CN102038951B - Nucleic acid vaccine adjuvant designed based on MCP-1 and construction method thereof - Google Patents
Nucleic acid vaccine adjuvant designed based on MCP-1 and construction method thereof Download PDFInfo
- Publication number
- CN102038951B CN102038951B CN 201010295542 CN201010295542A CN102038951B CN 102038951 B CN102038951 B CN 102038951B CN 201010295542 CN201010295542 CN 201010295542 CN 201010295542 A CN201010295542 A CN 201010295542A CN 102038951 B CN102038951 B CN 102038951B
- Authority
- CN
- China
- Prior art keywords
- mcp
- plasmid
- nucleic acid
- acid vaccine
- spliceosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to the technical field of medical biology and discloses a plasmid for enhancing cellular immune effect of a nucleic acid vaccine, which is designed based on monocyte chemoattractant protein-1 (MCP-1). An expressed sequence of a novel MCP-1 spliceosome molecule is inserted into a pcDNA-3.1 plasmid to form a pcDNA-3.1-MCP-1 plasmid, the plasmid can efficiently express the novel MCP-1 spliceosome molecule, and the expression ability of the co-transfected nucleic acid vaccine is not influenced. In an in vivo test, the plasmid and the nucleic acid vaccine are injected simultaneously to have the capacity of effectively inducing cellular immune response, namely antigenic specificity spleen interferon (IFN)-gamma positive cells are increased and target-killing capacity of spleen CD8 positive cells is improved. Therefore, the plasmid can be added into the conventional nucleic acid vaccine preparation for mixed injection so as to obviously accelerate the nucleic acid vaccine-induced cellular immune response, and the plasmid serves as a novel cellular immune adjuvant.
Description
Technical field
The present invention relates to the medicine bioengineering field that learns a skill, relate in particular to the immunocompetence enhancement techniques field of nucleic acid vaccine.
Background technology
Nucleic acid vaccine refers to contain the plasmid vector of certain antigenic protein gene sequence as vaccine; directly import in zooblast; by host's re-recording system synthetic antigen albumen, induce the host to produce immunne response to this antigen protein, thereby make the host obtain corresponding immunoprotection.Because nucleic acid vaccine can be induced the comprehensive immunne response of body generation; and the pathogen to different subtype has the effect of resisting that intersects; have again simultaneously the series of advantages such as immune protective effect is lasting, safe, convenient for production, therefore be considered to the third generation of vaccine after attenuation, inactivated vaccine and genetic engineering subunit vaccine.The advantage of nucleic acid vaccine mainly contains: 1, not only can induce the protection antibody for conservative antigen to produce; and the simultaneously CTL immunity of excitating organism, the prevention of the disease of the dependent cells immune clearance cause of disease such as object disease of viral infection is also just more effective like this.And after gene vaccine inoculation, antigen is consistent with the expression of virus antigen in the natural viral infection process in intracellular expression, can make antigen with the processed rear submission of the form of nature to immune recognition system.This is necessary for the generation that the conformation type epitope brings out neutrality antibody; 2, preparation is easy, the preparation of time saving and energy saving gene vaccine only needs the gene of coding for antigens is designed and clones, do not need at vivoexpression and protein purification, and exogenous gene is easier to the clone and advances expression vector, can increase in a couple of days and purification it, but particularly to those new vaccines of fast Development when epidemic diseases is broken out.3, immunne response is more lasting, and bibliographical information 15 months available PCR after intramuscular injection detect the existence of exogenous plasmid dna.Experimental results show that in injection and a considerable amount of expression of exogenous gene still can be detected in rear 19 months.Exogenous gene and expression sustainable existence thereof, make the memory of immunological memory cell special in body be reinforced, thereby the protective immunity that body is obtained exists more lastingly like this.4, different strain cross protection of the same race this be one of great advantage of gene vaccine.In preparation during gene vaccine, can be by the entrained target gene of expression vector be transformed, thus select antigenic determinant.Select the nucleotide sequence of coding conservative protein of a certain pathogen as gene vaccine, because it can not make a variation, thus can be to drift or the novel generation cross immunity of same cause of disease, thus play immanoprotection action.5, can be used for that treatment and prevention of tumour CTL replys is also effective removing approach that body kills cancerous tumor cell.If can find the key protein in the malignant transformation of cells process, just can prepare the CTL vaccine of tumor.After the inoculation of this gene vaccine, can bring out body and produce the CTL immunne response, cancerating of cell carried out immune surveillance, the cell of canceration is produced immunne response, thereby provide strong modern weapon for prevention and the immunization therapy of cancer.
