNA _3.1-Hsp70/CD80 plasmid.

2, experiment grouping modeling and processing:

Animal grouping: according to the table of random number random packet, laboratory animal is the healthy mice C57BL/6N of 6-8 age in week, cleaning level, and body weight is about 18 ± 2g, and male and female half and half are available from Medical University Of Chongqing's Experimental Animal Center.Be divided into blank group (abbreviation matched group), BCG vaccine group (bacillus calmette-guerin vaccine group, be called for short the BCG group), tuberculosis experimental model group (being called for short the tuberculosis group), pcDNA3.1-Hsp70/CD80 chimeric DNA vehicle group (abbreviation vehicle group) and pVAX1-Hsp70/CD80 Chimeric DNA vaccine group (abbreviation vaccine group), every group 10-20.

Zooprophylazis immunity (being called for short immunity in table as a result): first immune postoperative infection, each experimental group is injected respectively the pVAX1-Hsp70/CD80 Chimeric DNA vaccine on request, each 100ug(0.5mL of pcDNA3.1-Hsp70/CD80 chimeric DNA carrier), the BCG group is by the body weight injection of BCG; Blank group and tuberculosis experimental model group injecting normal saline 0.5mL.The injection site is the both sides tibialis anterior, every side dosage half and half, and the inoculation operation is with reference to embodiment two.Respectively press former scheme booster shot once after 2 weeks of inoculation and 4 weeks.Every mouse tail vein injection 10 of the group of each except the blank group in the time of rear the 14th day of immunity for the third time ⁴-10 ⁵CFU tubercule bacillus H37RV(tubercule bacillus H37RV reference culture derives from Sichuan Province tuberculosis prevention and treatment institute).

Animal immune treatment (being called for short treatment in table as a result): grouping and operation are substantially with above-mentioned epidemic prevention test, but carry out " first premunition ", namely the group of each except the blank group is carried out tubercule bacillus and is attacked front, after being seeded in of corresponding DNA vaccination or bacillus calmette-guerin vaccine (blank group only injecting normal saline).Each winding kind time be after H37RV attacks the 7th day, the 14th day and the 28th day each once.

The vitro detection of IL-4, γ-INF: after two weeks, each group of animal immune therapeutic test was put to death animal to each group of epidemic prevention test after after vaccination for the second time 14 days at the H37RV tail vein injection.Get serum and carry out IL-4, γ-INF detection, detection method is by the mice ELISA of brilliant U.S. company detection kit description.

Pathological Changes: observe Mouse Liver, spleen tissue smear, section pathological change and and cultivation tubercule bacillus numeration.

Statistical procedures method: adopt SPSS for windowsl0.0 statistical package to carry out date processing

3, result:

3.1, the vitro detection of γ-IFN, IL-4 the results are shown in Table 1:

The testing result of table 1 γ-IFN, IL-4 (ⅹ ± SD)

Table 1 result shows: γ-IFN and IL-4 level in mice BALF are respectively organized in each group of epidemic prevention test and immunization therapy test.Compare with tuberculosis model group mice, in pcDNA3.1-Hsp70/CD80 chimeric DNA vehicle group (abbreviation vehicle group) and pVAX1-Hsp70/CD80 Chimeric DNA vaccine group (abbreviation vaccine group) mice BALF, γ-IFN level all obviously increases, and difference is extremely remarkable; And vehicle group and vaccine group have notable difference.Compare with tuberculosis model group mice, it is extremely remarkable that vehicle group and vaccine group IL-4 obviously increase difference; And notable difference is arranged between vehicle group and vaccine group, vaccine group is apparently higher than vehicle group.In pcDNA3.1-Hsp70/CD80 chimeric DNA vehicle group (abbreviation vehicle group) and pVAX1-Hsp70/CD80 Chimeric DNA vaccine group (abbreviation vaccine group) BALF, all apparently higher than the BCG group, difference is extremely remarkable for γ-IFN level and IL-4 level.

