CN104388456A - Construction method of vector capable of simultaneously expressing two sgRNAs - Google Patents
Construction method of vector capable of simultaneously expressing two sgRNAs Download PDFInfo
- Publication number
- CN104388456A CN104388456A CN201410605326.7A CN201410605326A CN104388456A CN 104388456 A CN104388456 A CN 104388456A CN 201410605326 A CN201410605326 A CN 201410605326A CN 104388456 A CN104388456 A CN 104388456A
- Authority
- CN
- China
- Prior art keywords
- carrier
- sgrna
- vector
- construction process
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to a construction method of a vector capable of simultaneously expressing two sgRNAs. The construction method comprises the following steps: carrying out in-vitro synthesis of single-chain nucleotide chains and forming double-chain DNA fragments; by utilizing a PCR system, annealing two single-chain nucleotides and extending the two single-chain nucleotides to the double-chain DNA fragments, and carrying out electrophoresis for identifying; carrying out enzyme digestion on a vector 42229 by BbsI, and carrying out fragment insertion by the linearized vector 42229 and the annealed and extended insertion fragments by a homologous recombination method to construct the vector. According to the construction method of the vector, the subsequent vector purifying and transfecting steps are simplified in knockout of a plurality of genetic loci, so that the gene knockout efficiency is improved.
Description
Technical field
The invention belongs to crRNA field, particularly a kind of construction process of simultaneously expressing the carrier of two sgRNA.
Background technology
1987, seminar of Japan finds interval tumor-necrosis factor glycoproteins (the Ishino Y that connects near the alkaline phosphatase gene of E.coli K12, Shinagawa H, Makino K, et al.Nucleotide sequence of the iap gene, responsible for alkalinephosphatase isozyme conversion in Escherichia coli, and identification of the gene produce.JBacteriol, 1987, 169 (12): 5429-5433), in research afterwards, find that this kind of interval tumor-necrosis factor glycoproteins is extensively present in the genome of bacterium and Archimycetes, in 2002, be rule cluster interval short and small palindrome tumor-necrosis factor glycoproteins (CRISPR) (Jansen R by scientist's definite designation, van Embden J D, Gaastra W, et al.Identification of a novel family of sequencerepeats among prokaryotes.Omics:a journal of Intearative Biology, 2002, 6 (1): 23-33, Mojica FJ, Ferrer C, Juez G, et al.Long stretches of short tandem repeats are present in the largest replicons ofthe archaea Haloferax mediterranei and Haloferax volcanii and could be involved in repliconpartitioning.Mol Microbiol, 1995,17 (1): 85-93, Jansen R, Embden J D, Gaastra W, et al.Identificationof genes that are associated with DNA repeats in prokaryotes.MolMicrobiol, 2002,43 (6): 1565-1575).
CRISPR discovery is a kind of immunity system of a kind of bacterium and Archimycetes, it is had the DNA sequence dna institute interval of the uniqueness of similar size by the short and small conservative tumor-necrosis factor glycoproteins of row, the DNA sequence dna of uniqueness is called a transcribed spacer, and these transcribed spacers derive from phage or plasmid DNA usually.CRISPR row and Cas (CRISPR-associated) gene form CRISPR-Cas and adapt to immunity system (Horva th, P.and Barrangou, R. (2010) CRISPR/Cas, the immune system of bacteria and archaea.Science 327,167 – 170; Barrangou, R.et al. (2007) CRISPR provides acquiredresistance against viruses in prokaryotes.Science 315,1709 – 1712; Gasi unas, G.et al. (2013) Molecular mechanisms of CRISPR-mediated microbial immunity.Cel l Mol.Life Sci.http: //dx.doi.or g/10.1007/s00018-013-1438-6).The function of CRISPR/Cas system exercises like this: the nucleic acid fragment of invasion is integrated with host genome as transcribed spacer, subsequently using these transcribed spacers as template, produce small RNA molecular (crRNA), these crRNA can become effect mixture with Cas protein binding, and exogenous nucleic acid silence can be fallen by it in the infecting of next round.
Type II system only needs Cas9 albumen just to may be used for DNA interference (Mojica F J, Diez-VillasenorC, Garcia-Martinez J, et al.Intervening sequences of regularly spaced prokaryotic repeats derive fromforeign genetic elements.J Mol Evol, 2005,60 (2): 174-182; Sapranauskas, R.et al. (2011) TheStreptococcus thermophilus CRISPR/Cas system provides immunity in Escherichia coli.NucleicAcids Res.39,9275 – 9282; Deltcheva, E.et al. (2011) CRISPR RNA maturation by trans-encodedsmall RNA and host factor Rnase III.Nature 471,602 – 607; Garneau, J.E.et al. (2010) The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA.Nature 468,67 – 71.).Type II system carries out the step of the double-strand break of target gene: (i) pre-crRNA and tracrRNA gets off from CRISPR site is transcribed; (ii) the direct repetitive sequence hybridization in tracrRNA and pre-crRNA forms double-strand, and is combined with Cas9, and pre-crRNA forms ripe crRNA by RNase III and certain unknown nuclease effect.Short intervening sequence is included in the crRNA of this maturation; (iii) ripe crRNA:tracrRNA heteroduplex guides Cas9 albumen to target DNA site, DNA target spot need contain protospacer and required PAM (protospacer adjacent motif), and this process between protospacer DNA, forms heteroduplex by the intervening sequence of crRNA to have come; (iv) in the protein mediated target position DNA of Cas9, PAM upstream is sheared, in protospacer, carry out double-strand break.
At present for building crRNA, the carrier of trRNA and Cas9 can find respectively on Addgene, by expressing pre-crRNA and trRNA on a carrier simultaneously, the cell of originating with Cas9 expression vector cotransfection mouse or people, or by microinjection in the zygote of mammalian cell, can obtain carrying out the cell that knocks out or filial generation for specific gene.If simultaneously transfection, for the crRNA of two or more gene or chromosomal foci, utilize CRISPR/Cas9 system to knock out in these genes or site, but at present, this have not been reported to the carrier of expressing many crRNA simultaneously simultaneously.
Summary of the invention
The invention provides a kind of construction process of simultaneously expressing the carrier of two sgRNA, thus in polygenic locus knocks out, simplify follow-up vector purification and transfection procedure, improve the efficiency of gene knockout.
A kind of construction process of simultaneously expressing the carrier of two sgRNA of the present invention, comprising:
(1) external synthesizing single-stranded nucleotide chain, utilizes PCR system, is annealed and extends to double chain DNA fragment, electroresis appraisal by two single-stranded nucleotide; Wherein, single-stranded nucleotide chain is:
insert-F:
GAATGGTCCCAAAACGGGTCTTCGAGAAGACGTTTTAGAGCTATGCTGTTTTGAATGGT；
insert-R:
GCATAGCTCTAAAACGAAGAGCTCGCTCTTCCGTTTTGGGACCATTCAAAACAGCATAG；
(2) 42229 carrier Bbs I carry out enzyme and cut, and the double chain DNA fragment after the carrier 42229 after linearizing and step (1) annealing extend carries out fragment insertion by the method for homologous recombination.
Fragment in described step (1) comprises 19nt two single-stranded nucleotide chain complementary pairing sequences, Bbs I restriction enzyme site, SapI restriction enzyme site, the sequence of 15nt and 42229Bsb I restriction enzyme site two ends sequence homology.
In described step (1), the nucleotide single-chain of synthesis sgRNA is annealed, and extends; PCR system: add ddH
2o 10ul, GT Buffer 1.5ul, dNTP 1.5ul, positive and negative strand (10P) 1.5ul, BSA 0.2ul, taq enzyme 1ul; PCR program: 95 DEG C of 2min, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 1min) 5 circulation, 72 DEG C of 10min.
The sepharose of 2% is adopted to carry out electroresis appraisal in described step (1).
The vector competent escherichia coli cell DH5 α that described step (2) obtains, the agarose LB flat board being applied to 1% ammonia benzyl resistance, to growing bacterium colony, carries out PCR qualification with following pair of primers to single bacterium colony; 42229-BbsI-L:5 ' TGTGGAAAGGACGAAACACC, 42229-BbsI-R:5 ' CGCGCTAGAAAAAGTTTTGG.
PCR system: add ddH2O 9.3ul, GT Buffer 1.5ul, dNTP 1.5ul, Primer (2P) 1.5ul, BSA 0.2ul, taq enzyme 1ul, last picking list bacterium colony is as template; PCR program: 95 DEG C of 2min, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 1min30sec) 40 circulation, 72 DEG C of 10min; Obtain positive colony candidate, choose single bacterium colony and shake bacterium and obtain bacterium liquid, get 1ml bacterium liquid and 20ul 10P upstream and downstream primer (upstream primer, each 10P of downstream primer), transfer to biotech firm to carry out the two-way order-checking of business.
The present invention is constructed by the transformation to Addgene42229, is originally expressing on the basis of a crRNA, realizes expression two or more crRNA simultaneously.The collection of illustrative plates of plasmid Addgene42229 as shown in Figure 2, introduces a tumor-necrosis factor glycoproteins DR again at DR-BB-DR sequence downstream, and adds suitable restriction enzyme site in this tumor-necrosis factor glycoproteins upstream, to facilitate the clone of Article 2 crRNA.Because this carrier can express trRNA and Cas9 albumen simultaneously, therefore by by this carrier transfection mammalian cell, can realize carrying out gene knockout to two target sites, with the Study of the Realization gene function, and the object of two gene interactions.
On 42229 carriers, DR-BB-DR region sequence is as follows:
5’-GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACggGTCTTCgaGAAGACGTTTTAGAGCTAT GCTGTTTTGAATGGTCCCAAAACTTTTT-3’
Between two tumor-necrosis factor glycoproteins DR, there is the Bbs I restriction enzyme site (red capitalization mark be BbsI recognition site) of both direction, this carrier obtains following sticky end after Bbs I enzyme is cut:
5’----TGGTCCCA……TTTAGAGCTATG----3’
3’----ACCAGGGTTTTC……CTCGATAC----5’
Intend inserting following fragment at this cohesive end:
5’-AAACggGTCTTCgaGAAGACGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACgGAAGAGCgaGCTCTTCGT-3’
3’-ccCAGAAGctCTTCTGCAAAATCTCGATACGACAAAACTTACCAGGGTTTTGcCTTCTCGctCGAGAAGCAAAAT-5’
Above fragment comprises Bbs I recognition sequence and the Sap I recognition sequence of two Opposite direction connections, is DR tumor-necrosis factor glycoproteins between them.DR-BB-DR-BB-DR form is formed after inserting:
(each arrow represents cleavage site when inserting sgRNA)
This carrier can access one or two sgRNA sequence easily.
beneficial effect
The present invention constructs the carrier simultaneously can expressing the sgRNA for two gene locuss in mammalian cell, in actual applications, can as required for two chromosomal focis that will knock out or gene design sgRNA, and by two different restriction enzymes, whether different to the shear efficiency of homologous genes for studying different sgRNA; The present invention is the tumor-necrosis factor glycoproteins fragment inserting synthesis at the Bbs I restriction enzyme site of 42229 carriers, is identified and checked order obtaining positive colony by bacterium colony PCR.Thus obtain sgRNA and the Cas9 co-expression carrier that simultaneously can insert two sgRNA.
Accompanying drawing explanation
Fig. 1 is the design of graphics that the present invention expresses two sgRNA carrier;
Fig. 2 is the Insert Fragment of 42229;
Fig. 3 is the PCR result of co-expression carrier;
Fig. 4 is sequencer map.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.In addition should be understood that those skilled in the art can make various changes or modifications the present invention, and these equivalent form of values fall within the application's appended claims limited range equally after the content of having read the present invention's instruction.
Embodiment 1
(1) external synthesizing single-stranded nucleotide chain, and form DNA double chain fragment
Insert Fragment (Insert Fragment comprises 19nt two single-stranded nucleotide chain complementary pairing sequences, Bbs I restriction enzyme site, Sap I restriction enzyme site, the sequence of 15nt and 42229Bsb I restriction enzyme site two ends sequence homology) in 42229
insert-F:
GAATGGTCCCAAAACGGGTCTTCGAGAAGACGTTTTAGAGCTATGCTGTTTTGAATGGT
insert-R:
GCATAGCTCTAAAACGAAGAGCTCGCTCTTCCGTTTTGGGACCATTCAAAACAGCATAG。
Utilize PCR system, annealed and extend to double chain DNA fragment by two single-stranded nucleotide, sequence length is 98bp, and is undertaken identifying (Fig. 2) by 2% agarose gel electrophoresis.PCR system: add ddH
2o 10ul, GT Buffer 1.5ul, dNTP1.5ul, positive and negative strand (10P) 1.5ul, BSA 0.2ul, taq enzyme 1ul.PCR program: 95 DEG C of 2min, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 1min) 5 circulation, 72 DEG C of 10min.
The structure of (2) 42229 pairs of sgRNA/Cas9 co-expression carriers
42229 carrier Bbs I carry out enzyme and cut, Insert Fragment after carrier 42229 after linearizing and annealing extend carries out fragment insertion by the method for homologous recombination, and transform competent escherichia coli cell DH5 α processed, be applied to the agarose LB flat board of 1% ammonia benzyl resistance to growing bacterium colony, with following pair of primers, PCR qualification is carried out to single bacterium colony, 42229-BbsI-L:
5’TGTGGAAAGGACGAAACACC，42229-BbsI-R：5’CGCGCTAGAAAAAGTTTTGG。
Agarose gel electrophoresis qualification (Fig. 3) of 2%, short-movie section illustrates does not have object fragment to insert, and occurs that long segment illustrates have object fragment to insert.PCR system during bacterium colony PCR identifies: add ddH
2o 9.3ul, GT Buffer 1.5ul, dNTP 1.5ul, Primer (2P) 1.5ul, BSA 0.2ul, taq enzyme 1ul, last picking list bacterium colony is as template.PCR program: 95 DEG C of 2min, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 1min30sec) 40 circulation, 72 DEG C of 10min; Obtain positive colony candidate, choose single bacterium colony and shake bacterium and obtain bacterium liquid, get 1ml bacterium liquid and 20ul 10P upstream and downstream primer (upstream primer, each 10P of downstream primer), transfer to biotech firm to carry out the two-way order-checking of business.
(3) base in order to ensure Insert Fragment is right-on, subsequently the positive colony that bacterium colony PCR filters out is carried out order-checking qualification (Fig. 4).
It is correct that order-checking obtains on position, and the positive colony that sequence is correct equally, thus obtain the sgRNA/Cas9 co-expression carrier that simultaneously can insert two sgRNA.By this carrier, can knock out two genes in same genome.
Claims (5)
1. express a construction process for the carrier of two sgRNA simultaneously, comprising:
(1) external synthesizing single-stranded nucleotide chain, utilizes PCR system, is annealed and extends to double chain DNA fragment, electroresis appraisal by two single-stranded nucleotide; Wherein, single-stranded nucleotide chain is:
insert-F:
GAATGGTCCCAAAACGGGTCTTCGAGAAGACGTTTTAGAGCTATGCTGTTTTGAATGGT；
insert-R:
GCATAGCTCTAAAACGAAGAGCTCGCTCTTCCGTTTTGGGACCATTCAAAACAGCATAG；
(2) 42229 carrier Bbs I carry out enzyme and cut, and the double chain DNA fragment after the carrier 42229 after linearizing and step (1) annealing extend carries out fragment insertion by the method for homologous recombination.
2. a kind of construction process of carrier of simultaneously expressing two sgRNA as claimed in claim 1, it is characterized in that: the fragment in described step (1) comprises 19nt two single-stranded nucleotide chain complementary pairing sequences, Bbs I restriction enzyme site, Sap I restriction enzyme site, the sequence of 15nt and 42229 Bsb I restriction enzyme site two ends sequence homologies.
3. a kind of construction process of carrier of simultaneously expressing two sgRNA as claimed in claim 1, is characterized in that: PCR system in described step (1): add ddH2O 10ul, GT Buffer, 1.5ul, dNTP 1.5ul, positive and negative strand 1.5ul, BSA 0.2ul, taq enzyme 1ul; PCR program: 95 DEG C of 2min; 95 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 1min, 5 circulations; 72 DEG C of 10min.
4. a kind of construction process of carrier of simultaneously expressing two sgRNA as claimed in claim 1, is characterized in that: adopt the sepharose of 2% to carry out electroresis appraisal in described step (1).
5. a kind of construction process of carrier of simultaneously expressing two sgRNA as claimed in claim 1, it is characterized in that: the vector competent escherichia coli cell DH5 α that described step (2) obtains, the agarose LB flat board being applied to 1% ammonia benzyl resistance, to growing bacterium colony, carries out PCR qualification with following pair of primers to single bacterium colony; 42229-BbsI-L:
5’TGTGGAAAGGACGAAACACC，42229-BbsI-R：5’CGCGCTAGAAAAAGTTTTGG；
PCR system: add ddH
2o 9.3ul, GT Buffer 1.5ul, dNTP 1.5ul, primer 1.5ul, BSA 0.2ul, taq enzyme 1ul, last picking list bacterium colony is as template;
PCR program: 95 DEG C of 2min; 95 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 1min30s, 40 circulations, 72 DEG C of 10min; Obtain positive colony candidate, choose single bacterium colony and shake bacterium and obtain bacterium liquid, get 1ml bacterium liquid and 20ul 10P upstream and downstream primer, check order.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410605326.7A CN104388456A (en) | 2014-10-31 | 2014-10-31 | Construction method of vector capable of simultaneously expressing two sgRNAs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410605326.7A CN104388456A (en) | 2014-10-31 | 2014-10-31 | Construction method of vector capable of simultaneously expressing two sgRNAs |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104388456A true CN104388456A (en) | 2015-03-04 |
Family
ID=52606413
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410605326.7A Pending CN104388456A (en) | 2014-10-31 | 2014-10-31 | Construction method of vector capable of simultaneously expressing two sgRNAs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388456A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894071A (en) * | 2015-06-08 | 2015-09-09 | 东华大学 | Method for carrying out gene edition on GT1-7 cells |
| CN105567718A (en) * | 2016-01-22 | 2016-05-11 | 东华大学 | Building method of carrier for expressing multiple sgRNAs simultaneously |
| CN106755026A (en) * | 2016-12-18 | 2017-05-31 | 吉林大学 | The foundation of the structure and enamel hypocalcification model of sgRNA expression vectors |
| CN110835635A (en) * | 2018-08-16 | 2020-02-25 | 深圳华大生命科学研究院 | Plasmid construction method for promoting expression of multiple tandem sgRNAs by different promoters |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
| CN103820441A (en) * | 2014-03-04 | 2014-05-28 | 黄行许 | Method for human CTLA4 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting CTLA4 gene |
| CN103911376A (en) * | 2014-04-03 | 2014-07-09 | 南京大学 | CRISPR-Cas9 targeted knockout hepatitis b virus cccDNA and specific sgRNA thereof |
-
2014
- 2014-10-31 CN CN201410605326.7A patent/CN104388456A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103388006A (en) * | 2013-07-26 | 2013-11-13 | 华东师范大学 | Method for constructing gene site-directed mutation |
| CN103820441A (en) * | 2014-03-04 | 2014-05-28 | 黄行许 | Method for human CTLA4 gene specific knockout through CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat) and sgRNA(single guide RNA)for specially targeting CTLA4 gene |
| CN103911376A (en) * | 2014-04-03 | 2014-07-09 | 南京大学 | CRISPR-Cas9 targeted knockout hepatitis b virus cccDNA and specific sgRNA thereof |
Non-Patent Citations (1)
| Title |
|---|
| YUANWU MA ET AL: "HERITABLE MULTIPLEX GENETIC ENGINEERING IN RATS USING CRISPR/CAS9", 《PLOS》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894071A (en) * | 2015-06-08 | 2015-09-09 | 东华大学 | Method for carrying out gene edition on GT1-7 cells |
| CN105567718A (en) * | 2016-01-22 | 2016-05-11 | 东华大学 | Building method of carrier for expressing multiple sgRNAs simultaneously |
| CN105567718B (en) * | 2016-01-22 | 2021-11-09 | 东华大学 | Construction method of vector for simultaneously expressing multiple sgRNAs |
| CN106755026A (en) * | 2016-12-18 | 2017-05-31 | 吉林大学 | The foundation of the structure and enamel hypocalcification model of sgRNA expression vectors |
| CN110835635A (en) * | 2018-08-16 | 2020-02-25 | 深圳华大生命科学研究院 | Plasmid construction method for promoting expression of multiple tandem sgRNAs by different promoters |
| CN110835635B (en) * | 2018-08-16 | 2024-01-09 | 深圳华大生命科学研究院 | Plasmid construction method for promoting expression of multiple tandem sgRNAs by different promoters |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11692213B2 (en) | Compositions and methods for targeted depletion, enrichment, and partitioning of nucleic acids using CRISPR/Cas system proteins | |
| CN107083392B (en) | CRISPR/Cpf1 gene editing system and application thereof in mycobacteria | |
| KR101994953B1 (en) | How to Enhance Plant Resistance to Invasive DNA Viruses | |
| JP2020506667A5 (en) | ||
| US20170073663A1 (en) | Targeted remodeling of prokaryotic genomes using crispr-nickases | |
| CN107142272A (en) | A kind of method for controlling plasmid replication in Escherichia coli | |
| CN104212836A (en) | Method for knocking out mir-505 from mammal cell line | |
| CN107523567A (en) | A kind of construction method for the esophageal cancer cell strain for knocking out people's ezrin genetic enhancers | |
| CN104109687A (en) | Construction and application of Zymomonas mobilis CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-association proteins)9 system | |
| CN106995813A (en) | Genome large fragment Direct Cloning and DNA polymoleculars assembling new technology | |
| CN105567718B (en) | Construction method of vector for simultaneously expressing multiple sgRNAs | |
| Maguin et al. | Cleavage of viral DNA by restriction endonucleases stimulates the type II CRISPR-Cas immune response | |
| CN104388456A (en) | Construction method of vector capable of simultaneously expressing two sgRNAs | |
| JP6994730B2 (en) | Genome editing method for filamentous fungus genome editing by direct introduction of protein | |
| CN109706148A (en) | A kind of gRNA, gRNA composition and electric shifting method for knocking out BCL11A gene or BCL11A genetic enhancer | |
| CN111321101A (en) | Method for knocking out cytidine deaminase gene cdd in escherichia coli by using CRISPR-Cas9 technology and application | |
| CN105602972B (en) | Method based on CRISPR-Cas9 engineered ex vivo adenovirus vector | |
| CN110004145B (en) | sgRNA, knockout vector, knockout method of KLF4 gene and application thereof | |
| CN106497958A (en) | A kind of method of rapid build recombiant plasmid | |
| KR102648886B1 (en) | Method for modifying a target nucleic acid in the genome of a cell | |
| JP5129498B2 (en) | Nucleic acid cloning method | |
| CN111434771A (en) | Plasmid construction method for self-recombination of linearized vector | |
| KR102421129B1 (en) | Novel protospacer adjacent motif sequence and method for modifying a target nucleic acid in the genome of a cell using the same | |
| Perin et al. | Characterization of aapP and nopP genes related to the biological nitrogen fixation efficiency with soybean in contrasting strains of Bradyrhizobium japonicum | |
| JP2022549721A (en) | Nucleic acid delivery vectors containing circular single-stranded polynucleotides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150304 |