CN103074358A - Method for simulating recombination and non-trace cloning - Google Patents

Abstract

The invention relates to a method for simulating recombination and non-trace cloning, which is characterized in that when a carrier primer is designed, a fragment of DNA basic group having a same sequence with a target gene is respectively added at 5' terminal of the primer, the obtained carrier DNA terminal and the inner part of the target gene have a coupling area, the carrier DNA and the target gene are mixed, and Lambda Exonuclease and T4 DNA polymerase are used for treatment to obtain recombinant DNA. The method for simulating recombination and non-trace cloning has the following beneficial effects that 1) the target gene amplified through PCR is not required, the mutation caused by PCR is reduced; 2) the target fragment can be specifically cloned in a DNA mixture; and a trace of an enzyme site is not kept.

Description

A kind of simulation seamless cloning process of recombinating

(1) technical field

The present invention relates to a kind of simulation seamless cloning process of recombinating.

(2) background technology

Utilize primer 5 ' terminal enzyme-added site and the protection base thereof of cutting, pcr amplification goal gene fragment connects into after enzyme is cut in the specific support again, has become classical cloning process.This method also exists some problems: when the restriction enzyme site on the carrier has when conflict with the goal gene fragment, often will transform carrier; High or when having stable secondary structure, we usually are difficult to obtain the pcr amplification product of capacity when goal gene GC content; In addition, when the goal gene fragment is very long, easily cause the problem that amplification efficiency is low, mutation rate is high.The people (2012) such as Fu J. have invented a kind of total length RecE that utilizes, RecT, method (the Fu J that the recombinases such as Red γ and RecA have been recombinated between having realized large fragment DNA in the intestinal bacteria body, Bian X, Hu S, Wang H, Huang F, Seibert PM, Plaza A, Xia L, M ü ller R, Stewart AF, Zhang Y. Full-length RecE enhances linear-linear homologous recombination and facilitates direct cloning for bioprospecting. Nat Biotechnol. 2012 May; 30 (5): 440-6.), yet recombinase that this method relies on has the risk that makes the non-specific restructuring of the inner generation of goal gene simultaneously.

(3) summary of the invention

The object of the invention provides a kind of method with restructuring in λ Exonuclease and the in-vitro simulated intestinal bacteria body of T4 archaeal dna polymerase.

The technical solution used in the present invention is:

A kind of simulation seamless cloning process of recombinating, described method comprises:

(1) carrier DNA preparation: take cloning vector plasmids as template, sequence with goal gene insertion point two ends designs primer for binding site according to a conventional method, then add respectively that at primer 5 ' end the length with the goal gene coupling is the preferred 25bp of 20 ~ 30bp() sequence, final gained upstream primer is designated as primer1, downstream primer is designated as primer2, obtains carrier DNA take primer1 and primer2 as primer carries out pcr amplification;

(2) goal gene preparation: carry out according to a conventional method enzyme and cut the fragment that obtains to comprise goal gene; Perhaps according to a conventional method for the goal gene design of amplification primers, the gained primer carries out pcr amplification take the DNA that contains goal gene as template, obtains comprising the fragment of goal gene;

(3) gene recombination: step (1) carrier DNA and step (2) gained fragment are mixed, add first λ Exonuclease, 37 ℃ of reaction 30 min, 72 ℃ of temperature are bathed 5min, 50 ℃ of temperature are bathed 30min, and then temperature is down to 37 ℃, add T4 archaeal dna polymerase and dNTPs, 37 ℃ of reaction 15 min obtain recombinant DNA.

The principle of the invention is referring to Fig. 1.λ Exonuclease(Lambda exonuclease) have and depend on 5 ' of 5 ' phosphate group → 3 ' exonuclease activity, the T4 archaeal dna polymerase has 3 ' → 5 ' exonuclease activity and 5 ' → 3 ' polymerase activity.Shown in Fig. 1 C, utilize T4 polynucleotide kinase (T4 PNK) phosphorylated cdna, make λ Exonuclease play exonuclease and form the strand district the end of double-stranded DNA, (overlap uses respectively among Fig. 1 if carrier end and goal gene inside have matching area

With Expression), the strand zone just can be according to the principle specificity annealing of base complementrity pairing.Product after the annealing forms the circular double stranded DNA with nicking (Nick) behind 3 ' → 5 ' exonuclease activity and 5 ' → 3 ' polymerase activity effect of T4 archaeal dna polymerase.After being transformed into bacterium, just can finish goal gene to the clone of purpose carrier.When utilizing this method clone goal gene, can there be unnecessary dna sequence dna (Figure 1A) at the two ends of goal gene.When this method requires the design vector primer, will increase respectively the section of DNA base (Figure 1B) identical with the goal gene sequence at 5 ' end of primer, this sequence same area needn't (be used respectively among Fig. 1 corresponding to the end of goal gene

With Expression).

The purpose fragment of 4kb is as example in the Lambda DNA, and concrete, described method is as follows:

(1) carrier DNA preparation: take cloning vector pBlueScript II KS (-) plasmid as template, carry out pcr amplification with primer MR4kbP1 and MR4kbP2, obtain carrier DNA;

Primer MR4kbP1 sequence is as follows:

5’-GCATAGGCGGGTTCAAGCATCAGCGATCGAATTCCTGCAGCC-3’；

Primer MR4kbP2 sequence is as follows:

5’-CTGGGCTATGCGCTGCAGCATCAACATCAAGCTTATCGATACCG-3’；

(2) goal gene preparation: take Lambda DNA as template, carry out pcr amplification with primer MR4kbPF and MR4kbPR, obtain goal gene;

Primer MR4kbPF sequence is as follows: 5 '-AGGAGGAGAAGAGTGACAGCA-3 ';

Primer MR4kbPR sequence is as follows: 5 '-GTCATGCTTCTCCAGTGCATC-3 ';

(3) gene recombination: step (1) carrier DNA and step (2) gained fragment are mixed, add first λ Exonuclease, 37 ℃ of reaction 30 min, 72 ℃ of temperature are bathed 5min, 50 ℃ of temperature are bathed 30min, and then temperature is down to 37 ℃, add T4 archaeal dna polymerase and dNTPs, 37 ℃ of reaction 15 min obtain recombinant DNA.

Concrete, described goal gene is the coding region (ORF) of Sox10 gene, described method is as follows:

(1) carrier DNA preparation: take the pGEX-4T-1 vector plasmid as template, carry out pcr amplification with primer Sox10-pGEX-P1 and Sox10-pGEX-P2, obtain carrier DNA;

Primer Sox10-pGEX-P1 sequence is as follows:

5’- AGGTCTTGTTCCTCGGCCATGAATTCCGGGGATCCACGC -3’；

Primer Sox10-pGEX-P2 sequence is as follows:

5’- CGACTCTATCCCGACCTTAGCTCGAGCGGCCGCATCGTG -3’；

(2) goal gene preparation: pBlueScript II KS (-) plasmid that comprises Sox10 ORF with restriction endonuclease EcoRI-HF and XhoI carry out enzyme cut (37 ℃, 4h), acquisition Sox10 ORF endonuclease bamhi;

(3) gene recombination: step (1) carrier DNA and step (2) gained fragment are mixed, add first λ Exonuclease, 37 ℃ of reaction 30 min, 72 ℃ of temperature are bathed 5min, 50 ℃ of temperature are bathed 30min, and then temperature is down to 37 ℃, add T4 archaeal dna polymerase and dNTPs, 37 ℃ of reaction 15 min obtain recombinant DNA.

Beneficial effect of the present invention is mainly reflected in: (1) does not need through the pcr amplification goal gene, has reduced the sudden change that PCR causes; (2) can from the DNA mixture, clone specifically the purpose fragment; (3) do not stay the vestige of restriction enzyme site.

(4) description of drawings

Fig. 1 is the principle of the invention and schema;

Fig. 2 is that one section Alu I enzyme of Lambda DNA is cut sequence; Cloning site distance nearest end separately is approximately 400 bp, uses respectively With

Expression.

Fig. 3 is the Insert Fragment detected result; Swimming lane 1-7 is that the white colony of 7 random chooses detects Insert Fragment with PCR, and wherein the bacterial clone of swimming lane 3,5 and 6 representatives is accredited as the clone who contains target DNA fragment through order-checking; M, 10kb marker.

(5) embodiment

The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:

Embodiment 1:

1.1, detect the seamless clone's of simulation restructuring efficient.

At first utilize the seamless cloning process of simulation restructuring from 144 Alu I endonuclease bamhis of Lambda DNA, to clone one section (Fig. 2) and come detection efficiency.

1.1.1, the preparation of target DNA fragment.

At 40 μ l, 1 * NEB Buffer(New England Biolabs) in, use the AluI restriction endonuclease (New England Biolabs) of 20U at 37 ℃ 2 μ g Lambda DNA (Sangon) Reaction 4h makes Lambda DNA be cut by thorough enzyme.Then be heated to 70 ℃ and temperature and bathe 10min and make the restriction endonuclease inactivation, products therefrom is that the Lambda DNA enzyme of final concentration 50ng/ μ l is cut product.

Table 1: detect the seamless cloning efficiency the primer of simulation restructuring

Overlap	Primers	Sequences (5’-3’)
			0 bp	0bpP1	ATCGAATTCCTGCAGCC
	0bpP2	ATCAAGCTTATCGATACCG
			15 bp	15bpP1	TGCCGTCGTTGTTAAATCGAATTCCTGCAGCC
	15bpP2	AGAGTGATTTGCCGTATCAAGCTTATCGATACCG
			20 bp	20bpP1	GTTCGTGCCGTCGTTGTTAAATCGAATTCCTGCAGCC
	20bpP2	GGTGCAGAGTGATTTGCCGTATCAAGCTTATCGATACCG
			25 bp	25bpP1	TGCCCGTTCGTGCCGTCGTTGTTAAATCGAATTCCTGCAGCC
	25bpP2	CTGCAGGTGCAGAGTGATTTGCCGTATCAAGCTTATCGATACCG

1.1.2, the preparation of carrier DNA fragment.

Utilize pcr amplification to obtain respectively four groups of linearized vectors, the end of these four groups of carriers has respectively the sequence of 0bp, 15bp, 20bp and 25bp and target DNA fragment to be complementary (representing with lower stroke straight line and wavy line respectively among table 1 and Fig. 2).The condition of PCR is as follows, in 25 μ l systems, take 1ng pBlueScript II KS (-) plasmid DNA as template, add respectively four pairs of primers (0bpP1 and 0bpP2,15bpP1 and 15bpP2,20bpP1 and 20bpP2 and 25bpP1 and 25bpP2), the primer final concentration is 0.4 μ M, with high-fidelity enzyme Phusion archaeal dna polymerase (New England Biolabs) amplification.The PCR program is: 98 ℃ of denaturation 30s; Then move 98 ℃ of sex change 10s of 30 circulations, 62 ℃ of annealing 30s, 72 ℃ are extended 75s; Extend 5min at 72 ℃ more at last.The PCR product is finally through the DNA electrophoresis and cut glue and reclaim.

Table 2: the seamless cloning process efficient of simulation restructuring detects

1.1.3, the seamless clone of simulation restructuring.

In about 10 μ l reaction systems, add respectively:

2μl 5× reaction buffer

0.2μl 10mM dNTPs

40ng carrier DNA fragment

50ng Lambda DNA AluI enzyme is cut product

1U 1st enzyme(s)

37 ℃ of reaction 30 min make the terminal strand district that forms of DNA, then are heated to 72 ℃ of temperature bath 5min and make enzyme deactivation, then bathe 30min 50 ℃ of temperature and form complementary pairing.When temperature is reduced to 37 ℃, add

1U 2nd enzyme(s)

37 ℃ of reaction 15 min repair outstanding unpaired base.

Above-mentioned reaction product places and namely can be used for afterwards on ice transforming.After being transformed into the DH5a competent cell, carry out blue hickie screening.

Wherein 5 * reaction buffer composition is: 25 ℃ of 335 mM Tris-HCl(pH, 8.8 at), and 33 mM MgCl ₂, 5 mM DTT, 84 mM (NH4) ₂SO ₄During as 1st enzyme (s), 37 ℃ of reaction times of the first step are 15min with T4 DNA polymerase, and 37 ℃ of reaction times of second step are 30min, and in addition, dNTPs adds when adding 2nd enzyme (s).

The result is as shown in table 2.Compared coupling (overlap) sequence of different lengths to the impact of cloning efficiency, found when matching sequence length＜15bp, to be difficult to obtain to contain the bacterium colony of purpose fragment.The cloning efficiency of the target DNA fragment during the 25bp matching sequence is the highest, reaches 5/16, and white colony is maximum simultaneously.Also compared simultaneously the impact of different experiments step on the seamless cloning efficiency of simulation restructuring, found to process with T4 PNK and λ Exonuclease first, the cloning efficiency of processing with T4 DNA polymerase again is the highest.Find only to add in addition carrier and the target DNA with matching area, and process without enzyme, although the bacterium colony that obtains is less, have a bacterium colony to contain target DNA fragment (table 2) in 6 bacterium colonies.Still have certain restructuring active in the proof DH5a body.First with T4 DNA polymerase process process with T4 PNK and λ Exonuclease again and only with T4 DNA polymerase process the colony number that contains target DNA fragment of final acquisition and not enzyme-added processing almost.

1.2, utilize the dna fragmentation of the seamless cloning process clone of simulation restructuring 4kb

Then the dna fragmentation whether seamless cloning process of restructuring can clone 4kb is simulated in checking.

1.2.1, the preparation of target DNA fragment.

The size of target DNA fragment is 4.2kb, is obtained by pcr amplification, wherein with the equal about 80bp of the nearest DNA end of the region distance of carrier DNA coupling.In 20 μ l reaction systems, take 1ng Lambda DNA as template, take MR4kbPF and PR4kbPR as primer (table 3), the amplification target DNA fragment.The extension time of PCR is 2min, identical among all the other conditions and the step 1.1.2.The amplified production of target DNA fragment AxyPrep PCR cleaning agents box (AxyGen Biotechnology) purifying.

Table 3: the seamless clone 4kb fragment the primer of simulation restructuring

1.2.2, the preparation of carrier DNA.

Carrier DNA is take MR4kbP1 and MR4kbP2 as primer amplification, identical among all the other PCR conditions and the step 1.1.2.

1.2.3, the seamless clone of simulation restructuring.

The simulation reconstitution steps is identical with step 1.1.3.Random choose 7 white colonies detect whether contain goal gene with the universal primer M13F on pBlueScript II KS (-) carrier and M13R, the result as shown in Figure 3, there are 3 in the white colony of 7 random chooses and comprise the goal gene fragment, show the fragment that the seamless cloning process of simulation restructuring can effectively be cloned 4kb.

Embodiment 2:

2.1, utilize the seamless cloning process clone of simulation restructuring Sox10 ORF to pGEX-4T-1

(ORF) has 1401bp in the coding region of Sox10 gene; GC content reaches 63.24%; with conventional primer 5 ' terminal enzyme-added site and the protection base thereof of cutting with failing; Phusion DNA polysaccharase (New England Biolabs) pcr amplification goal gene fragment with high-fidelity connects in the pGEX-4T-1 carrier after enzyme is cut again.Therefore utilize the seamless cloning process of simulation restructuring that Sox10 ORF is subcloned into from pBlueScript II KS (-) carrier and obtain the GST-Sox10 fusion expression plasmid in the pGEX-4T-1 carrier.

2.1.1, the preparation of target DNA fragment.

At 20 μ l NEB buffer 4+BSA(New England Biolabs) in the reaction system, add 1 μ g and comprise pBlueScript II KS (-) plasmid of Sox10 ORF with restriction endonuclease EcoRI-HF and the XhoI(New England Biolabs of each 10U) at 37 ℃ Reaction 4h, then 70 ℃ of temperature are bathed 10min and are made the restriction endonuclease heat inactivation, obtain Sox10 ORF endonuclease bamhi.There is unnecessary pBlueScript II KS (-) carrier sequence at the Sox10 ORF endonuclease bamhi two ends that obtain, are respectively 8bp and 29bp.

2.1.2, the preparation of carrier DNA.

The pGEX-4T-1 carrier DNA is take Sox10-pGEX-P1 and Sox10-pGEX-P2(table 3) as primer amplification, the extension time is 2min, identical among all the other PCR conditions and the embodiment 1 step 1.1.2.

Table 4: the seamless clone Sox10ORF the primer of simulation restructuring

2.1.3, the seamless clone of simulation restructuring.

The simulation reconstitution steps is identical with embodiment 1 step 1.1.3.The sequencing result demonstration, successfully the ORF with Sox10 is cloned into pGEX-4T-1, thereby has obtained the GST-Sox10 fusion expression plasmid.

Claims (2)

1. simulate the seamless cloning process of restructuring for one kind, described method comprises:

(1) carrier DNA preparation: take cloning vector plasmids as template, sequence with goal gene insertion point two ends designs primer for binding site, and add respectively that at primer 5 ' end the length with the goal gene coupling is the sequence of 20 ~ 30bp, the gained upstream primer is designated as primer1, downstream primer is designated as primer2, obtains carrier DNA take primer1 and primer2 as primer carries out pcr amplification;

(2) goal gene preparation: cut or increase through enzyme and obtain to comprise the fragment of goal gene;

(3) gene recombination: step (1) carrier DNA and step (2) gained fragment are mixed, add first λ Exonuclease, 37 ℃ of reaction 30 min, 72 ℃ of temperature are bathed 5min, 50 ℃ of temperature are bathed 30min, and then temperature is down to 37 ℃, add T4 archaeal dna polymerase and dNTPs, 37 ℃ of reaction 15 min obtain recombinant DNA.

2. the method for claim 1 is characterized in that described goal gene is the coding region of Sox10 gene, and described method is as follows:

(1) carrier DNA preparation: take the pGEX-4T-1 vector plasmid as template, carry out pcr amplification with primer Sox10-pGEX-P1 and Sox10-pGEX-P2, obtain carrier DNA;

Primer Sox10-pGEX-P1 sequence is as follows:

5’- AGGTCTTGTTCCTCGGCCATGAATTCCGGGGATCCACGC -3’；

Primer Sox10-pGEX-P2 sequence is as follows:

5’- CGACTCTATCCCGACCTTAGCTCGAGCGGCCGCATCGTG -3’；

(2) goal gene preparation: pBlueScript II KS (-) plasmid that comprises Sox10 ORF carries out enzyme with restriction endonuclease EcoRI-HF and XhoI to be cut, and obtains Sox10 ORF endonuclease bamhi;

(3) gene recombination: step (1) carrier DNA and step (2) gained fragment are mixed, add first λ Exonuclease, 37 ℃ of reaction 30 min, 72 ℃ of temperature are bathed 5min, 50 ℃ of temperature are bathed 30min, and then temperature is down to 37 ℃, add T4 archaeal dna polymerase and dNTPs, 37 ℃ of reaction 15 min obtain recombinant DNA.

Images