Yet DNA vaccination also exists obvious deficiency, and a little less than namely DNA vaccination stimulated the ability of body generation immunne response often to inoculate than conventional vaccine the immunoreation that causes, this just gave the new challenge of having researched and proposed of DNA vaccination.Therefore, new vaccine adjuvant has become the study hotspot that receives much attention now.Immunological adjuvant refers to use simultaneously or in advance with antigen, can promote, extends or strengthen the material to the vaccine antigen specific immune response.At present most popular in the preparation of animal vaccine is oily adjuvant and Alum adjuvant etc., and as the adjuvant of DNA vaccination mainly contain cytokine, costimulatory molecules, CpG DNA and liposome (referring to document, Jalilian B.et al.Development of avian influenza virus H5DNA vaccine and MDP-1gene of Mycobacterium bovis as genetic adjuvant.Genet Vaccines Ther.2010May24; 8:4.).
MCP-1 (monocyte chemoattractant protein-1, monocyte chemoattractant protein-1) belong to Chemokines CC C subfamily, comprise MCP1～3, can by the secretions such as Monocytes/Macrophages, fibroblast, B cell, endotheliocyte and smooth muscle cell of inflammatory mediator stimulation, to Monocytes/Macrophages, chemotactic and activation be arranged.MCP-1 also can mediate basophilic granulocyte chemotactic and activation.research is found, by injection MCP-1, the antigen specific immune reaction is significantly strengthened, and significantly increase quantity and the frequency of DC, MCP-1 can have synergism with cytokine profiles, it is a kind of good DC amplification agent, reach external the experiment and all obtained good effect (referring to document in toy and people's body, Seubert A, Monaci E, Pizza M, O ' Hagan DT, Wack A.The adjuvants aluminum hydroxide andMF59induce monocyte and granulocyte chemoattractants and enhance monocyte differentiation toward dendritic cells.J Immunol.2008Apr 15, 180 (8): 5402-12.).And inducing of antigen-specific immune response depends on that to a great extent body is to the processing of this antigen molecule and the efficient of offering.Important function based on DC in genetic immunization if the APC that recruitment comprises DC to position, target antigen place, increases the picked-up of antigen and offers, may be beneficial to the effect of enhancing gene immunity.
But, in existing nucleic acid vaccine adjuvant, do not have research report and Patents based on the nucleic acid vaccine adjuvant of MCP-1 design.
Summary of the invention
The object of the present invention is to provide a kind of nucleic acid vaccine adjuvant and construction method thereof based on the MCP-1 design with cellular immunization enhanced activity.
The present invention significantly strengthens in view of MCP-1 can make the antigen specific immune reaction, and significantly increases quantity and the frequency of DC, and imagination can be with MCP-1 as a kind of nucleic acid vaccine adjuvant molecule.
The inventor has obtained one section sequence that lacks the part base in clone MCP-1 gene process, this sequence has the effect of raising and activate DC equally, has no at present the relevant report of this sequence.
The invention provides a kind of nucleic acid vaccine adjuvant with cellular immunization enhanced activity, it is characterized in that this nucleic acid vaccine adjuvant is the plasmid that contains the DNA sequence of MCP-1 spliceosome, the DNA sequence of MCP-1 spliceosome wherein is as shown in SEQ ID NO:4.
Above-mentioned plasmid is pcDNA.3.1 (+), and the present invention also can substitute with other eukaryon expression plasmids such as pVAX1 or pEZX.Plasmid also can substitute with adenovirus, slow virus etc.