3.2, the dyeing of liver, spleen tissue smear (Z-N)

Put to death animal, get liver, spleen tissue smear (Z-N, luxuriant-Nissl) dyeing, the results are shown in Table 2.

Table 2 liver, spleen tissue smear (Z-N) coloration result

In table 2 :+: be 50 below bacterium colony, ++: be 500 below bacterium colony, +++: be 1000 below bacterium colony, ++ ++: be 5000 more than bacterium colony.

3.3, liver, tuberculosis of spleen bacterium cultivate colony count

Put to death and cultivate after animal is got liver, the grinding of spleen tissue, and the tissue that takes a morsel carries out smear; The results are shown in Table 3.

Table 3 liver, tuberculosis of spleen bacterium are cultivated colony count

Annotate ,+: be 50 below bacterium colony, ++: be 500 below bacterium colony, +++: be 1000 below bacterium colony, ++ ++: be 5000 more than bacterium colony.

Table 2, table 3 result show: prevention group and treatment group mice BALF; With tuberculosis model group mice relatively, in vaccine group and control group mice BALF liver, spleen tissue smear (Z-N) coloration result, clump count is negative, vaccine group and control group mice BALF liver, that spleen knot of tissue pyrenomycetes is cultivated bacterium colony is negative.Illustrate that pVAX1-Hsp70/CD80 chimeric of the present invention all obviously is better than existing pcDNA3.1-Hsp70/CD80 plasmid in the effect aspect prevention lungy and immunization therapy two, and more guaranteed aspect safety, have better application prospect.

Claims (11)

1. mosaic type DNA vaccine in use is characterized in that: for containing the pVAXI plasmid of following protein (a) or encoding gene (b):

(a) protein that forms of the described aminoacid sequence of SEQ ID No.2;

(b) process replaces, lacks and/or add one or several aminoacid and have the protein that has same or similar function with (a) described protein in the aminoacid sequence that SEQ ID No.2 limits.

2. mosaic type DNA vaccine in use according to claim 1, it is characterized in that: it is described that the nucleotides sequence of described protein coding gene is classified SEQ ID No.1 as.

3. mosaic type DNA vaccine in use according to claim 1 and 2, it is characterized in that: described protein coding gene is controlled its expression by the CMV promoter on the pVAXI plasmid.

4. mosaic type DNA vaccine in use according to claim 4, it is characterized in that: the nucleotides sequence of described pVAXI plasmid is classified as shown in SEQ ID No.3.

5. mosaic type DNA vaccine in use according to claim 5, it is characterized in that: its nucleotides sequence is classified as shown in SEQ ID No.4.

6. the purposes of mosaic type DNA vaccine in use in preparation prevention or immunization therapy tuberculosis, it is characterized in that: described mosaic type DNA vaccine in use is for containing the pVAXI plasmid of following protein (a) or encoding gene (b):

(a) protein that forms of the described aminoacid sequence of SEQ ID No.2;

(b) process replaces, lacks and/or add one or several aminoacid and have the protein that has same or similar function with (a) described protein in the aminoacid sequence that SEQ ID No.2 limits.

7. purposes according to claim 6, it is characterized in that: it is described that the nucleotides sequence of the encoding gene of described protein is classified SEQID No.1 as.

8. according to claim 6 or 7 described purposes, it is characterized in that: the encoding gene of described protein is controlled its expression by the CMV promoter on the pVAXI plasmid.

9. purposes according to claim 6, it is characterized in that: the nucleotides sequence of described pVAXI plasmid is classified as shown in SEQ IDNo.3.

10. purposes according to claim 6, it is characterized in that: the nucleotides sequence of described mosaic type DNA vaccine in use is classified as shown in SEQ IDNo.4.

11. be prevention or the immunization therapy tuberculosis that main active is prepared into by the described mosaic type DNA vaccine in use of claim 1～5 any one.

Images