CN101954093A - Hepatitis B nucleic acid vaccine and construction method thereof - Google Patents

Abstract

The invention relates to the technical field of biomedicines. The currently reported hepatitis B virus vaccine mainly comprises one or several of HBsAg, preS 1, preS2 and HBcAg, some cell factor genes with immunological enhancement function or lymphocyte epitope genes and the like, however, the immunoprophylaxis effect and treatment effect of the vaccine are always unsatisfactory. The invention provides a hepatitis B vaccine which comprises hepatitis B virus surface antigen gene HBsAg, core protein gene HBc and e-antigen gene, also comprises a human microRNA181a precursor gene sequence, and can assist stimulating the body immunity pathway. The construction process of the vaccine relates to PCR, enzyme cutting, connection, conversion and other molecularly biological operating means. The hepatitis B vaccine has the advantages of effectively activating the body to produce a specific antibody against the hepatitis B virus, stimulating body cell immunity and secreting various cell factors. Therefore, the aim of treating chronic hepatitis B is fulfilled.

Description

Hepatitis B nucleic acid vaccine and construction method thereof

Technical field

The invention belongs to field of biomedicine technology, be specifically related to a kind of dna vaccination and construction method thereof of new resisting HBV virus.

Background technology

Hepatitis B is a kind of global infectious disease that is caused by hepatitis B virus (HBV).China is that HBV infects the district occurred frequently, has 7-8 hundred million people to infect hepatitis B approximately, and about 1.2 hundred million people are hepatitis B virus carriers, and 1/4 among them develop into chronic hepatitis, liver cirrhosis or primary hepatocarcinoma.From 1985 I cross begin to inoculate Hepatitis B virus vaccine since, hepatitis B virus carriers is reduced to about 1% by 10% in immune child.Therefore facts have proved that Hepatitis B virus vaccine is prevention and the most effective weapon of control hepatitis B.

Hepatitis B virus is a hepadnavirus, has double-shell structure, and shell is made of hepatitis B virus surface antigen (HBsAg), pre-s1 protein (preS1), pre-s2 protein (preS2); Inner shell is made of hepatitis B virus core antigen (HBcAg) and e antigen (HBeAg); Double-stranded cyclic DNA and archaeal dna polymerase are arranged in the inner shell.

There is the hepatitis B virus vaccine of report mainly to comprise HBsAg, preS1, preS2 and HBcAg any one or several gene at present, add the cytokine gene that some have immunological enhancement, perhaps (Qing Y, et al.Construction of an HBV DNA vaccine byfusion of the GM-CSF gene to the HBV-S gene and examination of its immuneeffects in normal and HBV-transgenic mice.Vaccine.2010Jun11 such as lymphocyte epitopes gene; 28 (26): 4301-7.).But its immunoprophylaxis effect and therapeutic effect are unsatisfactory always, especially concerning the chronic HBV infection person, because long-term existence corresponding antigens in the body, body immune system has formed immune tolerance state for HBV antigen, therefore after it inoculated this vaccine, immunoreactivity was well below the normal person.Therefore the hepatitis B DNA vaccine is not very desirable for chronic viral hepatitis B patient's the immunologic tolerance and the effect of activation HBV specific T-cells immunity.

MicroRNA is subjected to paying close attention to widely as the popular molecule of biological study in recent years.MicroRNA has participated in the numerous post-transcriptional control processes of organism, plays a significant role in fields such as cell proliferation and differentiation, antitumor and immunity.There are some researches show that microRNA has participated in the regulation and control of the many immune paths of human body, fields such as cellular immunization and humoral immunization all play a significant role.MiRNA-181a can regulate the B cell differentiation, and can regulate CD4+T cell activation and sensitivity, therefore can be used as natural vaccine adjuvant (the Mark A.Lindsay.microRNAs and the immune response.Trends inImmunology that is used, Volume 29, Issue 7,343-351).

Summary of the invention

The object of the present invention is to provide and a kind ofly can activate humoral immunity of organism and cellular immunization simultaneously, immune effect is strong, and immunization is lasting, makes up the easy resisting HBV virus dna vaccination of technology.

As stated in the Background Art, there are many defectives in existing hepatitis B nucleic acid vaccine, if just therefore can directly connect vaccine adjuvant behind traditional nucleic acid vaccine can improve its immune effect.Based on above theory, the inventor uses the Protocols in Molecular Biology means, surface antigen, cAg and the e antigen gene of HBV virus are cloned into carrier for expression of eukaryon, and add the vaccine adjuvant of miRNA181a precursor fragment thereafter, thereby make up a kind of novel hepatitis B DNA vaccine that had not only contained antigenic protein gene but also contained vaccine adjuvant as the enhance immunity effect.

The invention provides a kind of hepatitis B nucleic acid vaccine, is basic framework with the carrier for expression of eukaryon, contains hepatitis B viruses (HBV) envelope protein gene HBsAg, hepatitis B virus core antigen HBc and e antigen gene; The pre-miR181a sequence that also contains the people, wherein the nucleotide sequence of hepatitis B viruses (HBV) envelope protein gene HBsAg shown in SEQ ID NO:1, the nucleotide sequence of hepatitis B virus core antigen HBc and e antigen gene is shown in SEQ ID NO:2; People's pre-miR181a sequence is shown in SEQ ID NO:5.

Described carrier for expression of eukaryon is the eukaryon expression plasmid pcDNA of Invitrogen company ^TM3.1/V5-His B.

The present invention also provides the construction method of above-mentioned hepatitis B nucleic acid vaccine, comprises following steps:

A, hepatitis b virus hbv envelope antigen, hepatitis B virus core antigen HBc and e antigen gene and people miR181a precursor-gene clone

(I) be template with the full genome of HBV, the design primer obtains HBV SDNA fragment by PCR reaction amplification, and primer sequence is as follows:

S-F：ATGGAGAGCACAACATCAGG

S-F：TCAAATGTATACCCAAAGACAAAAGA

(II) be template with the full genome of HBV, the design primer obtains HBV C antigen and the antigenic DNA sequence of e by PCR reaction amplification, and primer sequence is as follows:

C-F：ATGGACATTGACCCGTATAA

C-F：CTAACATTGAGATTCCCGAGAT

(III) be template with the THP-1 cellular genome, the design primer obtains the miR181a precursor by PCR reaction amplification, and primer sequence is as follows:

181F：TCGACTTGAAACCCAGAGAGG

181R：AATTCACTGGACCACATTTGG

B, above-mentioned hepatitis b virus hbv envelope antigen, hepatitis B virus core antigen HBc and e antigen gene and people miR181a precursor-gene are inserted same carrier for expression of eukaryon pcDNA ^TM3.1/V5-His B.

The present invention also provides above-mentioned hepatitis B nucleic acid vaccine being used for preparing the application for the treatment of hepatitis B medicament.

Hepatitis B nucleic acid vaccine of the present invention has the following advantages: the first, and this vaccine is by the inoculation of eukaryon expression plasmid mediation injection system, and is safe and reliable; The second, this vaccine can act on humoral immunity of organism and cellular immunization simultaneously, and immune effect is better; The 3rd because complete surface antigen, cAg and the e antigen of this vaccine clonal expression HBV virus, so its immune effect and to the protection of body apparently higher than polyepitope vaccines; The 4th, this vaccine is carrier with the eukaryon expression plasmid, long-term expression in vivo, and immune effect is lasting; The 5th, this vaccine self has comprised the microRNA adjuvant, does not need extra interpolation, simplifies processing technology.

Description of drawings

Fig. 1 is this nucleic acid vaccine pcDNA3.1-S-C-181a structural representation

Fig. 2 is HBV S antigen carrier for expression of eukaryon preparation flow figure

Fig. 3 is HBV cAg and e antigen carrier for expression of eukaryon preparation flow figure

Fig. 4 is pre-miR181a expression vector preparation flow figure

Fig. 5 is determined at HBsAg for the ELISPOT method and HBc stimulates this nucleic acid vaccine of back to activate situation for the mouse spleen cellular immunization, and wherein Fig. 5 a vertical coordinate represents per 10 ⁶Produce the cell number of INF-γ in the spleen, abscissa is represented group; Fig. 5 b vertical coordinate represents per 10 ⁶Produce the cell number of IL-4 in the spleen, abscissa is represented group.

The specific embodiment

Below in conjunction with drawings and Examples the present invention is described in detail, but embodiments of the invention only are used to the present invention is described and are not used in restriction protection scope of the present invention.

Embodiment 1: the structure of nucleic acid vaccine of the present invention

PCR that the present invention adopts, enzyme action, connection, conversion equimolecular biological experimental method constructed dna vaccine can be with reference to U.S.'s Sa nurse Brooker work " molecular cloning " second editions.The PCR primer-design software is the Primer PREMER V of Premier Biosoft International company.

The stock that makes up this vaccine comprises: Hep G 2.215 hepatoma carcinoma cell of person monocytic cell THP-1 (available from Chinese Academy of Sciences's cell bank), stable transfection HBV totivirus (available from Wuhan virus institute of the Chinese Academy of Sciences); Carrier for expression of eukaryon pcDNA ^TM3.1/V5-His B plasmid (available from Invitrogen company).

Making up this adjusts viral required reagent and comprises: Prime Star high-fidelity DNA polymerase (available from TaKaRa company), pMD18T cloning vehicle (available from TaKaRa company), various restricted enzyme (available from NEB company), T4 ligase (available from TaKaRa company), reverse transcription reagent M-MLV (available from Invitrogen company), RNA extracting Trizol reagent (available from Invitrogen company).

The basic step that makes up this vaccine comprises:

(1) HBV S antigen presentation preparing carriers

As shown in Figure 2, be template with the full genome of HBV, the design Auele Specific Primer obtains HBV S dna fragmentation by PCR reaction amplification, and nucleotide sequence is shown in SEQ ID NO:1.

Primer sequence is:

S-F：ATGGAGAGCACAACATCAGG

S-F：TCAAATGTATACCCAAAGACAAAAGA

The PCR reaction system is:

ddH ₂O 36μl

10×Prime?Star?Buffer 5μl

dNTPs 4μl

S-F 1μl

S-R 1μl

HBV genome 1.5 μ l

Prime Star enzyme 1.5 μ l

50μl

The PCR reaction condition is: 94 ℃ of pre-degeneration 5min; 94 ℃-30s, 55 ℃-30s, 72 ℃-1min, 30 circulations; Extend 7min after 72 ℃; 4 ℃ of preservations.

HBV S PCR product is carried out glue after by 1.5% agarose gel electrophoresis reclaim, obtain the HBVS dna fragmentation.This fragment is connected into cloning vehicle pMD18T, and linked system is:

HBV?S?DNA 18μl

pMD18T 1μl

Solution?I 1μl

20μl

To connect product after 16 ℃ of connections are spent the night and be transformed into Top10CaCl ₂In the competent cell,, entrust the order-checking of Invitrogen company through choosing the clone.After sequencing result to be determined is correct, determines to obtain HBV S antigen cloning vehicle T-S, and preserve this strain.

With T-S plasmid and carrier for expression of eukaryon pcDNA ^TM3.1/V5-His B reclaims postdigestive HBV S dna fragmentation and carrier pcDNA respectively with Kpn I and BamH I digestion with restriction enzyme ^TM3.1/V5-His B.The enzyme action system is:

ddH ₂O 49μl

T-S/pcDNA ^TM3.1 40μl

10×K?Buffer 5μl

KpnI 3μl

BamHI 3μl

100μl

16 ℃ of junction fragments of T4 ligase and carrier spend the night.To connect product and be transformed into Top10CaCl ₂Competent cell, picking monoclonal bacterium colony also carries out bacterium colony PCR and identifies and the enzyme action evaluation.Identify that successfully bacterium colony is preserved in the back, and called after pcDNA3.1-S.

(2) HBV C antigen and e antigen presentation preparing carriers

As shown in Figure 3, be template with the full genome of HBV, the design primer obtains HBV C antigen and the antigenic DNA sequence of e by the PCR reaction, and nucleotide sequence is shown in SEQ ID NO:2.

Primer sequence is:

C-F：ATGGACATTGACCCGTATAA

C-F：CTAACATTGAGATTCCCGAGAT

The PCR reaction system prepares with reference to HBV S dna fragmentation.The PCR reaction condition is 94 ℃ of pre-degeneration 5min; 94 ℃-30s, 53 ℃-30s, 72 ℃-1min, 30 circulations; Extend 7min after 72 ℃; 4 ℃ of preservations.

To connect into pMD18T after HBV C antigen and the recovery of the antigenic PCR product of e glue, linked system and condition are identical with HBV S antigen.Connect the product conversion after choose the clone, entrust the order-checking of Invitrogen company, and the correct clone that will check order protects bacterium and called after T-C.

With EcoR I and Xba I digestion with restriction enzyme T-C plasmid and HBV S antigen presentation carrier pcDNA3.1-S and empty carrier pcDNA ^TM3.1/V5-His B.The enzyme action system is:

ddH ₂O 44μl

T-C/pcDNA3.1-S/pcDNA3.1 40μl

10×M?Buffer 10μl

EcoRI 3μl

XbaI 3μl

100μl

37 ℃ of enzyme action spend the night, and the agarose gel with 1% reclaims the enzyme action product, and 16 ℃ of junction fragments of T4 ligase and carrier spend the night.The fragment and the carrier that connect are transformed into competent cell, choose the clone afterwards and carry out bacterium colony PCR evaluation and enzyme action evaluation, protect bacterium also difference called after pcDNA3.1-S-C and pcDNA3.1-C after evaluation is correct.

(3) miR181a precursor vaccine adjuvant expression vector establishment

As shown in Figure 4, by going up retrieval Sanger miRBase data base (http://www.mirbase.org), we obtain the precursor sequence of people's miR181a, shown in SEQ ID NO:3.This sequence is carried out human genome BLAST, its place gene locus is positioned, and extend about 200bp to its two flank and obtain the section of DNA sequence, shown in SEQ ID NO:4, according to this sequential design Auele Specific Primer:

181F：TCGACTTGAAACCCAGAGAGG

181R：AATTCACTGGACCACATTTGG

With reference to U.S. Sa nurse Brooker work " molecular cloning " second edition, extract the THP-1 cellular genome by phenol chloroform method, and be that template obtains the miR181a precursor by the PCR reaction with this genome.PCR reaction system and condition are as follows:

ddH ₂O 36μl

10×Prime?Star?Buffer 5μl

dNTPs 4μl

181F 1μl

181R 1μl

THP-1 cellular genome 1.5 μ l

Prime Star enzyme 1.5 μ l

50μl

The PCR reaction condition is: 94 ℃ of pre-degeneration 5min; 94 ℃-30s, 59 ℃-30s, 72 ℃-1min, 30 circulations; Extend 7min after 72 ℃; 4 ℃ of preservations.

The PCR product of miR181a is connected into the pMD18T carrier, and linked system and condition are as previously mentioned.To connect product and transform the order-checking evaluation of back trust Invitrogen company.Correct guarantor bacterium and called after T-181a check order.

With Hind III and Kpn I double digestion T-181a and pcDNA3.1-S-C plasmid, the enzyme action system is as follows:

ddH ₂O 44μl

T-181a/pcDNA3.1-S-C 40μl

10×M?Buffer 10μl

Hind?III 3μl

Kpn?I 3μl

100μl

The endonuclease reaction condition is 37 ℃, 4 hours.The enzyme action product is reclaimed the back connect, and transform by the T4 ligase.After choose the clone, bacterium colony PCR and enzyme action are identified, correct bacterium colony guarantor bacterium, called after pcDNA3.1-S-C-181a will be identified.

Embodiment 2: the zoopery of nucleic acid vaccine of the present invention

In order to verify that the present invention renders a service for the protection that HBV infects, the present invention has compared pcDNA3.1-S-C-181a, the antigenic pcDNA3.1-S of expression HBV S, expression HBV C antigen and the antigenic pcDNA3.1-C of the e difference for the mouse immune effect.

Laboratory mice be female 8 the week age Balb/C mice, 30, being divided into is 3 groups, 10 every group.Wherein one group of injection pcDNA3.1-S-C-181a injects pcDNA3.1-S for two groups, three groups of injection pcDNA3.1-C, and injection system is intramuscular injection, presses the injection volume of 0.1mg/ mice and implements.For the enhance immunity effect, be the center again with the injection orifice after the injection, with the vertical insertion of electric pulse electric shock, electrode needle is inserted and slightly is deeper than injection depth, and electric field intensity is 200v/cm, discharges 6 times, extracts electrode needle after 10 seconds.Carry out 3 immunity altogether, each immunity is 2 weeks at interval.Blood 10 μ l are got in docking before each immunity, mix with 90 μ lPBS, and 3000 rev/mins of centrifugal 10min go supernatant to detect antibody.4 weeks of last immunity back are put to death mices, go spleen cell to carry out formerly being commissioned to train fosterly, and detect the situation of vaccine active cell immunity by ELISPOT.

After the immunity for the first time, anti--HBs antibody positive conversion ratio is respectively 6/10 and 2/10 in injection pcDNA3.1-S-C-181a group and the pcDNA3.1-S group mice serum, and anti--HBc antibody positive conversion ratio is respectively 9/10 and 7/10 in injection pcDNA3.1-S-C-181a group and the pcDNA3.1-C group mice serum.

After the immunity for the second time, anti--HBs antibody positive conversion ratio is respectively 9/10 and 5/10 in injection pcDNA3.1-S-C-181a group and the pcDNA3.1-S group mice serum, and anti--HBc antibody positive conversion ratio is respectively 10/10 and 8/10 in injection pcDNA3.1-S-C-181a group and the pcDNA3.1-C group mice serum.

For the third time after the immunity, anti--HBs antibody positive conversion ratio is respectively 10/10 and 8/10 in injection pcDNA3.1-S-C-181a group and the pcDNA3.1-S group mice serum, and anti--HBc antibody positive conversion ratio is respectively 10/10 and 9/10 in injection pcDNA3.1-S-C-181a group and the pcDNA3.1-C group mice serum.

Treat last immunity 4 weeks of back, the cervical vertebra dislocation method is put to death mice, takes out spleen under aseptic condition, places the plate that fills the RPMI1640 culture medium, and broken with the glass rod grinding, 200 order nylon net filters become single cell suspension, the centrifugal 10min of 1000r/min.Abandon supernatant, wash 2 times with Hanks, centrifugal, cell is resuspended in the RPMI1640 culture medium that contains 10%FBS.Platform expect that every group of mice of blue dyeing counting live lymphocyte number alives, the adjustment cell density is 3 * 10 ⁵/ ml is to 37 ℃ of 5%CO ₂Detect for ELISPOT in the incubator.

ELISPOT detects: sealing ELISPOT culture plate, and by 3 * 10 ⁵/ hole adds cell, 37 ℃ of 5%CO ₂Hatch 12h in the incubator.The antibody (GABA) that adds biotin labeled detection antibody and enzyme labelling successively behind the adding chromogenic reagent, is observed speckle and is formed.Remove colour developing liquid, use washed with de-ionized water ELISPOT plate.Drying at room temperature ELISPOT plate, observed result under inverted microscope.

Experimental result shows that after HBsAg and HBV core protein HBc stimulation, each experimental group competent cell number is significantly higher than stimulates preceding level.The pcDNA3.1-S-C-181a group stimulates the secretory cell quantity of back specific cell factor INF-γ and IL-4 to be significantly higher than other two groups.Fig. 5 a is for producing T cell number/10 of INF-γ ⁶Splenocyte.Fig. 5 b is for producing T cell number/10 of IL-4 ⁶Splenocyte.*：p＜0.05

This shows, the present invention's design, the nucleic acid vaccine pcDNA3.1-S-C-181a that makes up are activating humoral immunity of organism, cellular immunization, produce the nucleic acid vaccine of significantly strong and simple HBV membrane-associated protein in anti-HBs and aspects such as HBc antibody serum and specific cytokine and core protein.

Claims (4)

1. a hepatitis B nucleic acid vaccine is a basic framework with the carrier for expression of eukaryon, it is characterized in that this vaccine contains hepatitis B viruses (HBV) envelope protein gene HBsAg, hepatitis B virus core antigen HBc and e antigen gene; The pre-miR181a sequence that also contains the people, wherein the nucleotide sequence of hepatitis B viruses (HBV) envelope protein gene HBsAg shown in SEQ ID NO:1, the nucleotide sequence of hepatitis B virus core antigen HBc and e antigen gene is shown in SEQ ID NO:2; People's pre-miR181a sequence is shown in SEQ ID NO:4.

2. a kind of hepatitis B nucleic acid vaccine according to claim 1 is characterized in that wherein said carrier for expression of eukaryon is pcDNA ^TM3.1/V5-His B plasmid.

3. the construction method of a hepatitis B nucleic acid vaccine as claimed in claim 1 or 2 comprises following steps:

A, hepatitis b virus hbv envelope antigen, hepatitis B virus core antigen HBc and e antigen gene and people miR181a precursor-gene clone

(I) be template with the full genome of HBV, the design primer obtains HBV SDNA fragment by PCR reaction amplification, and primer sequence is as follows:

S-F：ATGGAGAGCACAACATCAGG

S-F：TCAAATGTATACCCAAAGACAAAAGA

(II) be template with the full genome of HBV, the design primer obtains HBV C antigen and the antigenic DNA sequence of e by PCR reaction amplification, and primer sequence is as follows:

C-F：ATGGACATTGACCCGTATAA

C-F：CTAACATTGAGATTCCCGAGAT

(III) be template with the THP-1 cellular genome, the design primer obtains the miR181a precursor by PCR reaction amplification

181F：TCGACTTGAAACCCAGAGAGG

181R：AATTCACTGGACCACATTTGG

B, above-mentioned hepatitis b virus hbv envelope antigen, hepatitis B virus core antigen HBc and e antigen gene and people miR181a precursor-gene are inserted same carrier for expression of eukaryon pcDNA ^TM3.1/V5-His B.

4. hepatitis B nucleic acid vaccine as claimed in claim 1 or 2 is being used for preparing the application for the treatment of hepatitis B medicament.

Images