CN103146713A - Proline-rich protein gene as well as expression vector and application thereof - Google Patents

Abstract

The invention belongs to the field of genetic engineering and discloses a proline-rich protein gene as well as an expression vector and application thereof. A cDNA (complementary Deoxyribonucleic Acid) sequence of Ta-PRP3 is SEQ ID NO.1, and an encoded amino acid sequence is SEQ ID No.2; the gene is from a common weat gibberellic disease resistant variety wnghuibai (Triticum Aestivumcv.Wanghuibai); the expression is enhanced in the wanghuibai due to the induction of gibberella; the gene transforms an infected wheat variety Yangmai 158 through particle bombardment; the result shows that the excessive expression of the Ta-PRP3 can be used for enhancing the resistance of the Yangmai 158 to the gibberellic disease, therefore the Ta-PRP3 is expected to be applied to the genetic engineering breeding; and the fusarium head blight resistance of the wheat is expected to be enhanced by introducing the Ta-PRP3 into the wheat varieties which are easily infected by the fusarium head blight.

Description

Proline rich protein gene and expression vector and application

Technical field

The invention belongs to the genetically engineered field, disclose in wheat a proline rich protein gene and expression vector and application.

Background technology

Wheat scab (Fusarium head blight, FHB) is a kind of to be caused by sickle-like bacteria (Fusarium graminearum), the fungal disease of the little Cereal such as serious harm wheat, barley and seeding corn and other crops.On the one hand, it can make makes the deposits yields disease, directly causes crop failure and quality to descend; On the other hand, the grain of results is owing to being polluted by deoxynivalenol (deoxynivalenol, DON) and some other trichothecene toxoid, and humans and animals is eaten by mistake to produce and poisoned.In recent years, along with global climate warms, the change of the adjustment of pattern of farming, cropping system and mode, this disease is each wheat planting district rapid spread in the whole world, the genesis of the controlling wheat scab difficult problem that become international.

Improvement wheat breed resistance, cultivation and popularization disease-resistant variety be control that wheat scab is most economical, safety and effective approach.Clear and definite its disease-resistant mechanism, clone's disease-resistant related gene are for preventing and treating wheat scab, carrying out breeding for disease resistance and have the most important theories directive significance.Gibberellic hypha has the characteristic of saprophytic double parasitism, can live on plant residue, also can live on the hosts' such as wheat class live body; Wheat has non-microspecies specialized feature to scab resistance, be the quantitative inheritance proterties of controlled by multiple genes, thereby the interaction between head blight pathogenic bacteria and wheat host is very complicated.

The research of wheat Resistance mechnism is the focus of present wheat scab research.Expression conditions in analysis of pathogenic bacteria-host's Interaction helps to excavate disease-resistant gene and finds crucial disease-resistant path, and disease-resistant mechanism is significant for illustrating.At present, researcher utilizes various approaches and methods, be subjected to cDNA library, the SSH library of gibberellic hypha abduction delivering as structure, utilize two-dimensional electrophoresis connexus spectral technology, chip technology, express spectra sequencing analysis etc. screen gene or albumen that some may be relevant to scab resistance, as pathogenesis-related proteins, Cytochrome P450, glucanotransferase, abc transport albumen etc., also found the signal path relevant to scab resistance, as jasmonic approach, ethene approach etc.

The local variety Wangshuibai is the best wheat breed of anti gibberellic disease of generally acknowledging at present, and resistance is the most stable, and seed DON content is also very low.This laboratory utilizes Affymetrix wheat cdna group chip of expression spectrum to induce front and back fringe tissue gene expression characteristic to analyze high anti gibberellic disease wheat breed Wangshuibai and sense head blight mutant thereof through gibberella, the clone obtains a coding proline rich protein gene in Wangshuibai, and with in the sick wheat breed Yangmai No.158 of this gene transformation sense head blight, can improve scab resistance.

Summary of the invention

The purpose of this invention is to provide a coding proline rich protein gene Ta-PRP3.

Another object of the present invention is to provide the expression vector of this gene.

Another purpose of the present invention is to provide the application of this gene and expression vector.

Purpose of the present invention can be achieved through the following technical solutions:

Proline rich protein gene Ta-PRP3, from common wheat (Triticum asetivum L.) local variety Wangshuibai, its nucleotides sequence is classified SEQ ID NO.1 as.

The protein Ta-PRP3 of this proline rich protein gene coding, its aminoacid sequence are SEQ ID NO.2.

The expression vector that contains described proline rich protein gene Ta-PRP3.

The described expression vector that contains proline rich protein gene Ta-PRP3 claimed in claim 1 preferably with pBI220 for the carrier that sets out, Ta-PRP3 gene claimed in claim 1 is inserted gained between the BamH I of pBI220 and Kpn I restriction enzyme site.

The application of described proline rich protein gene Ta-PRP3 in building the wheat-resistance to scab kind.

The described application of expression vector in building the wheat-resistance to scab kind that contains proline rich protein gene Ta-PRP3.

Beneficial effect:

The present invention clones from wheat and obtains a proline rich protein gene Ta-PRP3 and coded protein Ta-PRP3 thereof.Be inserted into expression vector pBI220, the Overexpression vector of this gene that obtains imports in susceptible wheat breed, can improve the resistance of sense head blight Scab In Wheat Varieties.Ta-PRP3 is used for genetic engineering breeding, and it is imported in susceptible head blight wheat breed, can improve the scab resistance of wheat.

Description of drawings

Fig. 1 utilizes China spring third part homology group nulli-tetrasomes material to carry out chromosomal localization to the Ta-PRP3 gene, and Ta-PRP3 is navigated to 3D karyomit(e).

1, the water contrast; 2, China spring (Chinese Spring); 3, N3A/T3B; 4, N3A/T3D; 5, N3B/T3A; 6, N3B/T3D; 7, N3D/T3A; 8, N3D/T3B; 9, Wangshuibai

QRT-PCR expression analysis in the fringe tissue of Fig. 2 Ta-PRP3 after Wangshuibai, NAUH117 are subjected to gibberella to induce 0h, 6h, 12h, 24h, 36h, 48h, 72h.

Fig. 3 Ta-PRP3 overexpression Vector construction

A: build the plant expression vector pBI220-Ta-PRP3 that contains goal gene Ta-PRP3; B: cotransformation vector plasmid pAHC25 Fig. 4 Ta-PRP3 transforms the T of Yangmai No.158 ₀PCR Molecular Identification for positive plant

1, DNA ladder; 2, the water contrast; 3, the contrast of transgene receptor Yangmai No.158; 4, comprise the pBI220-Ta-PRP3 vehicle Control of goal gene; 5-12, positive transformed plant

Fig. 5 Common Wheat Varieties China spring and third part homology group's thereof nulli-tetrasomes series.

A, China spring; B, China spring 3A nullisomic/3B limbs; C, China spring 3A nullisomic/3D limbs; D, China spring 3B nullisomic/3A limbs; E, China spring 3B nullisomic/3D limbs; F, China spring 3D nullisomic/3A limbs; G, China spring 3D nullisomic/3B limbs table 1Ta-PRP3 transforms the T of Yangmai No.158 ₁Scab resistance qualification result for positive strain

T ₁-2, T ₁-5, T ₁-9, T ₁-12, T ₁-14, T ₁-15, T ₁-18 and T ₁-115 positive transformation plants for evaluation, Yangmai No.158 are the contrast of transgene receptor wheat, and Wangshuibai is the contrast of resistance wheat.

Embodiment

Embodiment 1 Wangshuibai is subjected to the clone of a proline rich protein gene in fringe tissue that gibberella induces

Local Wheat Variety Wang-shui-bai is that the anti gibberellic disease of generally acknowledging at present is best, resistance is the most stable, DON content is a very low kind (QiZeng Jun also, Pei Ziyou etc. utilize the difference of DON test-HPLC detection wheat Fusarium toxin DON content, 2005,28(3): 6-10).this laboratory is in early-stage Study, utilize fast neutron radiation Wangshuibai dry seeds, screening obtains sense head blight mutant NAUH117(Jin Xiao, Xinping Jia et al.A Fast-neutron Induced Fragment Deletion of3BS in wheat variety Wangshuibai Increased Its Susceptibility to Fusarium Head Blight, Chromosome Research, 2011-2-18, 19:225-234), chromosome deletion occurs in the subregion of 3BS in this mutant, and deletion fragment is just in time Wangshuibai anti gibberellic disease main effect QTL region.In order to obtain gene relevant to gibberellic disease resistant in Wangshuibai, the present invention utilizes the difference expression gene before and after Affymetrix wheat cdna group chip of expression spectrum screening Wangshuibai and the inoculation of NAUH117 gibberella, therefrom selects important gene to carry out functional verification.

At heading stage, small ear is adopted single flower inoculation method inoculation gibberella, the gibberella strain is to separate and cultivation obtains that (gibberella gathers and cultural method is seen: Liu Chuanqin from the field natural occurrence plant, Guan Shuqing, Huang Wei. gibberella saubinetii separation and Culture and inoculation, agricultural modernization, 1998:9), inoculate as negative control totally 4 processing with the water that does not contain gibberella.After inoculation, 24h gets the fringe sample, use TRIZOL(invitrogen) extract respectively total RNA by the reagent specification sheets, carry out gene chip hybridization (Affymetrix wheat cdna chip of expression spectrum, part number900515), this experiment is completed in " Shanghai biochip engineering center of country ".Differential gene expression screening standard: parameter c hange is I or MI, log ratio 〉=1, and experimental group Detection is that the probe of P is up-regulated gene; Parameter c hange is D or MD, log ratio≤-1, and control group Detection is that the probe of P is down-regulated gene.One of them gene is speculated as proline rich protein gene (proline-rich protein APG, probe number be Ta.15373.3.S1_x_at), lowers in NAUH117 and expresses multiplying power apparently higher than Wangshuibai, selects and carries out gene clone and functional study.By Rapid amplification of cDNA ends (RACE), be subjected to gibberella to obtain the total length of this gene in inducing the fringe tissue at Wangshuibai.This gene cDNA total length 810bp, sequence is as shown in SEQ ID NO.1, sequential analysis shows that this sequence comprises a total length ORF, ORF468bp, 155 amino acid of encoding, this full length gene amplimer is PRP-1L(CTCACTCACTAGGGAAGCAT, SEQ IDNO.3) and PRP-1R(CCTCACACAAGGAATCAACT, SEQ ID NO.4).Utilize SigalP (http://www.cbs.dtu.dk/services/SignalP/) to carry out possible signal peptide analysis to this gene, find that this gene has 24 amino acid whose signal peptide sequences at the N end.This coded by said gene amino acid sequence analysis is found that this gene has NET, two glycosylation sites of NSS, and having simple polypeptide repeats, the tumor-necrosis factor glycoproteins that namely contains two 8 peptides (PGPPKPMP), this is the characteristic feature of proline rich protein gene, therefore, be Ta-PRP3 with this unnamed gene.Utilize TMpred(http: //www.ch.embnet.org/software/TMPRED_form.html) the Ta-PRP3 protein sequence is carried out the cross-film structure prediction, find that there is not membrane-spanning domain in it, show that Ta-PRP3 is not embrane-associated protein.

The chromosomal localization of embodiment 2Ta-PRP3 gene

According to Ta-PRP3 gene order design Auele Specific Primer PRP10F(AGTGCTACTCCACCTGCAT, SEQ IDNO.5) and ZW-3R(TTAGAGCTGATGGATCTATAG, SEQ ID NO.6).This only amplifies single band in China spring to primer.With the nulli-tetrasomes of a cover Common Wheat Varieties China spring (E.R.Sears, Chen Peidu, Weng Yiqun. the history of China spring aneuploid, wheat crops journal, 1990,2:16-19; Rattan far away is grand etc. and common wheat chromosome deletion system breeds, 1995,2:5-8. in the present invention, nullisomic used/limbs material draws (the Wheat Genetics Resource Centre from wheat genetic resource center of kansas, u.s.a state university, Kansas State University, USA)) genomic dna is that template is carried out pcr amplification reaction, and the TaPRP3 gene is carried out the karyomit(e) physical positioning.PCR program: 10-50ng/ μ l DNA profiling, each 0.5 μ l of the PRP10F of 10 μ M and ZW-3R; 2.5 μ l10 * buffer; 2.5 the dNTP of μ l2.5mM; 1.5 the Mg of μ l25mM ²⁺0.25 μ l (5U/ μ l) Taq polymerase(TaKaRa), add water to 25 μ l.The PCR reaction conditions is: 94 ℃ of denaturation 3min; 94 ℃ of 30sec, 55 ℃ of 45sec, 72 ℃ of 1min, 33 circulations; 72 ℃ are extended 10min.The PCR product detects through 1% agarose gel electrophoresis.The amplification banding pattern only appears in this primer in third part homology group nulli-tetrasomes difference Ta-PRP3 amplification in the material (Fig. 1) of 3D nullisomic/3A limbs, 3D nullisomic/3B limbs all lacks the band of a 602bp, shows that Ta-PRP3 is positioned on 3D karyomit(e).

The expression characteristic that embodiment 3Ta-PRP3 gene is induced by gibberella

Use can specific amplified Ta-PRP3 primer pair PRP-3D-2F(TCCAAGTGAACACGCGATAT, SEQ IDNO.7) and ZW-3R induced by gibberella to this gene to carry out real-time fluorescence quantitative PCR (QRT-PCR) analysis.PCR reaction is increased and detects fluorescence real-time fluorescence quantitative PCR instrument (MyIQ, Bio-Rad company, the U.S.) is upper.Contain 2 * SYBR Green PCR Master Mix10 μ l in 20 μ l PCR reaction systems, 0.5uM primer PRP-3D-2F and ZW-3R, reverse transcription cDNA template 2 μ l(cDNA article one chains are synthetic as follows, and agents useful for same is all available from Takara company.Oligo d (T) 18primers (100nmol/mL) that adds the 1 total RNA of μ g, 2 μ l in the eppendorf centrifuge tube of 200 μ l, the sterilized water that spends the RNA enzyme is supplied liquor capacity to 10 μ l; Rotating centrifugal after mixing is hatched 10min for 70 ℃ on the PCR instrument, quenching 2min on ice then, centrifugal collection; Add successively following composition on ice: 5 * Reverse Transcriptase XL Buffer4 μ l, dNTP Mixture (10mmol/L each) 2 μ l, Ribonuclease Inhibitor(40U/ μ l) 0.5 μ l, Reverse Transcriptase XL(AMV) (5U/ul) 1 μ l, the sterilized water that spends the RNA enzyme is supplied liquor capacity to 20 μ l.Place 10min under mixing, room temperature; On the PCR instrument 42 ℃, 40min; 48 ℃, 30min; 70 ℃, 15min termination reaction, cooled on ice and centrifugal collection; Add 0.5 μ l RNaseH, 37 ℃, 30min; Centrifugal collection saves backup in-20 ℃ after diluting 10 times).Amplification is: 95 ℃ of 10min, then 95 ℃ of 15sec, 60 ℃ of 30sec, 72 ℃ of 1min, totally 40 circulations.After reaction finishes, carry out the mensuration of melting curve, the gene expression detection level is quantitatively analyzed with the MyIQ system software.Result shows: in Wangshuibai, after gibberella inoculation 6h, the Ta-PRP3 gene is lowered and is expressed, and 12h and 24h expression amount return to the front level of inducing, and the 36h up-regulated expression is obvious, and 48h and 72h expression level descend again.In sense head blight mutant NAUH117, after gibberella inoculation 6h, the Ta-PRP3 gene is lowered and is expressed, and 12h and 24h up-regulated expression are obvious, and 36h, 48h and 72h expression level descend again.This gene expression pattern in Wangshuibai and mutant NAUH117 is slightly different, NAUH117 compares with mutant, the Ta-PRP3 gene time that up-regulated expression continues in Wangshuibai will be grown, and namely lowers after inoculation 48h in Wangshuibai and expresses, and expresses and lower after inoculation 36h in mutant; Induce simultaneously the expression amount apparently higher than susceptible mutant NAUH117 (Fig. 2) of the gene expression amount of 36h in Wangshuibai.Infer that thus the accumulation of Ta-PRP3 gene expression amount is relevant with the wheat scab resistance reaction.

Embodiment 4Ta-PRP3 sense expression vector builds and transforms Common Wheat Varieties Yangmai No.158 and Disease Resistance Identification

Take Ta-PRP3 gene cDNA full length sequence as template, use primer pair 220-ZWF(CGCGGATCCCTCACTCACTAGGGAAGCAT, SEQ ID NO.8) and 220-ZWR(CGGGGTACCCCTCACACAAGGAATCAACT, SEQ ID NO.9) carry out pcr amplification, reclaim amplified fragments.With BamH I and Kpn I, amplified production is carried out double digestion, enzyme is cut (Jefferson RA in carrier pBI220 after product is inserted into BamH I and Kpn I double digestion, Kavanagh TA, Bevan MW.GUS fusions:beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.EMBO J.1987,6:3901-3907.), thereby the Ta-PRP3 gene is placed in the multiple clone site place of 35S strong promoter back, obtains expression vector pBI220-Ta-PRP3(Fig. 3 A).

picking preculture 7 days is 2000 Yangmai No.158 rataria callus approximately, Overexpression vector pBI220-Ta-PRP3 and the carrier pAHC25(Fig. 3 B of goal gene Ta-PRP3 will be carried, public, Christensen A H, Quail P H, Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants, Transgenic Research, 1996, 5:213-218.)) pass through the particle bombardment cotransformation to Yangmai No.158, ooze substratum (MS+ABA0.5mg/L+ caseinhydrolysate 500mg/L+2 at height before bombardment, 4-D2mg/L+ glucose 30g/L+0.4mol/L N.F,USP MANNITOL, pH5.8) upper pre-treatment 4 – 6h, ooze at height after bombardment and continue to cultivate 16h on substratum.Afterwards callus is transferred to upper dark the cultivation for 2 weeks of recovery media (1/2MS+ caseinhydrolysate 500mg/L+2,4-D2mg/L+ sucrose 30g/L, pH5.8) of indiscriminate pressure, to growing vigorous callus, then transfers them to and contain 3mg.L ^-1On the screening culture medium of Bialaphos (1/2MS+ABA0.5mg/L+ caseinhydrolysate 500mg/L+2,4-D1mg/L+ sucrose 30g/L+3mg/LBialaphos, pH5.8), 2 weeks of screening and culturing.The callus that then will have resistance is transferred to division culture medium (1/2MS+L-paddy ammonia phthalein amine l mmol/L+ caseinhydrolysate 200mg/L+KT1mg/L+IAA0.5mg/L+ sucrose 30g/L+ agar 0.8%, pH5.8) on, the differentiation of 25 ℃ of green buds of illumination (10h/d) induction of resistance, transfer them to when Bud Differentiation grows to 2 – 3cm the Rooting and hardening-off culture base (1/2MS+KT1mg/L+ sucrose 30g/L+ agar 0.8%, pH5.8) in.Be about 8cm, when root system is more healthy and stronger, to open pipe hardening 2-3d in suitable season, wash away at last the substratum residue that root system carries to regrowth, transplant to the paper bag left and right of slow 1 week of seedling, then transplant engagement alms bowl or large Tanaka's growth, obtain totally 136 of regeneration plants.

Extract all regeneration plant genomic dnas, transformed plant is utilized 35S promoter primer 35S5F(TGCGATAAAGGAAAGGCTATC on carrier, SEQ ID NO.10) and the inner primer PRP11R(CTTGTAGCAATCCACCTGTT of goal gene, SEQ ID NO.11) carry out pcr amplification, to identify positive plant.PCR program: 10-50ng/ μ l genomic templates, each 0.5 μ l of the 35S5F of 10 μ M and PRP11R; 2.5 μ l10 * buffer; 2.5 the dNTP of μ l2.5mM; 1.5 the Mg of μ l25mM ²⁺0.25 μ l (5U/ μ l) Taq polymerase(TaKaRa), add water to 25 μ l.The PCR reaction conditions is: 94 ℃ of denaturation 3min; 94 ℃ of 45sec, 50 ℃ of 50sec, 72 ℃ of 70sec, 33 circulations; 72 ℃ are extended 10min.The PCR product is through 1% agarose gel electrophoresis.Wherein the 8 strains purpose band of 550bp that can increase, be accredited as positive plant, and numbering is followed successively by: T ₀-2, T ₀-5, T ₀-9, T ₀-12, T ₀-14, T ₀-15, T ₀-18 and T ₀-115(Fig. 4).And utilize the same primers as combination to identify T ₀The derivative T that obtains of positive plant ₁For strain, i.e. T ₁-2, T ₁-5, T ₁-9, T ₁-12, T ₁-14, T ₁-15, T ₁-18 and T ₁-115.

T to all evaluations ₁Carry out scab resistance for positive plant and identify that [scab resistance is identified the single flower inoculation method that adopts: a Xiao Hua who 5000/ml of 10 μ l gibberella spore suspensions is added drop-wise to the tassel middle part of just blooming, remove sack after bagging moisturizing 3d, the sick small ear rate of 21d " Invest, Then Investigate " after inoculation.Sick small ear rate=(morbidity spikelet number/total spikelet number) * 100%], take unconverted susceptible wheat breed Yangmai No.158, disease-resistant variety Wangshuibai as contrast.Sick small ear rate statistics and t test result show, T ₁-2, T ₁-9, T ₁-18, T ₁-115 four strains are compared with acceptor contrast Yangmai No.158, and sick small ear rate variance heteropole is remarkable; T ₁-12, T ₁-14 two strains are compared with the acceptor contrast, sick small ear rate significant difference (table 1).Thereby illustrate that T1-2, T1-9, T1-12, T1-14, T1-18, six transgenic lines of T1-115 compare with the acceptor contrast, the scab resistance level is improved in various degree.

Table 1. Yangmai No.158, Ta-PRP3 transform Yangmai No.158 transgenosis T1 for sick small ear rate and the test of significance of strain and Wangshuibai

Claims (6)

1. common wheat proline rich protein gene Ta-PRP3 is characterized in that its nucleotides sequence classifies SEQID NO.1 as.

2. the protein Ta-PRP3 of the described proline rich protein gene of claim 1, is characterized in that its aminoacid sequence is SEQ ID NO.2.

3. the expression vector that contains proline rich protein gene Ta-PRP3 claimed in claim 1.

4. expression vector according to claim 3, the expression vector that it is characterized in that described proline rich protein gene Ta-PRP3 be with pBI220 for the carrier that sets out, Ta-PRP3 gene claimed in claim 1 is inserted gained between the BamHI of pBI220 and KpnI restriction enzyme site.

5. the application of proline rich protein gene Ta-PRP3 claimed in claim 1 in cultivating the wheat-resistance to scab kind.

6. the described application of expression vector in cultivating the wheat-resistance to scab kind that contains proline rich protein gene Ta-PRP3 of claim 3 or 4.

Images