The present invention also provides the construction method of above-mentioned nucleic acid vaccine adjuvant, comprise the following steps: A) design PCR primer is as shown in SEQ ID NO:2 or 3, adopt the genomic DNA of Mus peripheral blood lymphocytes extracting to carry out PCR, obtain the DNA sequence of MCP-1 spliceosome as shown in SEQ IDNO:4;
B) DNA sequence with above-mentioned MCP-1 spliceosome is cloned into plasmid.
Particular content of the present invention is as follows:
1, at first according to the internet database information searching MCP-1 molecular sequences of mice (Gene ID:20296), for its flanking gene group coding sequential design PCR primer (upstream and downstream is added respectively Xbal I and EcoR I restriction enzyme site), adopt the genomic DNA of Mus peripheral blood lymphocytes extracting to carry out PCR, the clone is as follows with the PCR primer:
Forward primer: 3 ' cgggatcc atgctgactcctgtcatgcttc 5 ' (as shown in SEQ ID NO:2)
Downstream primer: 5 ' gctctagag ctagttcactgtgtgactggtc 3 ' (as shown in SEQ ID NO:3)
Thereby obtained comprise MCP-1 molecule encoding sequence DNA fragmentation (as shown in SEQ ID NO:4,465bp).
2, be connected into above-mentioned clone's the DNA fragmentation that comprises the MCP-1 coded sequence (as shown in Figure 1) in the polyclone zone available from the commercialization plasmid pcDNA.3.1 (+) of American I nvitrogene company, adopt Xbal I and EcoR I restriction enzyme site.The polyclone enzyme action site of this insertion sequence flank still keeps, and can be used for inserting antigen sequence does not affect its effective expression.Described MCP-1 expression vector: the pcDNA.3.1-MCP-1 that is.
The plasmid pcDNA.3.1-MCP-1 of a kind of MCP-1 sequence of encoding provided by the invention, this plasmid is high efficient expression MCP-1 in vivo and in vitro.Through being total to the injecting immune mice with HBsAg DNA Vaccine, we find to improve especially to nucleic acid vaccine immunity effect by this plasmid, and the enhancing of cell immune response plays an important role, therefore, described plasmid and nucleic acid vaccine are injected altogether and be can be used as a kind of new nucleic acid vaccine immunity effect Enhancement Method.This plasmid has following attribute through checking:
(1) this plasmid can efficiently increase intracellular MCP-1 developed by molecule level.
(2) this plasmid can be total to immunity and not affect latter's antigen expressed with various nucleic acid vaccines.
(3) this plasmid and HBsAg DNA Vaccine are injected mice altogether, can induce very strong antigenic specificity cell immune response, more traditional nucleic acid vaccine is significantly increased, but the impact of antagonist titre is not remarkable.
(4) in the experiment of heavy dose of this carrier of immunity repeatedly, any abnormal allergy or autoimmune phenomena do not appear in laboratory animal.
Description of drawings
Fig. 1 is pcDNA3.1-MCP-1 Plasmid pattern figure
With the polyclone zone of MCP-1 by Xbal I and EcoR I site insertion pcDNA3.1 (+) carrier, obtain to express the carrier of MCP-1.Figure Green zone is MCP-1 expressed sequence insertion point, and the multiple clone site beyond green area still keeps, and can be used for the antigen encoding sequence and inserts.This plasmid contains ammonia benzyl mycin resistant gene.
Fig. 2 is that the present invention adopts ELISA to detect antibody titer figure
Fig. 3 is that the present invention detects IFN-γ secretion figure as a result
The specific embodiment
The present invention is described in detail below in conjunction with drawings and Examples, but embodiments of the invention only are used for explanation the present invention and are not used in restriction protection scope of the present invention.
The structure of embodiment 1:pcDNA.3.1-MCP-1 plasmid
At first searched the MCP-1 molecular sequences (Gene ID:20296) of mice according to internet data library information (http://www.ncbi.nlm.nih.gov/gene/20296), for its flanking gene group coding sequential design PCR primer (upstream and downstream is added respectively Xbal I and EcoR I restriction enzyme site), adopt the genomic DNA of Mus peripheral blood lymphocytes extracting to carry out PCR, MCP-1 molecular sequences and clone PCR primer such as following table.Thereby obtained the DNA fragmentation that comprises MCP-1 molecule encoding sequence.
We are connected into above-mentioned clone's the DNA fragmentation that comprises the MCP-1 coded sequence (Fig. 1) in the polyclone zone available from the commercialization plasmid pcDNA.3.1 (+) of American I nvitrogene company, adopt Xbal I and EcoR I restriction enzyme site.The polyclone enzyme action site of this insertion sequence flank still keeps, and can be used for inserting antigen sequence does not affect its effective expression.Described MCP-1 expression vector: the pcDNA.3.1-MCP-1 that is.
The outer ability to express test experience of embodiment 2:pcDNA3.1-MCP-1 plasmid and pVAX1-HBsAg nucleic acid vaccine cotransfection situation lower body
Utilize mice as experimental animal model, again to mice shank injection pcDNA3.1-MCP-1 plasmid, the DC that adopts SABC to analyze injection site after 24 hours raises situation, finds to contrast with matched group after the immunity of pcDNA3.1-MCP-1 plasmid, and immune group has significant DC to raise and activate.
Embodiment 3: with immune efficacy test experience in the body after pcDNA3.1-MCP-1 plasmid and the common immunity of pVAX1-HBsAg nucleic acid vaccine
With pcDNA3.1-MCP-1 with 0.1mg/ only with pVAX1-HBsAg with 0.1mg/ dosage immunity 6-8 C57BL/6J mice in age in week, immunity is 3 times altogether, 2 weeks of interval, mix incomplete Freund's adjuvant booster immunization once with HBsAg recombiant protein (10 μ g/ only) the 6th weekend, the humoral immunization aspect adopts ELISA to detect its antibody titer and IgG hypotype (seeing Fig. 2); The cellular immunization aspect adopts the ELISPOT method to detect the IFN-γ secretion situation of spleen t-cell, adopts external evoked spleen CTL to kill target experiment detectable antigens specific C D8
+The T cell quantity.HBsAg nucleic acid vaccine pVAX1-HBsAg is as parallel control, and normal saline is as blank, and HBsAg subunit protein vaccine is as positive control.Found that, pcDNA3.1-MCP-1 with 0.1mg/ only with pVAX1-HBsAg with 0.1mg/ co-immunization after effective inducing antigen-specific ctl response, IFN-γ secretion positive cell significantly increases, the target cell killing-efficiency significantly improves, and prompting antigenic specificity cellular immunization obtains obviously to strengthen (seeing Fig. 3).
Immune efficacy test experience result in table 1, body
Claims (4)
1. the nucleic acid vaccine adjuvant with cellular immunization enhanced activity, is characterized in that this nucleic acid vaccine adjuvant is the plasmid that contains the DNA sequence of MCP-1 spliceosome, and the DNA sequence of MCP-1 spliceosome wherein is as shown in SEQ ID NO:4.
2. the nucleic acid vaccine adjuvant with cellular immunization enhanced activity according to claim 1, is characterized in that plasmid wherein is pcDNA.3.1 (+).
3. construction method with nucleic acid vaccine adjuvant of cellular immunization enhanced activity as claimed in claim 1 or 2 is characterized in that the method comprises the following steps:
A) design PCR primer as shown in SEQ ID NO:2 or 3, adopts the genomic DNA of Mus peripheral blood lymphocytes extracting to carry out PCR, obtains the DNA sequence of MCP-1 spliceosome as shown in SEQ IDNO:4;
B) DNA sequence with above-mentioned MCP-1 spliceosome is cloned into plasmid.
4. the construction method with nucleic acid vaccine adjuvant of cellular immunization enhanced activity according to claim 3, is characterized in that plasmid wherein is pcDNA.3.1 (+).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010295542 CN102038951B (en) | 2010-09-28 | 2010-09-28 | Nucleic acid vaccine adjuvant designed based on MCP-1 and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010295542 CN102038951B (en) | 2010-09-28 | 2010-09-28 | Nucleic acid vaccine adjuvant designed based on MCP-1 and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102038951A CN102038951A (en) | 2011-05-04 |
| CN102038951B true CN102038951B (en) | 2013-06-05 |
Family
ID=43905709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010295542 Expired - Fee Related CN102038951B (en) | 2010-09-28 | 2010-09-28 | Nucleic acid vaccine adjuvant designed based on MCP-1 and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102038951B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103333095B (en) * | 2013-06-26 | 2015-06-24 | 中国人民解放军第二军医大学 | Adipamide D-hydroxyproline derivative and application thereof as nucleic acid vaccine adjuvant |
| WO2024108386A1 (en) * | 2022-11-22 | 2024-05-30 | 中国科学院深圳先进技术研究院 | Use of anti-mcp1 neutralizing antibody in preparing medicament for treating systemic inflammation caused by neurodegenerative diseases |
-
2010
- 2010-09-28 CN CN 201010295542 patent/CN102038951B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 任?h欣等.pcDNA3.1(+)-MCP-1和pcDNA3.1(+)-Gro α真核表达质粒的构建及鉴定.《世界华人消化杂志》.2004,(第11期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102038951A (en) | 2011-05-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Seder et al. | DNA vaccines—designer vaccines for the 21st century | |
| Mendez et al. | Coinjection with CpG-containing immunostimulatory oligodeoxynucleotides reduces the pathogenicity of a live vaccine against cutaneous Leishmaniasis but maintains its potency and durability | |
| Shah et al. | Construction of DNA vaccines encoding Eimeria acervulina cSZ-2 with chicken IL-2 and IFN-γ and their efficacy against poultry coccidiosis | |
| Zhang et al. | Evaluation of the immune response induced by multiantigenic DNA vaccine encoding SAG1 and ROP2 of Toxoplasma gondii and the adjuvant properties of murine interleukin-12 plasmid in BALB/c mice | |
| JP2007523863A5 (en) | ||
| CN102083457B (en) | Smallpox DNA vaccination and its antigen for causing immune response | |
| Chen et al. | Immuno-efficacy of DNA vaccines encoding PLP1 and ROP18 against experimental Toxoplasma gondii infection in mice | |
| CN113633764A (en) | Novel corona DNA vaccine containing adjuvant | |
| CN105497886A (en) | Application of HBcAg (hepatitis B core antigen) virus-like particle serving as cancer therapeutic vaccine carrier | |
| CN102038951B (en) | Nucleic acid vaccine adjuvant designed based on MCP-1 and construction method thereof | |
| CN106983860A (en) | Sore mouth virus vaccine and its preparation method and application | |
| CN1814757B (en) | Novel CpGDNA adjuvant, its preparing method and vaccine containing same | |
| Pretorius et al. | A heterologous prime/boost immunisation strategy protects against virulent E. ruminantium Welgevonden needle challenge but not against tick challenge | |
| CN102000330B (en) | Nucleic acid vaccine adjuvant and construction method thereof | |
| Kumar et al. | DNA vaccine: a modern biotechnological approach towards human welfare and clinical trials | |
| CN101972476B (en) | DNA vaccine adjuvant using Micro RNA-155 and construction method thereof | |
| CN101954080B (en) | Compound-molecule adjuvant for swine foot-and-mouth vaccine and preparation method thereof | |
| Yamamoto et al. | Oligodeoxyribonucleotides with 5′-ACGT-3′ or 5′-TCGA-3′ sequence induce production of interferons | |
| CN1772298A (en) | The pIL-6 gene adjuvant for pig vaccine and its prepn process | |
| CN1324661A (en) | Human hepatitis B nucleic acid vaccine | |
| CN1452495A (en) | Vaccine against microbial pathogens | |
| CN101422604A (en) | Immunoloregulation type DNA vaccine capable of preventing Eimeria acervulina | |
| CN1772297A (en) | The pIFN-gamma gene adjuvant for pig vaccine and its prepn process | |
| KR101863335B1 (en) | DNA vaccine for prevention and treatment of fish viral hemorrhagic septicemia | |
| US20190307870A1 (en) | Synthetic malaria immunogens, combinations thereof, and their use to prevent and treat malaria infections |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130605 Termination date: 20150928 |
|
| EXPY | Termination of patent right or utility model |