CN107760706A - The application of DNA excision enzymes and the method for seamless clone - Google Patents
The application of DNA excision enzymes and the method for seamless clone Download PDFInfo
- Publication number
- CN107760706A CN107760706A CN201710939294.8A CN201710939294A CN107760706A CN 107760706 A CN107760706 A CN 107760706A CN 201710939294 A CN201710939294 A CN 201710939294A CN 107760706 A CN107760706 A CN 107760706A
- Authority
- CN
- China
- Prior art keywords
- dna
- fragment
- carrier
- exonucleases
- enzymes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
Abstract
The invention provides the application that DNA excision enzymes can apply to the seamless clone of DNA restructuring；A kind of kit is provided, can be used for DNA and recombinate seamless clone, DNA excision enzymes are T5 exonucleases, T7 exonucleases, exonucleaseⅲ or Lambda exonucleases or its mixture；The seamless cloning process using DNA excision enzymes is provided, by PCR method either digestion with restriction enzyme method vector linearization；Introduced at the both ends of target gene fragment by PCR and distinguish homologous homologous sequence, the target gene fragment expanded with carrier both ends；After linearized vector mixing the purpose fragment after processing and after processing, DNA excision enzymes and reaction solution warm bath are added, obtains carrier and fragment mixture；Competent escherichia coli cell is converted using obtained carrier and fragment mixture.This application and method can be selected flexibly in site, can carry out gene cloning in the optional position of carrier；It is fast and convenient to complete within 10 minutes vector construction, while clones accurate and efficiency high.
Description
Technical field
The present invention relates to molecular biology, the seamless cloning process of special DNA restructuring.
Background technology
From in the 1970s, Boyer-Cohen Success in Experiment builds dual resistance to the action of a drug recombinant plasmid, genetic engineering
Prelude just pulls open, and and then O.Smith is found that first restriction endonuclease, so far, most traditional and most classical
Gene clone technology-join dependency type clone's (Ligation-dependent cloning) technology be born.Join dependency
Type clone technology makes it produce identical cohesive end using restriction enzyme ferment treatment carrier and PCR primer fragment, then
Host cell is converted after connecting cyclization in the presence of DNA ligase.Gene clone technology is most important as field of biology
One of technology, all there is huge market potential and prospect always, more esbablished corporations and company are such as：NEB、Novagen、
Thermo scientific etc. conduct in-depth research to this.At present, in the species of cloning vector and restriction enzyme
There is remarkable progress with quantitative aspects, it has promoted the development of traditional gene clone technology to a certain extent.But its technology core
The heart is still that restriction endonuclease digestion target DNA fragment and carrier make it produce identical cohesive end respectively, connection
Enzyme connects target gene and carrier the two essential steps.Therefore, such a gene clone technology method is existing always
Shortcoming：(1) both ends of carrier and purpose fragment will have identical restriction enzyme site；(2) returning after carrier and fragment digestion
Rate of producing effects is too low；(3) easily from connecting, false positive is high；(4) if connected to carrier T also needs to be subcloned；(5) when flush end connects
It need to identify that direction of insertion etc. is not solved effectively.
The defects of in order to overcome conventional cloning methods, each company also in making great efforts always, so as to various disconnected dependences
Type clone's (Ligation-independent cloning (LIC)) technology is arisen at the historic moment：1st, GATEWAY technologies：Gateway's
Principle is built upon phage DNA site-directed integration to bacterial host gene group.Its process includes BP reactions i.e. target gene
It is cloned into entry vector (Entry Vector) neutralization LR reactions and leans on specific recombination site and restructuring present on entry vector
Enzyme, target gene is cloned on other acceptor carriers (Destination Vector, purpose carrier), it is not only bothersome to take
Power, process is complicated, and in Gateway systems, entry vector is suicide gene comprising a crucial screening original paper ---
CcdB genes, because the expression product of ccdB genes can suppress common E.coli growths, do not cut in clone or from
The carrier of body cyclisation can not grow in conversion.This gene must be cut away when building the entry vector containing target gene, is connect
Enter target gene.The restriction enzyme site that ccdB genes both ends can select is limited (2), while must also consider single open reading frame, open
The problems such as mover, termination codon, therefore alternative entry vector, with regard to few, Gateway systems only have 5 kinds not at present
Same entry vector is for selection.Equally, purpose carrier (Destination Vector) must also match somebody with somebody with Gateway systems
There are two recombination sites attR1 and attR2 in set, i.e. the expression regulation element downstream of purpose carrier, and size is 125bp, equally
Also a ccdB suicide gene is clipped.Consequently, it is possible to also just make being restricted using range for this clone technology；2nd, rely on
The clone technology of T4DNA polymerases：T4DNA polymerases have 5 ' -3 ' polymerase activity, while have 3 ' -5 ' it is circumscribed
Enzymatic activity, therefore, carrier and purpose fragment are handled using this specific function of T4DNA polymerases, it is produced complementary end
End, in the presence of annealing, carrier and purpose fragment produce connection；3rd, the clone technology of UDG enzymes is relied on：UDG is ura DNA
Glycosylase, it can incise the glycosidic bond fracture generation one of U bases, and then endonuclease VIII identifies that this is incised simultaneously
The phosphodiester bond of U bases, therefore, U bases can be added in purpose fragment end appropriate site, make its post-rift end just
Good and carrier end is complementary, and connection is completed after annealing.Due to the not only cost of the cloning process based on T4DNA polymerases and UDG enzymes
It is higher, and vehicle treated is cumbersome, so, both approaches also and are of little use.And field of biology be badly in need of it is a kind of it is new, save
Shi Shengli, efficiently and it can overcome the disadvantages that the clone technology of several conventional cloning methods shortcomings of the above.
Then, another gene clone technology independent of ligase is also born, that is, relies on recombinase
Seamless Cloning (seamless clone) technology, its technical principle is to make target DNA fragment end and carrier using round pcr
End has 15-20 homologous base sequence, and clone's restructuring is then completed in the presence of recombinase.Such a dependence recombinase
Gene clone technology avoids restriction enzyme and ligase in traditional gene cloning, simplifies laboratory operating procedures, phase
Conventional efficient is improved to traditional gene clone technology.But the technology relies primarily on recombinase, restructuring enzyme on the market
Class is various, and quality is also uneven, and the recombinase for the product also having is a kind of mixed enzyme, and this undoubtedly adds cost.
The content of the invention
The invention provides DNA excision enzyme applications, also provide a kind of seamless cloning process based on DNA excision enzymes.This hair
Bright methods described includes：By PCR method either digestion with restriction enzyme method vector linearization；In target DNA fragment
Both ends pass through PCR and introduce the homologous sequence that homologous 15~30bp is distinguished with carrier both ends；The purpose fragment after processing and
After carrier mixes according to a certain percentage, add DNA excision enzymes and corresponding reaction solution be placed in 25 DEG C or 37 DEG C of warm bath 10-15min,
Purpose fragment and carrier is set to form 3 ' jags of complementation in the presence of excision enzyme so that purpose fragment connects with carrier；
Bacillus coli DH 5 alpha competent cell is converted with the carrier after the circumscribed ferment treatments of DNA and fragment mixture, using Escherichia coli certainly
The repair system of body repairs junction.
Seamless clone technology provided by the invention is to be based on exonuclease, and not only digesting efficiency is high but also without cleavage site
Limitation.
T5 exonucleases are along 5 ' → 3 ' direction degradation of dna.It can be originated from 5 ' ends digests, also can be from linear or ring
The nicking of shape double-stranded DNA or indentation, there starting digestion.T7 exonucleases act on double-stranded DNA, are gone along the catalysis of 5 ' → 3 ' directions
Except 5 ' mononucleotides, it can be originated from 5 ' ends digests, nicking that also can be from double-stranded DNA or indentation, there starting digestion.It was both
5 ' the phosphorylated cdnas that can degrade can also degrade 5 ' dephosphorylation DNA.
The invention provides a kind of application of DNA excision enzymes, DNA excision enzymes are applied to DNA and recombinate seamless clone.
The present invention proposes the application for also having supplied a kind of DNA excision enzymes, and the DNA excision enzymes of application are double-strand exonuclease.
The present invention proposes the application for also having supplied a kind of DNA excision enzymes, and the DNA excision enzymes of application are T5 exonucleases, T7 cores
Any of which of sour excision enzyme, exonucleaseⅲ or Lambda exonucleases, or DNA excision enzymes are T5 Exonucleolytics
Enzyme, T7 exonucleases, wherein any several mixtures of exonucleaseⅲ or Lambda exonucleases.
The invention provides a kind of kit that seamless clone is recombinated for constructed dna, kit include DNA excision enzymes,
Reaction buffer.
Present invention also offers a kind of kit that seamless clone is recombinated for constructed dna, DNA excision enzymes are in kit
T5 exonucleases, T7 exonucleases, any of which of exonucleaseⅲ or Lambda exonucleases, or be T5
Any several mixture in exonuclease, T7 exonucleases, exonucleaseⅲ or Lambda exonucleases.
Present invention also offers a kind of kit that seamless clone is recombinated for constructed dna, reaction buffer in kit
Include 10~100mM KAc, 20~100mM Tris-Ac, 1~20mM Mg (Ac) 2 and 1~5mM DTT.
Present invention also offers a kind of kit that seamless clone is recombinated for constructed dna, in kit DNA excision enzymes and
Reaction buffer is to load in mixture or separately pack in advance.
Present invention also offers a kind of kit that seamless clone is recombinated for constructed dna, DNA excision enzymes and reaction buffer
The solution ph of liquid is 6~9.
The invention provides a kind of seamless cloning process using DNA excision enzymes, above-mentioned seamless cloning process uses DNA
Excision enzyme, seamless cloning process step is as follows,
The linearisation of step 1 carrier；
The acquisition of step 2 target gene fragment；
The circumscribed ferment treatment linearized vectors of step 3DNA and target DNA fragment；
Step 4 converts Escherichia coli bacillus competent cell.
Present invention also offers a kind of seamless cloning process using DNA excision enzymes, competent escherichia coli cell can be with
It is DH5 α, JM109.
Present invention also offers a kind of seamless cloning process using DNA excision enzymes, seamless cloning process is circumscribed using DNA
Enzyme, the seamless cloning process step is as follows,
The linearisation of step 1 carrier, step are by PCR method either digestion with restriction enzyme method that carrier is linear
Change；
The acquisition of step 2 target gene fragment, step are to be introduced and carrier two by PCR at the both ends of target DNA fragment
The homologous homologous sequence of end difference, the target gene fragment expanded；
The circumscribed ferment treatment linearized vectors of step 3DNA and target DNA fragment, step are after above-mentioned steps 2 are handled
After purpose fragment and the linearized vector after the processing of above-mentioned steps 1 mix, above-mentioned DNA excision enzymes and reaction solution warm bath are added,
Obtain carrier and fragment mixture；
Step 4 converts competent escherichia coli cell, and step is the carrier and fragment mixture obtained using above-mentioned steps 3
Convert competent escherichia coli cell.
Present invention also offers a kind of seamless cloning process using DNA excision enzymes, DNA excision enzymes are that double-strandednucleic acid is circumscribed
Enzyme, the dosage of double-strandednucleic acid excision enzyme is 0.01U~40U, and carrier and Insert Fragment mol ratio are 1：1~1:5.
Present invention also offers a kind of seamless cloning process using DNA excision enzymes, the linearisation of step 1 carrier, in can
A pair of the synthetic primer sequences used are as follows：
PUC19-F：SEQ No.1
GAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG；
PUC19-R：SEQ No.2
GTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG；
The acquisition of step 2 target gene fragment, in workable a pair of synthetic primer sequences it is as follows：
Kana–F：SEQ No.3
GACGGCCAGTGAATTCATGAGCCATATTCAACGG；
Kana-R：SEQ No.4
ATGCCTGCAGGTCGACTTAGAAAAACTCATCGA。
The method of the present invention also has the following advantages：
I. flexible site selection：Gene cloning can be carried out in the optional position of carrier；
II. it is fast and convenient：Complete vector construction within 10 minutes；
III. it is accurate：Any extra program need not be increased；
IV. cloning efficiency is high：Up to 90% positive colony.
Brief description of the drawings
Fig. 1 is the vector plasmid electrophoretogram of the embodiment of the present invention 1；
Fig. 2 is the target DNA fragment electrophoretogram of the embodiment of the present invention 1；
Fig. 3 is the negative control group cultivation results figure of the embodiment of the present invention 1；
Fig. 4 is the experimental group cultivation results figure of the embodiment of the present invention 1；
Fig. 5 is the vector plasmid electrophoretogram of the embodiment of the present invention 2；
Fig. 6 is the target DNA fragment electrophoretogram of the embodiment of the present invention 2；
Fig. 7 is the negative control group cultivation results figure of the embodiment of the present invention 2；
Fig. 8 is the experimental group cultivation results figure of the embodiment of the present invention 2；
Fig. 9 is the vector plasmid electrophoretogram of the embodiment of the present invention 3；
Figure 10 is the target DNA fragment electrophoretogram of the embodiment of the present invention 3；
Figure 11 is the negative control group cultivation results figure of the embodiment of the present invention 3；
Figure 12 is the experimental group cultivation results figure of the embodiment of the present invention 3；
Figure 13 is the vector plasmid electrophoretogram of the embodiment of the present invention 4；
Figure 14 is the target DNA fragment electrophoretogram of the embodiment of the present invention 4；
Figure 15 is the negative control group cultivation results figure of the embodiment of the present invention 4；
Figure 16 is the experimental group cultivation results figure of the embodiment of the present invention 4；
Embodiment
Technical scheme is expanded on further with reference to embodiment.
Following examples are intended to illustrate invention rather than limitation of the invention further.
Following examples have used the reagent for being used to build recombinant dna fragment including DNA excision enzymes and reaction buffer
Box, the species that DNA excision enzymes can select is T5 exonucleases, T7 exonucleases, exonucleaseⅲ or Lambda cores
Any of which of sour excision enzyme or several mixtures.Reaction buffer can be used comprising 10-100mM KAc, 20-
100mM Tris-Ac, 1-20mM Mg (Ac) 2,1-5mM DTT composition.The pH value of solution of DNA excision enzymes and reaction buffer
It is worth for 6~9.
Embodiment 1
1st, the linearisation of cloning vector
According to the gene order of pUC19 plasmids, enter performing PCR using the PUC19-F primers and PUC19-R primers of synthesis and expand
Increase, PCR uses the high-fidelity amplification system (E035, Novoprotein) of our company, and the requirement of reaction system to specifications is matched somebody with somebody
System.
Synthetic primer sequence is as follows：
PUC19-F：GAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG；
PUC19-R：GTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG.
PCR reaction conditions are：Step 1. 94 degrees Celsius 5 minutes；Step 2. 94 degrees Celsius 20 seconds, 55 degrees Celsius 20 seconds, 72
Degrees Celsius 90 seconds, 30 circulations；Step 3. 72 degrees Celsius 5 minutes.PCR primer is reclaimed, 1% agarose gel electrophoresis detects,
Obtain size correctly single band, such as Fig. 1.
2nd, the acquisition of target DNA fragment
According to linearized vector pUC19 both ends gene order, carried out using the Kana-F primers and Kana-R primers of synthesis
PCR is expanded, and PCR uses the high-fidelity amplification system of our company, and the requirement of reaction system to specifications is prepared.
Synthetic primer sequence is as follows：
Kana–F：GACGGCCAGTGAATTCATGAGCCATATTCAACGG；
Kana-R：ATGCCTGCAGGTCGACTTAGAAAAACTCATCGA.
PCR reaction conditions are：Step 1. 94 degrees Celsius 5 minutes；Step 2. 94 degrees Celsius 20 seconds, 55 degrees Celsius 20 seconds, 72
Degrees Celsius 30 seconds, 30 circulations；Step 3. 72 degrees Celsius 5 minutes.PCR primer is reclaimed, 1% agarose gel electrophoresis detects,
Obtain size correctly single band, such as Fig. 2.
3rd, T5 exonucleases digestion Puc19 carriers and Kana fragments
The dosage of T5 exonucleases is 0.01U, and Puc19 carriers and Kana fragments mol ratio are 1:5, according to following sample-adding
System is loaded, and blank control group and experimental group do 3 groups of repetitions, 25 DEG C are placed in after mixing, 10min.
Reaction system is as follows：
4th, bacillus coli DH 5 alpha competent cell is converted
B1-B3 and E1-E3 reaction products 10ul in above-mentioned steps 3 is converted bacillus coli DH 5 alpha competent cell, ice
After bathing 30min, 42 DEG C of heat shock 90S, ice bath 5min, 500ul LB nonreactive fluid nutrient mediums are added, 37 DEG C, 250rpm, vibration is trained
Support 45min.
5th, LB Amp resistance solid medium flat boards are applied
The cultured products that above-mentioned steps 4 obtain are placed in 5000Rpm/min centrifuge 3min, remove supernatant
400ul, remaining 200ul liquid are equably coated on LB Amp resistance solid medium flat boards after being blown and beaten uniformly with pipettor,
After 37 DEG C of incubators are incubated overnight 16-18h, hickie quantity is counted, as a result as shown in Figure 3,4.
6th, result counts
Experimental data shows that gene cloning can be achieved in 0.01U T5 exonucleases, and clone's number is up to 1000 or so.
Embodiment 2
1st, the linearisation of cloning vector
According to the gene order of pUC19 plasmids, enter performing PCR using the PUC19-F primers and PUC19-R primers of synthesis and expand
Increase, PCR uses the high-fidelity amplification system (E035, Novoprotein) of our company, and the requirement of reaction system to specifications is matched somebody with somebody
System.
Synthetic primer sequence is as follows：
PUC19-F：GAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG’
PUC19-R：
GTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG
PCR reaction conditions are：Step 1. 94 degrees Celsius 5 minutes；Step 2. 94 degrees Celsius 20 seconds, 55 degrees Celsius 20 seconds, 72
Degrees Celsius 90 seconds, 30 circulations；Step 3. 72 degrees Celsius 5 minutes.PCR primer is reclaimed, 1% agarose gel electrophoresis detects,
Obtain size correctly single band (such as Fig. 5).
2nd, the acquisition of target DNA fragment
According to linearized vector pUC19 both ends gene order, carried out using the Kana-F primers and Kana-R primers of synthesis
PCR is expanded, and PCR uses the high-fidelity amplification system (E035, Novoprotein) of our company, and reaction system is to specifications
It is required that prepare.
Synthetic primer sequence is as follows：
Kana–F：GACGGCCAGTGAATTCATGAGCCATATTCAACGG
Kana-R：ATGCCTGCAGGTCGACTTAGAAAAACTCATCGA
PCR reaction conditions are：Step 1. 94 degrees Celsius 5 minutes；Step 2. 94 degrees Celsius 20 seconds, 55 degrees Celsius 20 seconds, 72
Degrees Celsius 30 seconds, 30 circulations；Step 3. 72 degrees Celsius 5 minutes.PCR primer is reclaimed, 1% agarose gel electrophoresis detects,
Obtain size correctly single band (see Fig. 6).
3rd, T5 exonucleases digestion Puc19 carriers and Kana fragments
The dosage of T5 exonucleases is 1U, and Puc19 carriers and Kana fragments mol ratio are 1:5, according to following sample-adding body
System is loaded, and blank control group and experimental group do 3 groups of repetitions, 25 DEG C are placed in after mixing, 10min.
Reaction system is as follows：
4th, bacillus coli DH 5 alpha competent cell is converted
B1-B3 and E1-E3 reaction products 10ul in above-mentioned steps 3 is converted bacillus coli DH 5 alpha competent cell, ice
After bathing 30min, 42 DEG C of heat shock 90S, ice bath 5min, 500ul LB nonreactive fluid nutrient mediums are added, 37 DEG C, 250rpm, vibration is trained
Support 45min.
5th, LB Amp resistance solid medium flat boards are applied
The cultured products that above-mentioned steps 4 obtain are placed in 5000Rpm/min centrifuge 3min, remove supernatant
400ul, remaining 200ul liquid are equably coated on LB Amp resistance solid medium flat boards after being blown and beaten uniformly with pipettor,
After 37 DEG C of incubators are incubated overnight 16-18h, hickie quantity is counted, as a result as shown in Figure 7,8.
6th, result counts
Experimental data shows that gene cloning can be achieved in 1U T5 exonucleases, and clone's number is up to 500 or so.
Embodiment 3
1st, the linearisation of cloning vector
According to the gene order of pUC19 plasmids, enter performing PCR using the PUC19-F primers and PUC19-R primers of synthesis and expand
Increase, PCR uses the high-fidelity amplification system (E035, Novoprotein) of our company, and the requirement of reaction system to specifications is matched somebody with somebody
System.
Synthetic primer sequence is as follows：
PUC19-F：GAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG’
PUC19-R：
GTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG
PCR reaction conditions are：Step 1. 94 degrees Celsius 5 minutes；Step 2. 94 degrees Celsius 20 seconds, 55 degrees Celsius 20 seconds, 72
Degrees Celsius 90 seconds, 30 circulations；Step 3. 72 degrees Celsius 5 minutes.PCR primer is reclaimed, 1% agarose gel electrophoresis detects,
Obtain size correctly single band (such as Fig. 9).
2nd, the acquisition of target DNA fragment
According to linearized vector pUC19 both ends gene order, carried out using the Kana-F primers and Kana-R primers of synthesis
PCR is expanded, and PCR uses the high-fidelity amplification system of our company, and the requirement of reaction system to specifications is prepared.
Synthetic primer sequence is as follows：
Kana–F：GACGGCCAGTGAATTCATGAGCCATATTCAACGG
Kana-R：ATGCCTGCAGGTCGACTTAGAAAAACTCATCGA
PCR reaction conditions are：Step 1. 94 degrees Celsius 5 minutes；Step 2. 94 degrees Celsius 20 seconds, 55 degrees Celsius 20 seconds, 72
Degrees Celsius 30 seconds, 30 circulations；Step 3. 72 degrees Celsius 5 minutes.PCR primer is reclaimed, 1% agarose gel electrophoresis detects,
Obtain size correctly single band (such as Figure 10).
3rd, T7 exonucleases digestion Puc19 carriers and Kana fragments
The dosage of T7 exonucleases is 1U, and Puc19 carriers and Kana fragments mol ratio are 1:5, according to following sample-adding body
System is loaded, and blank control group and experimental group do 3 groups of repetitions, 25 DEG C are placed in after mixing, 10min.
Reaction system is as follows：
4th, bacillus coli DH 5 alpha competent cell is converted
B1-B3 and E1-E3 reaction products 10ul in above-mentioned steps 3 is converted bacillus coli DH 5 alpha competent cell, ice
After bathing 30min, 42 DEG C of heat shock 90S, ice bath 5min, 500ul LB nonreactive fluid nutrient mediums are added, 37 DEG C, 250rpm, vibration is trained
Support 45min.
5th, LB Amp resistance solid medium flat boards are applied
The cultured products that above-mentioned steps 4 obtain are placed in 5000Rpm/min centrifuge 3min, remove supernatant
400ul, remaining 200ul liquid are equably coated on LB Amp resistance solid medium flat boards after being blown and beaten uniformly with pipettor,
After 37 DEG C of incubators are incubated overnight 16-18h, hickie quantity is counted, as a result as shown in Figure 11,12.
6th, result counts
Experimental data shows that gene cloning can be achieved in 1U T7 exonucleases, and clone's number is up to 600 or so.
Embodiment 4
1st, the linearisation of cloning vector
According to the gene order of pUC19 plasmids, enter performing PCR using the PUC19-F primers and PUC19-R primers of synthesis and expand
Increase, PCR uses the high-fidelity amplification system (E035, Novoprotein) of our company, and the requirement of reaction system to specifications is matched somebody with somebody
System.
Synthetic primer sequence is as follows：
PUC19-F：GAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTG’
PUC19-R：
GTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAG
PCR reaction conditions are：Step 1. 94 degrees Celsius 5 minutes；Step 2. 94 degrees Celsius 20 seconds, 55 degrees Celsius 20 seconds, 72
Degrees Celsius 90 seconds, 30 circulations；Step 3. 72 degrees Celsius 5 minutes.PCR primer is reclaimed, 1% agarose gel electrophoresis detects,
Obtain size correctly single band (see Figure 13).
2nd, the acquisition of target DNA fragment
According to linearized vector pUC19 both ends gene order, carried out using the Kana-F primers and Kana-R primers of synthesis
PCR is expanded, and PCR uses the high-fidelity amplification system of our company, and the requirement of reaction system to specifications is prepared.
Synthetic primer sequence is as follows：
Kana–F：GACGGCCAGTGAATTCATGAGCCATATTCAACGG
Kana-R：ATGCCTGCAGGTCGACTTAGAAAAACTCATCGA
PCR reaction conditions are：Step 1. 94 degrees Celsius 5 minutes；Step 2. 94 degrees Celsius 20 seconds, 55 degrees Celsius 20 seconds, 72
Degrees Celsius 30 seconds, 30 circulations；Step 3. 72 degrees Celsius 5 minutes.PCR primer is reclaimed, 1% agarose gel electrophoresis detects,
Obtain size correctly single band (see Figure 14).
3rd, T7 exonucleases digestion Puc19 carriers and Kana fragments
The dosage of T7 exonucleases is 40U, and Puc19 carriers and Kana fragments mol ratio are 1:5, according to following sample-adding body
System is loaded, and blank control group and experimental group do 3 groups of repetitions, 25 DEG C are placed in after mixing, 10min.
Reaction system is as follows：
4th, bacillus coli DH 5 alpha competent cell is converted
B1-B3 and E1-E3 reaction products 10ul in above-mentioned steps 3 is converted bacillus coli DH 5 alpha competent cell, ice
After bathing 30min, 42 DEG C of heat shock 90S, ice bath 5min, 500ul LB nonreactive fluid nutrient mediums are added, 37 DEG C, 250rpm, vibration is trained
Support 45min.
5th, LB Amp resistance solid medium flat boards are applied
The cultured products that above-mentioned steps 4 obtain are placed in 5000Rpm/min centrifuge 3min, remove supernatant
400ul, remaining 200ul liquid are equably coated on LB Amp resistance solid medium flat boards after being blown and beaten uniformly with pipettor,
After 37 DEG C of incubators are incubated overnight 16-18h, hickie quantity is counted, as a result as shown in Figure 15,16.
6th, result counts
Experimental data shows that gene cloning can be achieved in 40U T7 exonucleases, and clone's number is up to 2000 or so.
Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, without departing from the technical principles of the invention, some improvement and deformation can also be made, these are improved and deformation
Also it should be regarded as protection scope of the present invention.
Sequence table
<110>Wujiang Alongshore Protein Technology Co., Ltd.
<120>The application of DNA excision enzymes and the method for seamless clone
<141> 2017-10-11
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 47
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gaattcactg gccgtcgttt tacaacgtcg tgactgggaa aaccctg 47
<210> 2
<211> 43
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gtcgacctgc aggcatgcaa gcttggcgta atcatggtca tag 43
<210> 3
<211> 34
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gacggccagt gaattcatga gccatattca acgg 34
<210> 4
<211> 33
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
atgcctgcag gtcgacttag aaaaactcat cga 33
Claims (11)
- The application of 1.DNA excision enzymes, it is characterised in that：The DNA excision enzymes are applied to DNA and recombinate seamless clone.
- 2. the application of DNA excision enzymes according to claim 1, it is characterised in that：The DNA excision enzymes are the circumscribed core of double-strand Sour enzyme.
- 3. the application of DNA excision enzymes according to claim 1, it is characterised in that：The DNA excision enzymes are T5 Exonucleolytics Enzyme, T7 exonucleases, any of which or several mixtures of exonucleaseⅲ or Lambda exonucleases.
- A kind of 4. kit that seamless clone is recombinated for constructed dna, it is characterised in that：The kit includes DNA excision enzymes And reaction buffer.
- A kind of 5. kit for being used to build recombinant dna fragment according to claim 4, it is characterised in that：Outside the DNA Enzyme cutting be T5 exonucleases, T7 exonucleases, exonucleaseⅲ or Lambda exonucleases any of which or Several mixtures.
- A kind of 6. kit for being used to build recombinant dna fragment according to claim 5, it is characterised in that：The reaction Buffer solution includes 10~100mM KAc, 20~100mM Tris-Ac, 1~20mM Mg (Ac) 2 and 1~5mM DTT.
- A kind of 7. kit for being used to build recombinant dna fragment according to claim 6, it is characterised in that：Outside the DNA Enzyme cutting and reaction buffer are to load in mixture or separately pack in advance.
- A kind of 8. kit for being used to build recombinant dna fragment according to claim 5, it is characterised in that：Outside the DNA The solution ph of enzyme cutting and the reaction buffer is 6~9.
- 9. the seamless cloning process of application DNA excision enzymes, it is characterised in that：The seamless cloning process uses DNA excision enzymes, institute It is as follows to state seamless cloning process step,The linearisation of step 1 carrier；The acquisition of step 2 target gene fragment；The circumscribed ferment treatment linearized vectors of step 3DNA and target DNA fragment；Step 4 converts competent escherichia coli cell.
- 10. the seamless cloning process according to claim 9 using gene excision enzyme, it is characterised in that：Described seamless gram Grand method uses DNA excision enzymes, and the seamless cloning process step is as follows,The linearisation of step 1 carrier, step are by PCR method either digestion with restriction enzyme method that carrier is linear Change；The acquisition of the step 2 target gene fragment, step are to be introduced and carrier two by PCR at the both ends of target DNA fragment The homologous homologous sequence of end difference, the target gene fragment expanded；The circumscribed ferment treatment linearized vector of the step 3DNA and target DNA fragment, step are after the step 2 is handled After purpose fragment and the linearized vector after the step 1 processing mix, the DNA excision enzymes and reaction solution warm bath are added, Obtain carrier and fragment mixture；The step 4 converts competent escherichia coli cell, and step is mixed for the carrier and fragment obtained using the step 3 Compound converts competent escherichia coli cell.
- 11. the seamless cloning process according to claim 10 using gene excision enzyme, it is characterised in that：Outside the DNA Enzyme cutting is double-strandednucleic acid excision enzyme, and the dosage of the double-strandednucleic acid excision enzyme is 0.01U~40U, carrier and Insert Fragment mole Than for 1：1~1:5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710939294.8A CN107760706A (en) | 2017-10-11 | 2017-10-11 | The application of DNA excision enzymes and the method for seamless clone |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710939294.8A CN107760706A (en) | 2017-10-11 | 2017-10-11 | The application of DNA excision enzymes and the method for seamless clone |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107760706A true CN107760706A (en) | 2018-03-06 |
Family
ID=61267863
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710939294.8A Pending CN107760706A (en) | 2017-10-11 | 2017-10-11 | The application of DNA excision enzymes and the method for seamless clone |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107760706A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108841901A (en) * | 2018-07-16 | 2018-11-20 | 山东大学 | It is a kind of to rely on the kit and its application that T5 exonuclease and PEG8000 completion DNA are assembled |
| CN112063642A (en) * | 2020-09-04 | 2020-12-11 | 湖北大学 | Premixed liquid for constructing recombinant plasmid by relying on T5 exonuclease and application thereof |
| CN112877324A (en) * | 2021-01-28 | 2021-06-01 | 杭州师范大学 | DNA cloning method |
| CN113667649A (en) * | 2021-09-08 | 2021-11-19 | 苏州博特龙免疫技术有限公司 | Reaction mixed reagent for lightning cloning and preparation method and application thereof |
| CN114875098A (en) * | 2022-06-29 | 2022-08-09 | 四川大学 | Kit for carrying out seamless assembly on multiple DNA fragments and assembly vector and application method thereof |
| WO2024022253A1 (en) * | 2022-07-29 | 2024-02-01 | 重庆精准生物技术有限公司 | Linearized mrna preparation system, use thereof, and preparation method for preparing mrna by using same |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321660A (en) * | 2011-09-28 | 2012-01-18 | 厦门大学 | Method for cloning deoxyribonucleic acid (DNA) |
| CN103160495A (en) * | 2011-12-15 | 2013-06-19 | 张力军 | Disconnected dependent rapid cloning method |
-
2017
- 2017-10-11 CN CN201710939294.8A patent/CN107760706A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102321660A (en) * | 2011-09-28 | 2012-01-18 | 厦门大学 | Method for cloning deoxyribonucleic acid (DNA) |
| CN103160495A (en) * | 2011-12-15 | 2013-06-19 | 张力军 | Disconnected dependent rapid cloning method |
Non-Patent Citations (1)
| Title |
|---|
| 史晏榕等: "DNA克隆和组装技术研究进展", 《微生物学通报》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108841901A (en) * | 2018-07-16 | 2018-11-20 | 山东大学 | It is a kind of to rely on the kit and its application that T5 exonuclease and PEG8000 completion DNA are assembled |
| WO2020015306A1 (en) * | 2018-07-16 | 2020-01-23 | 山东大学 | Kit for completing dna assembly depending on t5 exonuclease and peg8000 and use thereof |
| CN108841901B (en) * | 2018-07-16 | 2022-03-15 | 山东大学 | Kit for completing DNA assembly by relying on T5 exonuclease and PEG8000 and application thereof |
| CN112063642A (en) * | 2020-09-04 | 2020-12-11 | 湖北大学 | Premixed liquid for constructing recombinant plasmid by relying on T5 exonuclease and application thereof |
| CN112877324A (en) * | 2021-01-28 | 2021-06-01 | 杭州师范大学 | DNA cloning method |
| CN113667649A (en) * | 2021-09-08 | 2021-11-19 | 苏州博特龙免疫技术有限公司 | Reaction mixed reagent for lightning cloning and preparation method and application thereof |
| CN114875098A (en) * | 2022-06-29 | 2022-08-09 | 四川大学 | Kit for carrying out seamless assembly on multiple DNA fragments and assembly vector and application method thereof |
| WO2024022253A1 (en) * | 2022-07-29 | 2024-02-01 | 重庆精准生物技术有限公司 | Linearized mrna preparation system, use thereof, and preparation method for preparing mrna by using same |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107760706A (en) | The application of DNA excision enzymes and the method for seamless clone | |
| Wang et al. | CRISPR/Cas9 nuclease cleavage combined with Gibson assembly for seamless cloning | |
| Ma et al. | CRISPR/Cas9‐based multiplex genome editing in monocot and dicot plants | |
| CN107075511B9 (en) | Formation of synthons | |
| Wang et al. | Gene transcription repression in Clostridium beijerinckii using CRISPR‐dCas9 | |
| CN110358767B (en) | Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application thereof | |
| RU2766717C1 (en) | Method for editing dna in an acellular system | |
| Adalsteinsson et al. | Efficient genome editing of an extreme thermophile, Thermus thermophilus, using a thermostable Cas9 variant | |
| US20220170072A1 (en) | Programmable dna-guided artificial restriction enzymes | |
| Mohanraju et al. | Development of a Cas12a-based genome editing tool for moderate thermophiles | |
| Lee et al. | Cytosine base editing in cyanobacteria by repressing archaic Type IV uracil‐DNA glycosylase | |
| Hook et al. | A novel approach for Escherichia coli genome editing combining in vivo cloning and targeted long-length chromosomal insertion | |
| Sultan et al. | Formulation of an efficient combinatorial cellulase cocktail by comparative analysis of gibson assembly and NEBuilder HiFi DNA assembly Modus Operandi | |
| Dong et al. | A single digestion, single-stranded oligonucleotide mediated PCR-independent site-directed mutagenesis method | |
| US20230159955A1 (en) | Circular-permuted nucleic acids for homology-directed editing | |
| Walker et al. | A method for generating sticky-end PCR products which facilitates unidirectional cloning and the one-step assembly of complex DNA constructs | |
| CN103074358B (en) | Method for simulating recombination and non-trace cloning | |
| EP4048803A1 (en) | Modified double-stranded donor templates | |
| CN104404029A (en) | Mutation method based on methylation circular DNA molecules | |
| Li et al. | A Novel Method to Construct Binary CRISPR Vectors for Plant Transformation by Single Round of PCR Amplification | |
| KR102049238B1 (en) | Stimulation of the polymerization of poly A tail by Poly(A) polymerase by inorganic Pyrophosphatase | |
| WO2018147070A1 (en) | Method for producing dna fragments having desired base sequence | |
| Meng et al. | Establishing a straight-forward I-SceI mediated recombination one plasmid system for efficient genome editing in P. putida KT2440 | |
| Panicker | Genome Editing and CRISPR/Cas System of Extremophiles and Its Applications | |
| Xu et al. | Cas9 Nickase-Based Genome Editing in Clostridium cellulolyticum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |