CN103088061A - Application of RNA and carrier in preparation of product for preventing and/or treating liver cancer - Google Patents
Application of RNA and carrier in preparation of product for preventing and/or treating liver cancer Download PDFInfo
- Publication number
- CN103088061A CN103088061A CN2013100138962A CN201310013896A CN103088061A CN 103088061 A CN103088061 A CN 103088061A CN 2013100138962 A CN2013100138962 A CN 2013100138962A CN 201310013896 A CN201310013896 A CN 201310013896A CN 103088061 A CN103088061 A CN 103088061A
- Authority
- CN
- China
- Prior art keywords
- mir
- adenovirus
- pdc312
- sequence
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention discloses application of RNA and carrier in preparation of a product for preventing and/or treating liver cancer. The invention provides a recombinant adenovirus carrier which is a recombinant adenovirus carrier formed by inserting at least one encoding gene of miR-122 into a pDC312-cmv; and the miR-122 refers to RNA shown in a sequence 1 in a sequence table or RNA encoded by a sequence 3 in the sequence table. The experiment proves that the miR-122 encoding genes are introduced into the adenovirus carrier, the adenovirus is purified and is used for performing an animal experiment, the miR-122 and the recombinant adenovirus carrier or adenovirus can obviously suppress the liver cancer caused by chronic hepatitis B infection, and a novel liver cancer treatment medicine can be developed.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of RNA and carrier and prevent and/or treat application in the liver cancer product in preparation.
Background technology
The whole world has 3.5 hundred million people to infect the HBV(hepatitis B virus now at present), in China, 9,300 ten thousand people's chronic infection HBV are arranged approximately, approximately the infection population of 15-40% may develop into life-threatening disease such as liver cirrhosis, liver failure and hepatocellular carcinoma etc., and chronic HBV infection serious harm people are healthy.the existing methods for the treatment of that is used for Chronic Hepatitis B comprises that alpha-interferon (IFN-α) and nucleosides or nucleoside analog (as draw the pyridine of miaow furan, Adefovir and Entecavir), interferon-' alpha ' is first medicine that obtains the clinical treatment hepatitis B virus infection, as important first-line drug, polyoxyethylene glycol interferon-' alpha ' single therapy can effectively be treated the chronic hepatitis B patient of 25-40%, unite with nucleotide analog that use can produce larger lasting antiviral curative effect and in the HBeAg positive patient virus e antigen turn out cloudy, but interferon-' alpha ' treatment side effect is obvious, easily bounce-back after drug withdrawal, some patients were is insensitive to the interferon-' alpha ' reaction, weak curative effect.Nucleoside analog is long the course for the treatment of, easily bounce-back of virus after drug withdrawal, and mutagenesis, increase resistance.Infected by chronic viral hepatitis B at Chinese hepatocellular carcinoma majority and cause, and the present clinical effective pharmacological agent that do not have.Therefore, in the urgent need to developing new hepatitis B and liver cancer treatment medicine to replenish or to substitute existing antiviral therapy scheme and liver cancer treatment.
MicroRNA(miRNA) be the little RNA of non-coding of about 22 Nucleotide of a class, its function is mainly the negative regulation expression of target gene, mRNA3' end non-coding region complementary pairing common and target gene induces the translation of target gene to suppress, mRNA deadenylation and degraded.MicroRNA-122(miR-122) specificity overexpression in mammalian liver accounts for 70% of the total microRNA content of liver.
Summary of the invention
An object of the present invention is to provide recombinant adenoviral vector.
Recombinant adenoviral vector provided by the invention is at least one encoding gene with miR-122 inserts the recombinant adenoviral vector that obtains in the pDC312-cmv adenovirus carrier;
Described miR-122 is the RNA of the RNA shown in sequence 1 in sequence table or 3 codings of the sequence in sequence table.
The RNA of sequence 3 codings in sequence table is the precursor of the RNA shown in sequence 1.
Above-mentioned recombinant adenoviral vector is specially following 1) or 2):
1) described recombinant adenoviral vector inserts for 1 encoding gene with described miR-122 the carrier that obtains between the multiple clone site of pDC312-cmv adenovirus carrier;
2) described recombinant adenoviral vector inserts for 8 encoding genes with described miR-122 the carrier that obtains between the multiple clone site of pDC312-cmv adenovirus carrier.
In above-mentioned recombinant adenoviral vector, the nucleotides sequence of the encoding gene of described miR-122 is classified the sequence 3 in sequence table as;
The nucleotides sequence of 8 encoding genes of described miR-122 is classified the sequence 4 in sequence table as.
1) described recombinant adenoviral vector is for inserting DNA molecular shown in the sequence 3 in sequence table in the carrier that obtains between the multiple clone site of pDC312-cmv adenovirus carrier; Be specially the DNA molecular shown in sequence 3 is inserted between the BamHI and Xho1 restriction enzyme site of adenovirus expression carrier pDC312-cmv, obtain recombinant plasmid pDC312-miR-122.
2) described recombinant adenoviral vector is for inserting DNA molecular shown in the sequence 4 in sequence table in the carrier that obtains between the multiple clone site of pDC312-cmv adenovirus carrier.Be specially the DNA molecular shown in sequence in sequence table 4 is inserted between the BamHI and Xho1 restriction enzyme site of adenovirus expression carrier pDC312-cmv, obtain recombinant plasmid pDC312-8miR-122.
Another object of the present invention is to provide a kind of recombinant adenovirus.
Recombinant adenovirus provided by the invention is for changing above-mentioned recombinant adenoviral vector over to host cell, the recombinant adenovirus that is packaged to be; Described host cell is specially HEKC; HEKC further is specially HEKC HEK293.
MiR-122 has following 1 in preparation) and/or 2) application in the product of function is also the scope of protection of the invention:
1) prevent and/or treat tumour;
2) reduce tumour quantity and/or tumor weight;
Described miR-122 is the RNA of the RNA shown in sequence 1 in sequence table or 3 codings of the sequence in sequence table.
Above-mentioned recombinant adenoviral vector has following 1 in preparation)-7) in application in the product of at least a function be also the scope of invention protection:
1) prevent and/or treat tumour;
2) reduce tumour quantity and/or tumor weight;
3) suppress hepatitis B virus HBsAg antigen and/or HBeAg antigen presentation;
4) suppress the hepatitis B virus DNA copy;
5) suppress hepatocellular HBcAg antigen presentation;
6) suppressing hepatitis B virus transcribes; Be specially and suppress HBV pgRNA and/or total rna expression.
7) inhibition tumor cell propagation.
Above-mentioned adenovirus has following 1 in preparation)-5) in application in the product of at least a function be also the scope of protection of the invention:
1) prevent and/or treat tumour;
2) reduce tumour quantity and/or tumor weight;
3) suppress hepatitis B virus HBsAg antigen presentation;
4) suppress the hepatitis B virus DNA copy;
5) suppress hepatocellular HBcAg antigen presentation.
In above-mentioned application, described tumour is liver cancer;
Described tumour cell is liver cancer cell, and described liver cancer cell further is specially the HepG2 cell.
In above-mentioned application, described product is medicine.
Of the present invention experimental results show that, the present invention will express 8 miR-122 encoding genes and import in adenovirus carrier, and be purified into adenovirus, carry out experimentation on animals with it, find that synthetic miR-122 and recombinant adenoviral vector or adenovirus can obviously suppress the liver cancer that the hepatitis B chronic infection causes, can be developed into to be the novel liver cancer medicine.In addition, adopt pDC312-cmv as the carrier framework of recombinant adenoviral vector, have a host range wide, pathogenic low to the people, infect and expressing gene in propagation and non-proliferative cell, unconformability is in karyomit(e), without advantages such as insertion mutagenicities.
Description of drawings
Fig. 1 is that recombinant adenoviral vector pDC312-8miR-122 builds schema
Fig. 2 is tail vein injection miR-122 treatment HBV transgenic mice result in body
Fig. 3 is that in body, tail vein injection is expressed miR-122 adenovirus treatment HBV transgenic mice result
Fig. 4 is that in HBV transgenic mice body, the synthetic miR-122 of tail vein injection detects liver cancer generation result
Fig. 5 is that in HBV transgenic mice body, tail vein injection is expressed miR-122 adenovirus detection liver cancer generation result
Fig. 6 is miR-122 inhibition HBV replication ability
Fig. 7 is pSuper-miR-122 expression vector inhibition HBV replication ability
Fig. 8 is pDC312-miR-122, pDC312-8miR-122 adenovirus expression carrier inhibition HBV replication ability
Fig. 9 is that miR-122 suppresses liver cancer cell HepG2 propagation
Figure 10 is that the pSuper-miR-122 expression vector suppresses liver cancer cell HepG2 propagation
Figure 11 is that pDC312-miR-122, pDC312-8miR-122 adenovirus expression carrier suppress liver cancer cell HepG2 propagation
Figure 12 is that the miR-122 inhibitor promotes the hbv replication ability
Figure 13 is that the miR-122 inhibitor promotes cell proliferation
Embodiment
The experimental technique that uses in following embodiment is ordinary method if no special instructions.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Quantitative test in following examples all arranges repeated experiments three times, results averaged.
HBsAg (HBsAg) detection kit and HBV e antigen detection kit are all available from Shanghai Kehua Bio-engineering Co., Ltd, HBsAg authentication code: the accurate word S10910113 of traditional Chinese medicines, HBV e antigen authentication code: the accurate word S10910112 of traditional Chinese medicines; TriPure Isolation Reagent is available from Roche, catalog number 11667165001; The reverse transcription test kit is available from precious biotechnology company limited, catalog number BK3802; Whole blood/tissue gene group is extracted test kit and is followed (Beijing) biochemical technology company limited, catalog number DP304 available from the sky; Southern blot test kit is available from GE, and catalog number is RPN3680, RPN3681, RPN3690, RPN3691, RPN3692; Hepatitis B virus DNA copy number and pgRNA, totalRNA detection by quantitative primer are all synthetic in invitrogen company.Transfection reagent lipo2000 is available from invitrogen, catalog number 11668019; Human liver cancer cell HepG2(ATCC number:HB-8065), Huh-7(ATCC number:PTA-4583) and Human Embryonic Kidney HEK 293(ATCC number:CRL-1573) available from ATCC; HBV transgenic mouse: available from the 458th hospital of Guangzhou PLA.
The structure of the adenovirus of embodiment 1, miR-122, the recombinant adenoviral vector that contains the miR-122 encoding gene and expression miR-122
One, the acquisition of miR-122
Synthetic miR-122, sharp rich bio tech ltd is synthetic in Guangzhou.
The nucleotides sequence of miR-122 is classified sequence 1 in sequence table as.
The negative control RNA of miR-122 available from the sharp rich bio tech ltd in Guangzhou (be miRNA mimic Ncontrol#22 product information:
Essential information: people, mouse, the general miRNA mimic Ncontrol#22 of rat
Ripe miRNA title: cel-miR-239b-5p
Ripe miRNA numbering: MIMAT0000295
Ripe miRNA sequence: UUUGUACUACACAAAAGUACUG)
Two, the structure that contains the adenovirus recombination vector of miR-122
The nucleotides sequence of miR-122 precursor encoding gene is classified the sequence 3 in sequence table as, and this genes encoding miR-122 precursor obtains miR-122(sequence 1 after shearing).
Recombinant adenoviral vector pDC312-miR-122 builds: the DNA molecular shown in sequence 3 is inserted between the BamHI and Xho1 restriction enzyme site of adenovirus expression carrier pDC312-cmv, obtain recombinant plasmid pDC312-miR-122.
Above-mentioned adenovirus expression carrier pDC312-cmv builds by the following method: will be from pCDNA3.1(+) (invitrogen, catalog number V790-20) DNA molecular that contains promotor CMV and multiple clone site (sequence 5) that obtains of clone inserts adenovirus expression carrier this yuan of pDC312(Zhenyang, catalog number PD-01-26) XbaI and the BamHI restriction enzyme site between obtain adenovirus expression carrier pDC312-cmv.Repeat for fear of restriction enzyme site and multiple clone site, cutting repeatedly, design of primers adopts the technology of isocaudarner, AvrII (XmaJI) and Xbal I, Bgl II and BamH I are isocaudarner, and this carrier is take CMV as promotor, and ability to express is strong.
Design of primers:
CMV-F?aat?cctagg?ATGTACGGGCCAGATATACGC
CMV-R?aat?agatct?TTTCCGCCTCAGAAGCCATA
Recombinant adenoviral vector pDC312-8miR-122 builds: for the DNA molecular shown in sequence in sequence table 4 is inserted between the BamHI and Xho1 restriction enzyme site of adenovirus expression carrier pDC312-cmv, obtain recombinant plasmid pDC312-8miR-122:
It is as follows that the construction process of above-mentioned recombinant adenoviral vector also can (Fig. 1): take the pSuper-miR-122(carrier construction method see embodiment 3 two 1) as template, carry out pcr amplification with Pre-miR-122-F and Pre-miR-122-R as primer, obtain 250bp left and right PCR product and cut through BamHI and Xho1 enzyme and insert the adenovirus expression carrier pDC312-miR-122 that obtains expressing a miR-122 precursor in the pDC312-cmv that cuts through same enzyme; Then pDC312-miR-122 cuts back to close through BamHI and XhoI enzyme the pre-miR-122 fragment that obtains the 250bp left and right, cut the pDC312-miR-122 recovery with Bgl II and Xho I enzyme again and obtain carrier framework, the fragment that reclaims is connected the adenovirus carrier that conversion obtains expressing 2 miR-122 precursors with carrier; Repeatedly repeat, insert 8 miR-122 precursors, obtain recombinant plasmid pDC312-8miR-122.
The design primer sequence is as follows:
Pre-miR-122-F：CGGGATCCTTTCTCTGCTTAGGTCACAATATGT
Pre-miR-122-R：CCGCTCGAGAGATCT?ATCAGATGAACCTTCTTGCTCAA
Above-mentioned pDC312-miR-122 and pDC312-8miR-122 are the recombinant adenoviral vector that contains the miR-122 encoding gene.
Three, express the acquisition of the adenovirus of miR-122
1, plasmid is obtained through refining greatly standby
With recombinant adenoviral vector pDC312-miR-122, pDC312-8miR-122 and adenovirus framework plasmid pBHGlox △ E1, this yuan of 3Cre(Zhenyang, catalog number PD-01-64) import respectively intestinal bacteria competence DH5 α, obtain mono-clonal.Operate according to prestige lattice Lars large upgrading grain test kit specification sheets.To containing in suitable antibiotic 5mL LB substratum, 37 ℃ of shaking culture are spent the night with single colony inoculation, get the 5mL overnight culture and are added to and contain in antibiotic 300mLLB substratum, and 37 ℃ of shaking culture are spent the night, and in 4 ℃ 6, the centrifugal 15min of 000rpm collects bacterium.Add the 5mL solution I with the abundant mixing of thalline, and move in the 50mL centrifuge tube.Add solution II 5mL, soft mixing sex change 5min, solution is transparent, then adds the solution III of 5mL, puts upside down immediately mixing to white floss and produces, and places 15min on ice.With above-mentioned lysate in 4 ℃, the centrifugal 30min of 12,000rpm, supernatant is transferred in another pipe, then under 4 ℃ 12, the centrifugal 15min of 000rpm, shift supernatant to new centrifuge tube, add the 10mL Virahol, put upside down the abundant mixing of centrifuge tube, and place 15min on ice, and then at 4 ℃ 12, the centrifugal 15min of 000rpm, careful supernatant discarded, be inverted and drain gently remaining liq, add the 0.5mL solution I, fully dissolution precipitation agglomerate (available wide mouthful of suction pipe blown and beaten assist in dissolving gently).Move in new 1.5mL Ep pipe, room temperature is placed 20min with abundant dissolving.with desk centrifuge room temperature 12, the centrifugal 2min of 000rpm, supernatant is moved in new Ep pipe, remove liquid A with 100 μ L BufferIV(impurity) process twice, at every turn gently after mixing in 12, the centrifugal 5min of 000rpm, getting supernatant changes to new Ep, and then remove liquid B with 70 μ L Buffer V(impurity), mixing gently, 12, the centrifugal 10min of 000rpm, getting supernatant changes to new Ep, add the 0.5mL Virahol, mixing, room temperature is placed 10min, 12, the centrifugal 10min of 000rpm, abandon supernatant, wash gently 2 times with 70% ethanol 1mL, supernatant discarded, the appropriate TE dissolution precipitation of rear use (can vibrate or blow and beat gently assist in dissolving with wide mouthful of suction pipe) is dried in inversion in 37 ℃ of water-baths, obtain recombinant adenoviral vector pDC312-miR-122, recombinant adenoviral vector pDC312-8miR-122 and adenovirus framework plasmid pBHGlox △ E1, 3Cre.
Measure 0D260 and 0D280, calculate DNA concentration and purity.
2, express miR-122 adenovirus packing
Transfection is inoculated into 6 orifice plates with HEKC HEK293 the day before yesterday, and during transfection, cell degree of converging reaches 70% left and right, carries previous hour and changes substratum into opti-MEM.
The preparation of miR-122 adenovirus A:
(1) packing: adopt aforesaid method with recombinant adenoviral vector pDC312-miR-122 and adenovirus framework plasmid pBHGlox △ E1,3Cre adopts lipo2000 cotransfection HEK293 cell, plasmid transfection ratio the best is mass ratio 1:1, the 4-6 hour cell is washed three times with PBS, and changes the full substratum of DMEM of 2ml10%FBS into.
Every day observation of cell disease, if cell density is too large,, noted not using trysinization with in being transferred to the 10cm culture dish under cell piping and druming at transfection 3-4 days, prevent wild-type virus.About 10 days, pathology appears in the cell major part in transfection, and cell rounding comes off, cell is blown and beaten to get off to be transferred in the 15ml centrifuge tube, the centrifugal 10min collecting cell of room temperature 2000rpm is outwelled supernatant, and 1ml PBS re-suspended cell is transferred to-20 ℃ of preservations in the 1.5ml centrifuge tube.
(2) adenovirus discharges: with cell multigelation three times, make the complete cracking of cell, virus discharges, and 4 ℃ of centrifugal 10min of 12000rpm collect viral supernatant liquid, minute is filled to-80 ℃ of preservations in the 1.5ml centrifuge tube, obtains miR-122 adenovirus A.
Adopt and use the same method recombinant adenoviral vector pDC312-8miR-122 and adenovirus framework plasmid pBHGlox △ E1,3Cre adopts lipo2000 cotransfection HEK293 cell, packing, discharges, and obtains miR-122 adenovirus B.
Adopt and use the same method adenovirus carrier pDC312-cmv and adenovirus framework plasmid pBHGlox △ E1,3Cre adopts lipo2000 cotransfection HEK293 cell, packing, discharges, and obtains the contrast adenovirus.
3, virus is identified and Function detection
Infect the day before yesterday HepG2 is inoculated into 6 orifice plates, during infection, cell degree of converging reaches 70% left and right, carries previous hour and changes substratum into full substratum.
Add respectively HepG2 to infect 48h 10ul miR-122 adenovirus A, miR-122 adenovirus B and the contrast adenovirus of above-mentioned acquisition, the difference collecting cell, RNA, the miR-122 high expression level of RT-PCR Taqman probe in detecting maturation are extracted in the Trizol cracking.
Taqman detects the miR-122 method: the trizol reagent that adds 1ml in 6 orifice plate hole, cracking 5min, be drawn in the import EP pipe of 1.5ml, the chloroform that adds 200ul to pollute without the RNA enzyme, mixing 15s, 4 ℃ of centrifugal 15min of 13000rpm, drawing supernatant transfers in a new 1.5ml import EP pipe, add 500ul Virahol-20 a ℃ precipitation to spend the night, 4 ℃ of centrifugal 10min of 13000rpm, outwell supernatant, 75% washing with alcohol with the preparation of DEPC water precipitates once, dry, 50ul DEPC water dissolution, to specifications, be transcribed into cDNA with Taqman reverse transcription test kit, the RT-PCR detection by quantitative, detect primer synthetic in invitrogen company.
Taqman reverse transcription test kit: available from invitrogen, product article No.: 4366596
The miR-122 probe: available from invitrogen, catalog number: Cat.#4427975, article No.: 002245
U6 internal reference probe: available from invitrogen, catalog number: Cat.#4427975, article No.: 01093
Detected result is adenovirus A transfection group than at least 10 times of the horizontal high expression levels of miR-122 in contrast Adenovirus Transfection group cell, and adenovirus B transfection group is than at least 14 times of the horizontal high expression levels of miR-122 in contrast Adenovirus Transfection group cell.Illustrate that miR-122 high expression level adenovirus effect is remarkable.
4, a large amount of amplifications and the purifying of adenovirus
Infect the day before yesterday HEK293 is inoculated in the 150mm culture dish, during infection, cell degree of converging reaches 80%-90%, carries the DMEM substratum that substratum was changed in previous hour into 10ml5%FBS, miR-122 adenovirus A virus liquid is added in substratum, mixing, place 37 ℃, 5%CO gently
2Incubator in, add the DMEM substratum of 10ml5%FBS after 1.5 hours and continue to cultivate.Second day observation of cell state, collecting cell when pathology appears in cell 80%-90%, three abundant lysing cell of multigelation, ℃ storage of collection viral supernatant liquid-80 is to be purified.
Be below adenovirus cesium chloride density gradient centrifugation purified virus step:
A) precooling centrifugal rotor to 4 ℃.
B) slowly add 8ml1.4g/ml cesium chloride (53g+87ml10mM Tris-HCl, pH7.9) in centrifuge tube, more very light and slow the 6ml1.2g/ml cesium chloride (26.8+92ml10mM Tris-HCL, pH7.9) that adds.The final purity of virus depends on the quality of density gradient.
C) add 20ml DMEM5% virus to preserve liquid in super clean bench at the discontinuous gradient top, virus quantity must be less than 10
9Gained in cell, otherwise will be over the density gradient lifting capacity.Be less than 20ml if preserve the volume of liquid, transfer to 20ml with pH7.910mMTris-HCl.
D) equilibrium centrifugation pipe is 23000rpw on 100,000 * g(SW28 rotor) 4 ℃ centrifugal 90 minutes.
E) take out centrifuge tube in super clean bench, with the upright fixing centrifuge tube of clip.
F) suck most of impurity with the 10ml pipettor from the gradient top.
G) stick adhesive tape on the point of puncture of centrifuge tube outer wall, to prevent having liquid to reveal in piercing process.
H) with slightly puncturing lower than the position of virus band (under a band) from the centrifuge tube outer wall with the 5ml syringe of 18G syringe needle.
I. note: the zone between infectivity and defective virus particle is usually more muddy, is sure not to draw this muddy district.
I) careful suction virus band, avoid being drawn onto other band and impurity, extracts syringe needle.
J) take out syringe needle, the solution that will contain virus is transferred to aseptic 15ml centrifuge tube.
K) add 1 times of volume 1 * TE, this step is necessary for solution density is reduced to below 1.2, and the density of virus band is approximately 1.345; Obtain purifying miR-122 adenovirus A.
Adopt use the same method amplification purification miR-122 adenovirus B and purifying contrast adenovirus.
5, the titre of adenovirus detects:
Adopt the adenovirus titre detection kit (catalog number (Cat.No.): K-AD0001) carry out to specifications the titre detection of purifying miR-122 adenovirus A, purifying miR-122 adenovirus B and purifying contrast adenovirus of this yuan Zhenyang purchase.
Result is as follows: the titre of purifying miR-122 adenovirus A, purifying miR-122 adenovirus B and purifying contrast adenovirus is respectively 1 * 10
9IU/ml, 5 * 10
9IU/ml, 2 * 10
9IU/ml.
The application of the adenovirus of embodiment 2, miR-122, the recombinant adenoviral vector that contains the miR-122 encoding gene and expression miR-122
1, the application of the adenovirus of miR-122 and expression miR-122 in treatment HBV transgenic mice
A, the miR-122 application in treatment HBV transgenic mice
With the 6-8 HBV transgenosis BALB/c mouse (available from Army Hepatopathy Center, No.458 Hospital, PLA) in age in week; Body weight is close, and the mouse that all is about 16g is divided into 2 groups at random, 5 every group.
MiR-122 solution: every 10nM miR-122 is dissolved in PBS(8g/L NaCl, 0.2g/L KCl, the 3.628g/LNa of 0.1ml
2HPO
412H
20,0.24g/L KH
2PO
4And water, pH value 7.4) in, obtain miR-122 solution;
The negative control RNA solution of miR-122: the miR-122 negative control RNA of every 10nM is dissolved in PBS(8g/LNaCl, 0.2g/L KCl, the 3.628g/L Na of 0.1ml
2HPO
412H
20,0.24g/L KH
2PO
4And water, pH value 7.4) in, obtain the negative control RNA solution of miR-122.
First group (miR-122 group): every mouse tail vein injection is dissolved in 0.1ml miR-122 solution; Every injection in three days once, continued for two weeks.
Second group (negative control group): every mouse tail vein injection is dissolved in the negative control RNA solution of 0.1ml miR-122; Every injection in three days once, continued for two weeks.
Respectively detect HBsAg antigenic expression in mice serum on the the 1st, 3,5,8,12 day after tail vein injection finishes, reduce C antigen levels in detecting serum HBV DNA copy number and Mouse Liver in the most obvious the 12nd day at HBsAg, specific as follows:
1), the HBsAg antigen (HBV S antigen levels) in serum in detection bodies
In miR-122 group and negative control group mice serum, HBVs antigen adopts HBsAg (HBV S antigen levels) to detect; Operation steps is carried out according to manufacturer's specification sheets.
The results are shown in Figure shown in 2A,
HBV S antigen levels after the injection of miR-122 group finishes in the serum of the 1st, 3,5,8,12 day is respectively 5.2 * 10
5, 3.1 * 10
5, 2.5 * 10
5, 2.2 * 10
5, 2.4 * 10
5
HBV S antigen levels after the negative control group injection finishes in the serum of the 1st, 3,5,8,12 day is respectively 5.1 * 10
5, 5.0 * 10
5, 5.7 * 10
5, 5.5 * 10
5, 5.3 * 10
5
Can find out, compare with control group, the HBV S antigen of miR-122 group finishes obviously decline in the 3rd day at tail vein injection.The 12nd day, the average HBV s antigen value of miR-122 group was 2.4 * 10
5Than control group 5.3 * 10
5Remarkable downward (P＜0.05) is arranged.Express the miR-122 group and have significant difference for the reduction of HBV s antigen compared with the control.
2), the HBV DNA copy number in serum in detection bodies
Use hbv nucleic acid immue quantitative detection reagent box (PCR-fluorescent probe method) (available from Da＇an Gene Company, Zhongshan University, production number Cat.#DA-B051) miR-122 group and negative control group mouse 100ul serum to be carried out the absolute quantitation of DNA copy number; Operate according to manufacturer's product description.
The making method of HBV DNA quantitative measurement standard curve: (A.2001Feb13 this plasmid is documented in Proc Natl Acad Sci U S with HBV DNA (4.1kbp) plasmid of concentration known; 98 (4): 1841-6.Epub2001Feb6.Transcriptional regulation of hepatitis B virus by nuclear hormone receptors is a critical determinant of viral tropism; The below is called again plasmid pHBV1.3; The public can obtain from Institute of Microorganism, Academia Sinica .) carry out successively 1000 times of dilutions, 1 * 10
0-1 * 10
9Typical curve and detection by quantitative are carried out repeated experiments, results averaged three times.DNA copy number detection by quantitative primer:
forward：5’-CTCCCCGTCTGTGCCTTCTC-3’；
reverse：5’-TCGGTCGTTGACATTGCTGA-3’
As shown in the 12nd day two groups of serum HBV DNA copy number results figure as left in Fig. 2 C,
MiR-122 group serum HBV DNA copy number is 1.5 * 10
5Negative control group serum HBV DNA copy number is 4.5 * 10
5
The above results can be found out, with control group mean value 4.5 * 10
5Compare, the miR-122 cell mean is 1.5 * 10
5, the HBVDNA copy number obviously reduces (p＜0.01).
3), hepatocellular C antigen HBcAg in detection bodies
After tail vein injection finishes the 12nd day, miR-122 group and negative control group mouse liver are carried out immunohistochemical methods, and (antibody was anti-HBcAg antibody (Gene science (Shanghai) Co., Ltd., article No.: GB058610).
The results are shown in Figure shown in 2B, demonstration MiR-122 group can significantly be lowered hepatocellular C antigen HBcAg level, cytochrome and obviously reduces.
4), hepatocellular DNA copy number in detection bodies
Adopt whole blood/tissue gene group to extract test kit and (follow (Beijing) biochemical technology company limited available from the sky, catalog number DP304) extract tail vein injection and finish after DNA in the 12nd day miR-122 group and negative control group mouse liver tissue, extracting method sees product description for details.
DNA 50ul H with each group of said extracted
2The O dissolving, the RT-PCR detection by quantitative, the detection primer is:
forward：5’-CTCCCCGTCTGTGCCTTCTC-3’
reverse：5’-TCGGTCGTTGACATTGCTGA-3’
The making method of HBV DNA quantitative measurement standard curve is with 2 of A).
As shown in result figure as right in Fig. 2 C, in miR-122 group liver, HBV DNA copy number is 1.3 * 10
5In the negative control group liver, HBV DNA copy number is 7.5 * 10
5
Can find out, with control group mean value 7.5 * 10
5Compare miR-122 cell mean 1.3 * 10
5, in liver, HBV DNA copy number obviously reduces.
The miR-122 group can significantly reduce the DNA copy number (p＜0.01) in liver cell.
The application of the adenovirus of B, expression miR-122 in treatment HBV transgenic mice
HBV transgenosis BALB/c (body weight the is close) mouse in age in 6-8 week is divided into three groups, 5 every group, carries out respectively tail vein injection:
First group (the empty adenovirus group of pDC312-cmv): every mouse tail vein injection 2 * 10
8IU/ purifying contrast adenovirus (adenovirus) only;
Second group (pDC312-miR-122 adenovirus group): every mouse tail vein injection 2 * 10
8IU/ purifying miR-122 adenovirus A(expresses the pDC312-miR-122 adenovirus);
The 3rd group (pDC312-8miR-122 adenovirus group): every mouse tail vein injection 2 * 10
8IU/ purifying miR-122 adenovirus B(expresses the pDC312-8miR-122 adenovirus);
Above-mentioned three groups are every injection in 15 days once, continue 60 days.
After finishing, the tail vein injection adenovirus detected HBsAg antigen in mice serum on the 0th, 15,30,45,60 day, DNA copy number in the C antigen levels when the HBsAg reduction was the most obvious in the 60th day in detection HBV DNA and Mouse Liver and liver, specific as follows:
1), the HBsAg antigen (HBV S antigen levels) in serum in detection bodies
In the empty adenovirus group of pDC312-cmv, pDC312-miR-122 adenovirus group and pDC312-8miR-122 adenovirus group mice serum, HBV S antigen adopts the HBsAg detection kit; Operation steps is carried out according to manufacturer's specification sheets.
Result as shown in Figure 3A,
HBV S antigen levels after the empty adenovirus group injection of pDC312-cmv finishes in the serum of the 0th, 15,30,45,60 day is respectively 4.3 * 10
5, 2.5 * 10
5, 3.2 * 10
5, 3.05 * 10
5, 4.8 * 10
5
HBV S antigen levels after the injection of pDC312-miR-122 adenovirus group finishes in the serum of the 0th, 15,30,45,60 day is respectively 4.3 * 10
5, 1.2 * 10
5, 1.9 * 10
5, 0.8 * 10
5, 1.2 * 10
5
HBV S antigen levels after the injection of pDC312-8miR-122 adenovirus group finishes in the serum of the 0th, 15,30,45,60 day is respectively 4.3 * 10
5, 0.3 * 10
5, 0.1 * 10
5, 0.07 * 10
5, 0.05 * 10
5
Can find out, compare with the 1st group of empty virus group, other HBsAg antigen of 2 groups of expressing the miR-122 adenovirus began at the 3rd day to descend.Expressing miR-122 adenovirus group has remarkable downward than control group, and the adenovirus group of expressing 8 miR-122 is more remarkable for the reduction of HBsAg antigen.
2), the HBV DNA copy number in serum in detection bodies
Use hbv nucleic acid immue quantitative detection reagent box (PCR-fluorescent probe method) (available from Da＇an Gene Company, Zhongshan University, production number Cat.#DA-B051) the empty adenovirus group of pDC312-cmv, pDC312-miR-122 adenovirus group and pDC312-8miR-122 adenovirus group mouse 100ul serum to be carried out the absolute quantitation of DNA copy number; Operate according to manufacturer's product description.
The making method of HBV DNA quantitative measurement standard curve is with 2 of A).
As shown in result figure as left in Fig. 3 C, with the empty adenovirus cell mean of pDC312-cmv be 5.2 * 10
5Compare, the HBV DNA copy number of other 2 groups of gland virus expression groups obviously reduces, and 1 miR-122 adenovirus group (pDC312-miR-122 adenovirus group) mean value is 2 * 10
5, 8 miR-122 adenovirus groups (pDC312-8miR-122 adenovirus group) mean value is 0.8 * 10
5, the 3rd group of front two groups of impacts on the HBV DNA level have notable difference (p＜0.01).
3), hepatocellular C antigen HBcAg in detection bodies
Tail vein injection adenovirus the 60th day, the empty adenovirus group of pDC312-cmv, pDC312-miR-122 adenovirus group and pDC312-8miR-122 adenovirus group mouse liver are carried out immunohistochemical methods, antibody is anti-HBcAg antibody (Gene science (Shanghai) Co., Ltd., article No.: GB058610).
Result is as shown in Fig. 3 B, and expression miR-122 adenovirus group can significantly reduce the C antigen HBcAg in liver cell.Front two groups of 8 miR-122 adenovirus groups suppress more obvious to the HBc antigen levels, and painted liver cell amount obviously reduces.
4), hepatocellular DNA copy number in detection bodies
Adopt whole blood/tissue gene group to extract test kit and follow (Beijing) biochemical technology company limited available from the sky, catalog number DP304, extract tail vein injection and finish rear the 60th day DNA in the empty adenovirus group of pDC312-cmv, pDC312-miR-122 adenovirus group and pDC312-8miR-122 adenovirus group mouse liver tissue, extracting method sees product description for details, 50ul H
2The O dissolving, the RT-PCR detection by quantitative, the detection primer is:
forward：5’-CTCCCCGTCTGTGCCTTCTC-3’；
reverse：5’-TCGGTCGTTGACATTGCTGA-3’
The making method of HBV DNA quantitative measurement standard curve is with 2 of A).
As shown in result figure as right in Fig. 3 C, with the empty adenovirus cell mean of pDC312-cmv be 8 * 10
5Compare, the HBV DNA copy number of other 2 groups of gland virus expression groups obviously reduces, and pDC312-miR-122 adenovirus cell mean is 3 * 10
5, pDC312-8miR-122 adenovirus cell mean is 1 * 10
5, the 3rd group of front two groups of impacts on the HBV DNA level have notable difference (p＜0.01).
2, the application of adenovirus in the generation that suppresses HBV transgenic mouse liver cancer of miR-122 and expression miR-122
A, the miR-122 application in the generation that suppresses HBV transgenic mouse liver cancer
With the 6-8 HBV transgenosis BALB/c mouse in age in week; Body weight is close, and mouse all is about 16g, is divided at random 2 groups, 5 every group.
First group (miR-122 group): every mouse tail vein injection 0.1ml miR-122 solution; Injection once, continues 18 months every other month.
Second group (negative control group): the negative control RNA solution of every mouse tail vein injection 0.1ml miR-122; Injection once, continues 18 months every other month.
After 18 months, each group mouse is put to death, detect the generation of liver cancer, the quantity and weight of liver neoplasm, concrete grammar is as follows:
1), the generation of HE staining examine liver cancer
Required reagent:
Dimethylbenzene, dehydrated alcohol, 95% alcohol, 90% alcohol, 85% alcohol, phenodin, 1% hydrochloride alcohol, weak ammonia (1%), Yihong, neutral gum
Agent prescription:
The preparation of hydrochloride alcohol differentiation liquid: concentrated hydrochloric acid 0.5～1ml, 75% alcohol 99ml
This liquid needs to extend or change liquid after with for some time, and new liquid divergaence time is short.
Operation steps:
Dimethylbenzene I dewaxing 10min. dimethylbenzene II dewaxing 5min.
Dehydrated alcohol washes away dimethylbenzene 1min * 2 time.
95% alcohol 1min.90% alcohol 1min.85% alcohol 1min.
Wash from the beginning 2min.
Brazilwood extract dyeing 1min to 5min.
Wash from the beginning 1min.
1% hydrochloride alcohol differentiation 20s.
Wash from the beginning 1min.
The anti-blue 30s of weak ammonia (1%).Washing from the beginning or distillation washing 1min.
Yihong dyeing 20s to 5min.
Wash from the beginning 30s.
85% dehydration of alcohol 20s.90% alcohol 30s.95%I alcohol 1min.95%II alcohol 1min.Dehydrated alcohol I 2min.Dehydrated alcohol II 2min.
Dimethylbenzene I 2min.Dimethylbenzene II 2min.Dimethylbenzene III 2min.
Neutral gum or balsam mounting.
Can find out, the HE demonstration of dyeing, miR-122 group liver cancer cell quantity greatly reduces.
2), the detection of liver neoplasm quantity and weight
After each group mouse was put to death, liver took out, and liver neoplasm is told counting, and the weight of weighing liver neoplasm.
Result can find out as shown in Figure 4, and left figure is liver neoplasm quantity statistics result, and wherein, control group liver neoplasm quantity is 50, and 8 of miR-122 groups have significant difference (p＜0.01).
Right figure is liver neoplasm gross weight statistics, and wherein, control group liver neoplasm gross weight is 490g altogether, and miR-122 group tumour gross weight is 80g, has significant difference (p＜0.01).
The adenovirus of B, expression miR-122 suppresses the generation of HBV transgenic mouse liver cancer in vivo
The expression miR-122 adenovirus that embodiment 1 is obtained: purifying miR-122 adenovirus B(expresses the pDC312-8miR-122 adenovirus) and purifying miR-122 adenovirus A(express the pDC312-miR-122 adenovirus) and purifying contrast adenovirus (expressing pDC312-cmv sky adenovirus) carry out following experiment:
HBV transgenosis BALB/c (body weight the is close) mouse in age in 6-8 week is divided into three groups, 10 every group, carry out respectively tail vein injection January once, injected altogether 18 months:
First group (the empty adenovirus group of pDC312-cmv): every mouse tail vein injection 2 * 10
8The purifying contrast adenovirus of IU, once injected altogether 18 months January;
Second group (pDC312-miR-122 adenovirus group): every mouse tail vein injection 2 * 10
8IU purifying miR-122 adenovirus A, once injected altogether 18 months January;
The 3rd group (pDC312-8miR-122 adenovirus group): every mouse tail vein injection 2 * 10
8IU purifying miR-122 adenovirus B, once injected altogether 18 months January;
After 18 months, each group mouse is put to death, detect the generation of liver cancer, the quantity and weight of liver neoplasm, concrete grammar is with above-mentioned A,
Result as shown in Figure 5,
Left figure is liver neoplasm quantity statistics result, wherein, the empty adenovirus group of pDC312-cmv tumour quantity is 65, and pDC312-miR-122 adenovirus group tumour quantity is 15, pDC312-8miR-122 adenovirus group tumour quantity is 4, and contrast has significant difference (p＜0.01).
Right figure is liver neoplasm gross weight statistics, wherein, the empty adenovirus group of pDC312-cmv tumour gross weight is 600g, and pDC312-miR-122 adenovirus group tumour gross weight is 310g, pDC312-8miR-122 adenovirus group tumour gross weight is 90g, has significant difference (p＜0.01).
Can find out, compare with the contrast adenovirus, pDC312-miR-122, pDC312-8miR-122 adenovirus group liver cancer cell quantity and weight greatly reduce.
Embodiment 3, miR-122, contain the carrier of miR-122 encoding gene or contain the application of miR-122 encoding gene adenovirus carrier in vitro inhibition hbv replication ability
One, the application of miR-122 in the inhibition HBV replication ability
Transfection is inoculated into 6 orifice plates with the HepG2 cell the day before yesterday, and during transfection, cell degree of converging reaches 70% left and right, carries previous hour with substratum and changes opti-MEM(life technologies catalog number into: 31985070).
MiR-122 group: miR-122 and plasmid pHBV1.3 are adopted lipo2000 cotransfection HepG2 cell, obtain HepG2 cell/miR-122; Transfection ratio the best of RNA and pHBV1.3 replicability plasmid is volume and mass ratio 2.5ul:1ug, and the 4-6 hour cell is washed three times with PBS, and changes the full substratum of DMEM of 2ml10%FBS into.
Negative control group: adopting uses the same method adopts l ipo2000 cotransfection HepG2 cell with miR-122 negative control RNA and pHBV1.3 replicability plasmid, obtains HepG2 cell/miR-122 negative control RNA.
After transfection 24,48,72h detects in secretion, supernatant liquor DNA copy number and the 24h born of the same parents of HBsAg HBsAg and HBeAg in HepG2 cell/miR-122 in each group and HepG2 cell/miR-122 negative control RNA culture supernatant hbv replication intermediate in pgRNA, totalRNA expression level and born of the same parents.
1) HBsAg HBsAg(HBVs antigen levels) and the HBeAg(HBVe antigen levels) detect
The secretion of HBsAg HBsAg and HBeAg in the HepG2 cell/miR-122 that detect respectively after transfection 24,48,72h obtains and the cell culture supernatant of HepG2 cell/miR-122 negative control RNA, the detection kit that adopts be HBsAg and e antigen detection kit available from Shanghai Kehua Bio-engineering Co., Ltd, detection method is carried out to specifications;
Result as shown in Figure 6A, after transfection 24,48, in the HepG2 cell that obtains of 72h/miR-122 cell culture supernatant, the OD450 of HBV s antigen levels is respectively 0.045,0.1,0.16;
After transfection 24,48, in the HepG2 cell that obtains of 72h/miR-122 negative control RNA culture supernatant, the OD450 of HBVs antigen levels is respectively 0.08,0.21,0.34;
After transfection 24,48, in the HepG2 cell that obtains of 72h/miR-122 culture supernatant, the OD450 of HBV e antigen levels is respectively 0.04,0.09,0.12;
After transfection 24,48, in the HepG2 cell that obtains of 72h/miR-122 negative control RNA culture supernatant, the OD450 of HBV e antigen levels is respectively 0.075,0.19,0.28;
Can find out, miR-122 can significantly suppress the secretion of HBsAg HBsAg and HBeAg.
2) supernatant liquor HBV DNA copy number detects
Detect respectively HBV DNA copy number in 48h obtains after transfection HepG2 cell/miR-122 and HepG2 cell/miR-122 negative control RNA cell culture supernatant.
Supernatant DNA copy number detection method: respectively collect 200ul supernatant substratum during 48h, room temperature 12000rpm, the centrifugal removal cell debris of 2min adds the Mgcl of 10mM
2, the DNAase I of 100UI/ml, 37 ℃ digested 3 hours, added 1%SDS, 55 ℃ of digestion of the Proteinase K of 0.5mg/ml 2 hours, phenol 1:1 extracting, the ethanol precipitation is spent the night, and high speed centrifugation dries, 50ul H
2The O dissolving, the RT-PCR detection by quantitative as negative control, determines that the plasmid digestion of transfection is clean to the sample that does not pass through protease K digesting, can not disturb the detection by quantitative result.Detect primer synthetic in invitrogen company.
The concrete sequence of primer is as follows:
forward：5’-CTCCCCGTCTGTGCCTTCTC-3’
reverse：5’-TCGGTCGTTGACATTGCTGA-3’
Result is as shown in Fig. 6 B, and HepG2 cell/miR-122 supernatant liquor HBV DNA copy number is 4.5 * 10
5HepG2 cell/miR-122 negative control RNA culture supernatant HBV DNA copy number is 1.22 * 10
6Can find out, miR-122 can significantly suppress supernatant liquor HBV DNA copy number, thereby reflects that it can suppress the secretion of HBV virion in supernatant.
3) in born of the same parents, the HBV transcriptional level detects
The trizol reagent that adds 1ml in 6 orifice plate hole, cracking 5min, be drawn in the import EP pipe of 1.5ml, the chloroform that adds 200ul to pollute without the RNA enzyme, mixing 15s, 4 ℃ of centrifugal 15min of 13000rpm, draw supernatant and transfer in a new 1.5ml import EP pipe, add 500ul Virahol-20 a ℃ precipitation to spend the night, 4 ℃ of centrifugal 10min of 13000rpm, outwell supernatant, 75% washing with alcohol with the preparation of DEPC water precipitates once, dries 50ul DEPC water dissolution, to specifications, reverse transcription obtains cDNA as the quantitative template of RT-PCR.
The RT-PCR detection by quantitative, detect primer synthetic in invitrogen company:
PgRNA(is the primer of HBV conservative fragments)
forword：5’-TCTTGCCTTACTTTTGGAAG-3’；
reverse：5’-AGTTCTTCTTCTAGGGGACC-3’；
Total RNA(is the primer of HBV conservative fragments)
forward：5’-CTCCCCGTCTGTGCCTTCTC-3’；
reverse：5’-TCGGTCGTTGACATTGCTGA-3’
The GAPDH(internal reference) forword:5 '-GGTGAAGGTCGGTGTGAACG-3 ';
GAPDH?reverse：5’-CTCGCTCCTGGAAGATGGTG-3’；
Result is as shown in Fig. 6 D, and HBV pgRNA relative expression quantity is 0.35 in HepG2 cell/miR-122 born of the same parents, HBV totalRNA relative expression quantity is 0.45;
HBV pgRNA relative expression quantity is 1 in HepG2 cell/miR-122 negative control RNA, HBV total RNA relative expression quantity is 1;
Can find out, miR-122 can significantly reduce HBV transcriptional level in born of the same parents.
4) detection of hbv replication intermediate in born of the same parents
Southern detects hbv replication intermediate in born of the same parents: 48h HepG2 cell/miR-122 after transfection in 6 orifice plates and HepG2/ negative control RNA1 are collected in the 1.5ml centrifuge tube, adopt whole blood/tissue gene group to extract test kit (TianGen) and extract intracellular total DNA, and measure DNA concentration and purity with ultraviolet spectrophotometer OD260 and OD280,1% agarose gel electrophoresis, adopt GE southern test kit to detect the hbv replication intermediate, detection method sees the test kit specification sheets for details.
Result can find out as shown in Fig. 6 C, and transfection miR-122 can obviously reduce the hbv replication intermediate.
The hbv replication intermediate of HepG2 cell/miR-122 obviously reduces, and rcDNA and ssDNA band naked eyes are hardly as seen.
The hbv replication intermediate band gray scale of HepG2 cell/miR-122 negative control RNA is darker, and concentration is high.。
Can find out from the above results, miR-122 can significantly suppress the secretion (in supernatant, the copy number of virus has just represented the number of virion) of HBsAg, HBeAg and supernatant HBV virion, in born of the same parents, the HBV transcriptional level descends, and in born of the same parents, the hbv replication intermediate is significantly lowered.
Two, contain structure and the application in the inhibition HBV replication ability thereof of miR-122 encoding gene expression vector
1, contain miR-122 encoding gene expression vector pSuper-miR-122 plasmid construction
The encoding gene of miR-122 precursor, its nucleotides sequence are classified the sequence 3 in sequence table as, after the precursor of this genes encoding miR-122, obtain ripe miR-122 through shearing, and the nucleotides sequence of ripe miR-122 is classified the sequence 1 in sequence table as.DNA molecular shown in sequence 3 is inserted mammalian expression vector pSuper(Int J Cancer.2010Oct1; 127 (7): 1507-16.doi:10.1002/ijc.25159.RNAi-mediated downregulation of uPAR synergizes with targeting of HER2through the ERK pathway in breast cancer cells.; The public can obtain from Institute of Microorganism, Academia Sinica) EcoRI and the XhoI restriction enzyme site between, obtain recombinant plasmid pSuper-miR-122, for containing miR-122 encoding gene carrier.
2, the application of pSuper-miR-122 plasmid in inhibition HBV replication
Transfection is inoculated into 6 orifice plates with HepG2 the day before yesterday, and during transfection, cell degree of converging reaches 90-95%, carries previous hour and changes substratum into opti-MEM.
PSuper-miR-122 group: plasmid pSuper-miR-122 and pHBV1.3 replicability plasmid are adopted lipo2000 cotransfection HepG2 cell, obtain HepG2 cell/pSuper-miR-122; Transfection ratio the best of two plasmids is mass ratio 1:1, and the 4-6 hour cell is washed three times with PBS, and changes the full substratum of DMEM of 2ml10%FBS into.
Negative control group: adopting uses the same method adopts lipo2000 cotransfection HepG2 cell with empty carrier pSuper and pHBV1.3 replicability plasmid, obtains HepG2 cell/pSuper.
1) HBsAg HBsAg(HBV s antigen levels) and HBeAg(HBV e antigen levels) detect
The secretion of HBsAg HBsAg and HBeAg in the HepG2 cell/pSuper-miR-122 that detect after transfection 24,48,72h obtains and HepG2 cell/pSuper culture supernatant, detection method same 1).
Result is as shown in Fig. 7 A and 7B, after transfection 24,48, in the HepG2 cell that obtains of 72h/pSuper-miR-122 culture supernatant, the OD450 of HBV s antigen levels is respectively 0.3,0.62,0.8;
After transfection 24,48, in the HepG2 cell that obtains of 72h/pSuper culture supernatant, the OD450 of HBVs antigen levels is respectively 0.4,0.8,1.15;
After transfection 24,48, in the HepG2 cell that obtains of 72h/pSuper-miR-122 culture supernatant, the OD450 of HBV e antigen levels is respectively 0.12,0.26,0.45;
After transfection 24,48, in the HepG2 cell that obtains of 72h/pSuper culture supernatant, the OD450 of HBV e antigen levels is respectively 0.2,0.4,0.62.
2) supernatant liquor HBV DNA copy number detects
Detect respectively 48h obtains after transfection HepG2 cell/pSuper-miR-122 and HepG2 cell/pSuper culture supernatant HBV DNA copy number, detection method same 2).
Result is as shown in Fig. 7 C, and HepG2 cell/pSuper-miR-122 supernatant liquor HBV DNA copy number is 3.25 * 10
5HepG2 cell/pSuper culture supernatant HBV DNA copy number is 5.24 * 10
5
3) in born of the same parents, the HBV transcriptional level detects
Detect after transfection that in 48h HepG2 cell/pSuper-miR-122 and HepG2 cell/pSuper born of the same parents, the HBV transcriptional level detects, detection method same 3).
Result is as shown in Fig. 7 D, and HBV pgRNA relative expression quantity is 0.54 in HepG2 cell/pSuper-miR-122 born of the same parents, HBV total RNA relative expression quantity is 0.62;
HBV pgRNA relative expression quantity is 1 in HepG2 cell/pSuper, HBV total RNA relative expression quantity is 1;
Can find out from the above results, the interior HBV transcriptional level of secretion, born of the same parents that miR-122 expression vector pSuper-miR-122 can significantly suppress HBsAg and supernatant HBV virion descends.
Three, contain the structure of adenovirus expression carrier pDC312-miR-122, pDC312-8miR-122 of miR-122 encoding gene and the application in inhibition HBV replication thereof
Transfection is inoculated into 6 orifice plates with HepG2 the day before yesterday, and during transfection, cell degree of converging reaches 90-95%, carries previous hour and changes substratum into opti-MEM.
PDC312-miR-122 group: plasmid pDC312-miR-122 and pHBV1.3 replicability plasmid are adopted lipo2000 cotransfection HepG2 cell, obtain HepG2 cell/pDC312-miR-122; 2 plasmid transfection ratio the bests are mass ratio 1:1, and the 4-6 hour cell is washed three times with PBS, and change the full substratum of DMEM of 2ml10%FBS into.
The pDC312-8miR-122 group: adopting uses the same method adopts lipo2000 cotransfection HepG2 cell with plasmid pDC312-8miR-122 and pHBV1.3 replicability plasmid, obtains HepG2 cell/pDC312-8miR-122.
Negative control group: adopting uses the same method adopts lipo2000 cotransfection HepG2 cell with empty carrier pDC312-cmv, obtains HepG2 cell/pDC312-cmv.
1) HBsAg HBsAg(HBV s antigen levels) and HBeAg(HBV e antigen levels) detect
Detect the secretion of HBsAg HBsAg and HBeAg in 48h obtains after transfection HepG2 cell/pDC312-miR-122, HepG2 cell/pDC312-8miR-122 and HepG2 cell/pDC312-cmv culture supernatant, detection method same 1).
Result is as shown in Fig. 8 A and 8B, and in the HepG2 cell that after transfection, 48h obtains/pDC312-miR-122 culture supernatant, the OD450 of the OD450 of HBV s antigen levels and HBV e antigen levels is respectively 0.5 and 0.32;
In the HepG2 cell that after transfection, 48h obtains/pDC312-8miR-122 culture supernatant, the OD450 of the OD450 of HBV s antigen levels and HBV e antigen levels is respectively 0.25 and 0.15;
In the HepG2 cell that after transfection, 48h obtains/pDC312-cmv culture supernatant, the OD450 of HBVs antigen levels and the OD450 of HBVe antigen levels are respectively 0.73 and 0.5;
2) supernatant liquor HBV DNA copy number detects
Detect respectively 48h obtains after transfection HepG2 cell/pDC312-miR-122, HepG2 cell/pDC312-8miR-122 and HepG2 cell/pDC312-cmv culture supernatant HBV DNA copy number, detection method same 2 2).
Result is as shown in Fig. 8 C, and HepG2 cell/pDC312-miR-122 supernatant liquor HBV DNA copy number is 3.5 * 10
5HepG2 cell/pDC312-8miR-122 culture supernatant HBV DNA copy number is 2.0 * 10
5HepG2 cell/pDC312-cmv culture supernatant HBV DNA copy number is 5.2 * 10
5
3) in born of the same parents, the HBV transcriptional level detects
Detect after transfection that in 48h HepG2 cell/pDC312-miR-122, HepG2 cell/pDC312-8miR-122 and HepG2 cell/pDC312-cmv born of the same parents, the HBV transcriptional level detects, detection method same 2 3).
Result is as shown in Fig. 8 D, and HBV pgRNA relative expression quantity is 0.62 in HepG2 cell/pDC312-miR-122 born of the same parents, HBV total RNA relative expression quantity is 0.54;
HBV pgRNA relative expression quantity is 0.31 in HepG2 cell/pDC312-8miR-122, HBV total RNA relative expression quantity is 0.22;
HBV pgRNA relative expression quantity is 1 in HepG2 cell/pDC312-cmv, HBV total RNA relative expression quantity is 1;
Can find out from the above results, MiR-122 adenovirus expression carrier pDC312-miR-122, pDC312-8miR-122 can significantly suppress the secretion of HBsAg and supernatant HBV virion, and in born of the same parents, the HBV transcriptional level descends.
Embodiment 4, miR-122, the application of adenovirus carrier in suppressing liver cancer cell HepG2 propagation that contains miR-122 encoding gene expression vector or contain the miR-122 encoding gene
One, the application of miR-122 in suppressing liver cancer cell HepG2 propagation
Transfection is inoculated into 6 orifice plates with HepG2 the day before yesterday, and during transfection, cell degree of converging reaches 60-70%, carries previous hour and changes substratum into opti-MEM.
MiR-122 organizes (miR-122+pHBV1.3): miR-122 and pHBV1.3 replicability plasmid are adopted lipo2000 cotransfection HepG2 cell, obtain HepG2 cell/miR-122; Transfection ratio the best of RNA and plasmid is mass ratio 3ul:1ug, and the 4-6 hour cell is washed three times with PBS, and changes the full substratum of DMEM of 2ml10%FBS into.
Negative control group (contrast+pHBV1.3): adopt and use the same method adopting lipo2000 cotransfection HepG2 cell with pHBV1.3 replicability plasmid, obtain HepG2/ negative control RNA1.
Transfection the next morning heavily spreads 96 orifice plates with the cell dissociation counting, a porocyte is 2000, three repeating holes are set, and after transfection 24,48,72h, liquid 100ul10%FBS is changed in every hole, DMEM, add the CCK8 (Dojindo, Kumamoto, Japan) of 10ul to hatch 2h in the different time periods respectively again, the 450nm microplate reader detects light absorption value, detects respectively 24,48,72h cell proliferation.
Result as shown in Figure 9, after (miR-122+pHBV1.3) transfection of miR-122 group 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.167,0.34,0.6,1.2;
(contrast+pHBV1.3) after transfection 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.18,0.42,0.8,1.57 to negative control group;
Can find out, after miR-122 and pHBV1.3 cotransfection liver cancer cell HepG2, CCK8 detects and can suppress cell proliferation.
Two, contain the application of pSuper-miR-122 expression vector in suppressing HepG2 cell proliferation of miR-122 encoding gene
Transfection is inoculated into 6 orifice plates with HepG2 the day before yesterday, and during transfection, cell degree of converging reaches 90-95%, carries previous hour and changes substratum into opti-MEM.
PSuper-miR-122 organizes (pSuper-miR122+pHBV1.3): pSuper-miR-122 and pHBV1.3 replicability plasmid are adopted lipo2000 cotransfection HepG2 cell, obtain HepG2/pSuper-miR-122; Transfection ratio the best of plasmid is mass ratio 1:1, and the 4-6 hour cell is washed three times with PBS, and changes the full substratum of DMEM of 2ml10%FBS into.
Negative control group (pSuper+pHBV1.3): adopting uses the same method adopts lipo2000 cotransfection HepG2 cell with pSuper and pHBV1.3 replicability plasmid, obtains HepG2/pSuper.
Transfection the next morning heavily spreads 96 orifice plates with the cell dissociation counting, a porocyte is 2000, three repeating holes are set, and after transfection 24,48,72h, liquid 100ul10%FBS is changed in every hole, DMEM, add the CCK8 (Dojindo, Kumamoto, Japan) of 10ul to hatch 2h in the different time periods respectively again, the 450nm microplate reader detects light absorption value, detects respectively 24,48,72h cell proliferation.
Result as shown in figure 10, after (pSuper-miR-122+pHBV1.3) transfection of pSuper-miR-122 group 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.154,0.37,0.53,0.9;
After negative control group (pSuper+pHBV1.3) transfection 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.16,0.43,0.69,1.2;
Can find out, after pSuper-miR122 and pHBV1.3 cotransfection liver cancer cell HepG2, CCK8 detects and can suppress cell proliferation.
Three, contain adenovirus expression carrier pDC312-miR-122, the pDC312-8miR-122 application in suppressing HepG2 cell proliferation of miR-122 encoding gene
Transfection is inoculated into 6 orifice plates with HepG2 the day before yesterday, and during transfection, cell degree of converging reaches 90-95%, carries previous hour and changes substratum into opti-MEM.
PDC312-miR-122 group: pDC312-miR-122 and pHBV1.3 replicability plasmid are adopted lipo2000 cotransfection HepG2 cell, obtain HepG2/pDC312-miR-122; Transfection ratio the best of plasmid is mass ratio 1:1, and the 4-6 hour cell is washed three times with PBS, and changes the full substratum of DMEM of 2ml10%FBS into.
The pDC312-8miR-122 group: adopting uses the same method adopts lipo2000 cotransfection HepG2 cell with pDC312-8miR-122 and pHBV1.3 replicability plasmid, obtains HepG2/pDC312-8miR-122.
The pDC312-cmv group; Adopting uses the same method adopts lipo2000 cotransfection HepG2 cell with pDC312-cmv and pHBV1.3 replicability plasmid, obtains HepG2/pDC312-cmv.
Transfection the next morning heavily spreads 96 orifice plates with the cell dissociation counting, a porocyte is 2000, three repeating holes are set, and after transfection 24,48,72h, liquid 100ul10%FBS is changed in every hole, DMEM, add the CCK8 (Dojindo, Kumamoto, Japan) of 10ul to hatch 2h in the different time periods respectively again, the 450nm microplate reader detects light absorption value, detects respectively 24,48,72h cell proliferation.
Result as shown in figure 11, after the transfection of pDC312-miR-122 group 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.22,0.57,0.79,1.31;
After the transfection of pDC312-8miR-122 group 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.25,0.5,0.65,1.12;
After the transfection of pDC312- cmv group 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.24,0.62,0.98,1.56;
Can find out, pDC312-miR-122, pDC312-8miR-122 can suppress cell proliferation.
Embodiment 5, miR-122 inhibitor and related application
One, the application of miR-122 inhibitor in promoting the hbv replication ability
1, miR-122 inhibitor and negative control RNA's is synthetic
MiR-122 inhibitor and negative irrelevant synthetic to impinging upon the sharp rich bio tech ltd in Guangzhou, the nucleotide sequence of miR-122 inhibitor is that a length is 22 Nucleotide, the sequence of miR-122 inhibitor is as shown in the sequence 2 of sequence table.
MiR-122 inhibitor negative control RNA available from the sharp rich bio tech ltd in Guangzhou (product information:
Essential information: people, mouse, the general miRNA inhibitor Ncontrol#22 of rat
Ripe miRNA title: cel-miR-239b-5p
Ripe miRNA numbering: MIMAT0000295
Ripe miRNA sequence: UUUGUACUACACAAAAGUACUG)
2, the application of miR-122 inhibitor in promoting the hbv replication ability
MiR-122 inhibitor group: miR-122 inhibitor and pHBV1.3 replicability plasmid are adopted lipo2000 cotransfection HepG2 cell, obtain HepG2 cell/miR-122 inhibitor.
Negative control group: adopting uses the same method adopts lipo2000 cotransfection HepG2 cell with miR-122 inhibitor negative control RNA and pHBV1.3 replicability plasmid, obtains HepG2/miR-122 inhibitor negative control RNA.
1) HBsAg HBsAg(HBV s antigen levels) and HBeAg(HBV e antigen levels) detect
The secretion of HBsAg HBsAg and HBeAg in the HepG2 cell that detect after transfection 24,48,72h obtains/miR-122 inhibitor and HepG2/miR-122 inhibitor negative control RNA culture supernatant, detection method with embodiment 3 one 1).
Result is as shown in Figure 12 A, after transfection 24,48, in the HepG2 cell that obtains of 72h/miR-122 inhibitor culture supernatant, the OD450 of HBV s antigen levels is respectively 0.12,0.46,0.92;
After transfection 24,48, in the HepG2/miR-122 inhibitor negative control RNA culture supernatant that obtains of 72h, the OD450 of HBV s antigen levels is respectively 0.07,0.12,0.35;
After transfection 24,48, in the HepG2 cell that obtains of 72h/miR-122 inhibitor culture supernatant, the OD450 of HBV e antigen levels is respectively 0.12,0.45,0.88;
After transfection 24,48, in the HepG2/miR-122 inhibitor negative control RNA culture supernatant that obtains of 72h, the OD450 of HBV e antigen levels is respectively 0.05,0.13,0.32;
Can find out, the miR-122 inhibitor can significantly improve the secretion of HBsAg HBsAg and HBeAg.
2) supernatant liquor HBV DNA copy number detects
Detect respectively the HepG2 cell that 48h obtains after transfection/miR-122 inhibitor and contrast transfection HepG 2 cell 2 culture supernatant HBV DNA copy numbers, detection method with embodiment 3 one 2).
Result is as shown in Figure 12 B, and HepG2 cell/miR-122 inhibitor supernatant liquor HBV DNA copy number is 8.8 * 10
5HepG2/miR-122 inhibitor negative control RNA culture supernatant HBV DNA copy number is 1.8 * 10
5Can find out, the miR-122 inhibitor can significantly improve supernatant liquor HBV DNA copy number, thereby reflects that it can improve the secretion of HBV virion in supernatant.
3) in born of the same parents, the HBV transcriptional level detects
Detect after transfection that in 48h HepG2 cell/miR-122 inhibitor and HepG2/ negative control RNA2 born of the same parents, the HBV transcriptional level detects, detection method with embodiment 3 one 3).
Result is as shown in Figure 12 D, and HBV pgRNA relative expression quantity is 1.75 in HepG2 cell/miR-122 inhibitor born of the same parents, HBVtotal RNA relative expression quantity is 1.6;
HBV pgRNA relative expression quantity is 1 in HepG2/miR-122 inhibitor negative control RNA, HBV total RNA relative expression quantity is 1;
Can find out, the miR-122 inhibitor can significantly improve HBV transcriptional level in born of the same parents.
4) detection of hbv replication intermediate in born of the same parents
Adopt embodiment 3 one 4) method detect 48h HepG2 cell/miR-122 inhibitor and HepG2/ negative control RNA2 after transfection.
Result as shown in Figure 12 C,
The hbv replication intermediate of HepG2 cell/miR-122 inhibitor obviously increases, and band brightness is high;
The hbv replication intermediate of HepG2/miR-122 inhibitor negative control RNA is relatively few, rcDNA, and the ssDNA band is very light.
Can find out from the above results, the miR-122 inhibitor can significantly promote the secretion of HBsAg and supernatant HBV virion, and in born of the same parents, the HBV transcriptional level increases, and in born of the same parents, the hbv replication intermediate significantly raises.
Two, the application of miR-122 inhibitor in promoting liver cancer cell Huh7 propagation
Transfection is inoculated into 6 orifice plates with Huh7 the day before yesterday, and during transfection, cell degree of converging reaches 60-70%, carries previous hour and changes substratum into opti-MEM.
The miR-122 inhibitor (the miR-122 inhibitor+pHBV1.3): miR-122 inhibitor and pHBV1.3 replicability plasmid are adopted lipo2000 cotransfection Huh7 cell, obtain the Huh7/miR-122 inhibitor; Transfection ratio the best of RNA and plasmid is mass ratio 3ul:1ug, and the 4-6 hour cell is washed three times with PBS, and changes the full substratum of DMEM of 2ml10%FBS into.
Negative control group (contrast+pHBV1.3): adopting uses the same method adopts lipo2000 cotransfection HepG2 cell with miR-122 inhibitor negative control RNA and pHBV1.3 replicability plasmid, obtains Huh7/ negative control RNA2.
Transfection the next morning heavily spreads 96 orifice plates with the cell dissociation counting, a porocyte is 2000, three repeating holes are set, and after transfection 24,48,72h, liquid 100ul10%FBS is changed in every hole, DMEM, add the CCK8 (Dojindo, Kumamoto, Japan) of 10ul to hatch 2h in the different time periods respectively again, the 450nm microplate reader detects light absorption value, detects respectively 24,48,72h cell proliferation.
Result as shown in figure 13, the miR-122 inhibitor is (after the transfection of miR-122 inhibitor+pHBV1.3) 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.19,0.6,1.2,1.89;
(contrast+pHBV1.3) after transfection 0,24,48, after 72h, the light absorption value of OD450 is respectively 0.21,0.5,1,1.5 to negative control group;
Can find out, after miR-122 inhibitor and pHBV1.3 cotransfection liver cancer cell Huh7 cell, CCK8 detects and can promote cell proliferation.
Claims (10)
1. a recombinant adenoviral vector, be the recombinant adenoviral vector that obtains at least one encoding gene insertion pDC312-cmv adenovirus carrier with miR-122;
Described miR-122 is the RNA of the RNA shown in sequence 1 in sequence table or 3 codings of the sequence in sequence table.
2. recombinant adenoviral vector according to claim 1 is characterized in that:
Described recombinant adenoviral vector is following 1) or 2):
1) described recombinant adenoviral vector inserts for 1 encoding gene with described miR-122 the carrier that obtains between the multiple clone site of pDC312-cmv adenovirus carrier;
2) described recombinant adenoviral vector inserts for 8 encoding genes with described miR-122 the carrier that obtains between the multiple clone site of pDC312-cmv adenovirus carrier.
3. recombinant adenoviral vector according to claim 1 and 2 is characterized in that:
The nucleotides sequence of the encoding gene of described miR-122 is classified the sequence 3 in sequence table as;
The nucleotides sequence of 8 encoding genes of described miR-122 is classified the sequence 4 in sequence table as.
4. according to claim 2 or 3 described recombinant adenoviral vectors is characterized in that:
1) described recombinant adenoviral vector is for inserting DNA molecular shown in the sequence 3 in sequence table in the carrier that obtains between the multiple clone site of pDC312-cmv adenovirus carrier;
2) described recombinant adenoviral vector is for inserting DNA molecular shown in the sequence 4 in sequence table in the carrier that obtains between the multiple clone site of pDC312-cmv adenovirus carrier.
5. recombinant adenovirus is for changing arbitrary described recombinant adenoviral vector in claim 1-4 over to host cell, the adenovirus that is packaged to be; Described host cell is specially HEKC.
6.miR-122 have following 1 in preparation) and/or 2) application in the product of function:
1) prevent and/or treat tumour;
2) reduce tumour quantity and/or tumor weight;
Described miR-122 is the RNA of the RNA shown in sequence 1 in sequence table or 3 codings of the sequence in sequence table.
7. in claim 1-4, arbitrary described recombinant adenoviral vector has following 1 in preparation)-7) in application in the product of at least a function:
1) prevent and/or treat tumour;
2) reduce tumour quantity and/or tumor weight;
3) suppress hepatitis B virus HBsAg antigen and/or HBeAg antigen presentation;
4) suppress the hepatitis B virus DNA copy;
5) suppress hepatocellular HBcAg antigen presentation;
6) suppressing hepatitis B virus transcribes;
7) inhibition tumor cell propagation.
8. recombinant adenovirus claimed in claim 5 has following 1 in preparation)-5) in application in the product of at least a function:
1) prevent and/or treat tumour;
2) reduce tumour quantity and/or tumor weight;
3) suppress hepatitis B virus HBsAg antigen presentation;
4) suppress the hepatitis B virus DNA copy;
5) suppress hepatocellular HBcAg antigen presentation.
9. arbitrary described application according to claim 6-8 is characterized in that:
Described tumour is liver cancer;
Described tumour cell is liver cancer cell.
10. arbitrary described application according to claim 6-9, it is characterized in that: described product is medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310013896.2A CN103088061B (en) | 2013-01-15 | 2013-01-15 | A kind of RNA and carrier application in preparation prevention and/or treatment hepatocarcinoma product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310013896.2A CN103088061B (en) | 2013-01-15 | 2013-01-15 | A kind of RNA and carrier application in preparation prevention and/or treatment hepatocarcinoma product |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103088061A true CN103088061A (en) | 2013-05-08 |
| CN103088061B CN103088061B (en) | 2016-08-03 |
Family
ID=48201189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310013896.2A Active CN103088061B (en) | 2013-01-15 | 2013-01-15 | A kind of RNA and carrier application in preparation prevention and/or treatment hepatocarcinoma product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103088061B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103436555A (en) * | 2013-08-30 | 2013-12-11 | 浙江大学 | Construction method and application of adipose-derived mesenchymal stem cells (AMSC) carrying miR-122 |
| CN104645351A (en) * | 2015-01-26 | 2015-05-27 | 中南大学湘雅医院 | Application of hsa-miR-487a in preparation of medicine for treating or preventing liver cancer after operation |
| WO2015104706A1 (en) * | 2014-01-08 | 2015-07-16 | Hadasit Medical Research Services And Development Ltd. | Mir-122* as an active micro-rna, compositions comprising the same and uses thereof |
| CN106267237A (en) * | 2016-10-09 | 2017-01-04 | 四川大学 | A kind of genomic medicine treating hepatocarcinoma and metabolism disorder |
| CN113186224A (en) * | 2021-04-29 | 2021-07-30 | 中国人民解放军陆军军医大学士官学校 | MicroRNA-27a with hepatitis B virus replication inhibition activity and application thereof |
| TWI792124B (en) * | 2019-12-18 | 2023-02-11 | 臺北榮民總醫院 | Animal model for hepatocellular carcinoma and uses thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101050470A (en) * | 2007-03-22 | 2007-10-10 | 中山大学 | Recombining adenovirus carrier of carrying reverse transcriptase of telomere enzyme of rats |
| CN101076592A (en) * | 2004-10-12 | 2007-11-21 | 洛克菲勒大学 | Micro rna |
| EP2311499A1 (en) * | 2004-09-29 | 2011-04-20 | Oncolys BioPharma, Inc. | Telomelysin-GFP gene-containing recombinant virus |
-
2013
- 2013-01-15 CN CN201310013896.2A patent/CN103088061B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2311499A1 (en) * | 2004-09-29 | 2011-04-20 | Oncolys BioPharma, Inc. | Telomelysin-GFP gene-containing recombinant virus |
| CN101076592A (en) * | 2004-10-12 | 2007-11-21 | 洛克菲勒大学 | Micro rna |
| CN101050470A (en) * | 2007-03-22 | 2007-10-10 | 中山大学 | Recombining adenovirus carrier of carrying reverse transcriptase of telomere enzyme of rats |
Non-Patent Citations (8)
| Title |
|---|
| 《Journal of virology》 20121010 Junli Hao et al. Inhibition of alpha interferon(IFN-alpha)-induced microRNA-122 negatively the anti-hepatitis B virus efficiency of IFN-alpha 图3A 1-5 第87卷, 第1期 * |
| 《Journal of virology》 20121010 Junli Hao et al. Inhibition of alpha interferon(IFN-alpha)-induced microRNA-122 negatively the anti-hepatitis B virus efficiency of IFN-alpha 图3A 6-10 第87卷, 第1期 * |
| JUNLI HAO ET AL.: "Inhibition of alpha interferon(IFN-α)-induced microRNA-122 negatively the anti-hepatitis B virus efficiency of IFN-α", 《JOURNAL OF VIROLOGY》 * |
| WANG S ET AL.: "Loss of MicroRNA 122 expression in patients with hepatitis B enhances hepatitis B virus replication through cyclin G1-modulated P53 activity", 《HEPATOLOGY》 * |
| 张小勇等: "肝脏内源性microRNA调控乙型肝炎病毒基因的表达与复制", 《医学分子生物学杂志》 * |
| 朱蕾等: "miR-122对乙型肝炎病毒抗原表达的影响", 《浙江大学学报（医学版）》 * |
| 赵敏等: "肝癌组织miR-122的表达及其与细胞周期调控的关系", 《临床肿瘤学杂志》 * |
| 黄红艳: "转染MicroRNA-122类似物对肝癌细胞系HepG2增殖和凋亡的影响", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103436555A (en) * | 2013-08-30 | 2013-12-11 | 浙江大学 | Construction method and application of adipose-derived mesenchymal stem cells (AMSC) carrying miR-122 |
| CN103436555B (en) * | 2013-08-30 | 2015-12-02 | 浙江大学 | Carry the adipose-derived mescenchymal stem cell of miR-122 in the application preparing treating liver fibrosis preparation |
| WO2015104706A1 (en) * | 2014-01-08 | 2015-07-16 | Hadasit Medical Research Services And Development Ltd. | Mir-122* as an active micro-rna, compositions comprising the same and uses thereof |
| US10392617B2 (en) | 2014-01-08 | 2019-08-27 | Hadasit Medical Research Services And Development Ltd. | miR-122* as an active micro-RNA, compositions comprising the same and uses thereof |
| CN104645351A (en) * | 2015-01-26 | 2015-05-27 | 中南大学湘雅医院 | Application of hsa-miR-487a in preparation of medicine for treating or preventing liver cancer after operation |
| CN104645351B (en) * | 2015-01-26 | 2017-10-10 | 中南大学湘雅医院 | Application of Anti-hsa-miR-487a in preparation of medicine for treating liver cancer |
| CN106267237A (en) * | 2016-10-09 | 2017-01-04 | 四川大学 | A kind of genomic medicine treating hepatocarcinoma and metabolism disorder |
| TWI792124B (en) * | 2019-12-18 | 2023-02-11 | 臺北榮民總醫院 | Animal model for hepatocellular carcinoma and uses thereof |
| CN113186224A (en) * | 2021-04-29 | 2021-07-30 | 中国人民解放军陆军军医大学士官学校 | MicroRNA-27a with hepatitis B virus replication inhibition activity and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103088061B (en) | 2016-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103088061A (en) | Application of RNA and carrier in preparation of product for preventing and/or treating liver cancer | |
| Liu et al. | Role of microRNAs in hepatitis B virus replication and pathogenesis | |
| Snyder et al. | Vector design for liver-specific expression of multiple interfering RNAs that target hepatitis B virus transcripts | |
| CN102140458B (en) | SiRNA (Small interference ribonucleic acid) as well as medicine composition and pharmaceutical application thereof | |
| CN105647922A (en) | Application of CRISPR-Cas9 system based on new gRNA (guide ribonucleic acid) sequence in preparing drugs for treating hepatitis B | |
| CN102140461B (en) | Small interfering nucleic acid and medical composite and pharmaceutical applications of nucleic acid | |
| Ying et al. | Hepatitis B virus is inhibited by RNA interference in cell culture and in mice | |
| CN102083983A (en) | Small RNS interference target site sequences of hepatitis B virus and small interference RNAs and the compositions and uses thereof | |
| CN103329852B (en) | A kind of HBV persistent infection and fibrosis Establishment of mouse model | |
| CN102140459B (en) | SiRNA (Small interference ribonucleic acid) as well as medicine composition and pharmaceutical application thereof | |
| CN102140460A (en) | SiRNA (Small interference ribonucleic acid) as well as medicine composition and pharmaceutical application thereof | |
| Zhu et al. | Hepatitis B virus core protein variations differ in tumor and adjacent nontumor tissues from patients with hepatocellular carcinoma | |
| CN114632155B (en) | Application of PKA siRNA in preparation of medicine for treating novel coronavirus | |
| CN102206645A (en) | Mediating method of RNAi (ribonucleic acid interference) utilizing lentiviral vector | |
| CN102337263B (en) | siRNA (Small interfering ribonucleic acid) capable of inhibiting expression of enterovirus 71 type gene, composition and application | |
| Betty Mowa et al. | Efficient silencing of hepatitis B virus by helper-dependent adenovirus vector-mediated delivery of artificial antiviral primary Micro RNAs | |
| CN101979595B (en) | Dual expression vector for immunostimulatory RNA and HBV target gene silence RNA, construction and application thereof | |
| CN101954093A (en) | Hepatitis B nucleic acid vaccine and construction method thereof | |
| CN101671668A (en) | Hepatocellular carcinoma targeting gene expression element AG and applications thereof | |
| Zhou et al. | Establishment of a screening system for selection of siRNA target sites directed against hepatitis B virus surface gene | |
| CN108283646A (en) | Hsa-miRNA-155-5p is preparing the application in inhibiting human enterovirus 71 drug | |
| CN114008200A (en) | Compositions and methods for inhibiting hepatitis b virus proliferation | |
| CN104922697B (en) | Reduce pyridoxine phosphate oxidation enzyme treatment oophoroma | |
| CN113456798B (en) | Application of novel coronavirus SARS-CoV-2NSP13 gene | |
| EP3881850B1 (en) | Composition for inhibiting replication of hepatitis b virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |