CN103074316B - For expressing, transmitting and the recombinant carrier molecule of purification of target polypeptides - Google Patents

Abstract

The invention provides and have from the recombinant carrier molecule of the aminoacid sequence of thermophilic enzyme and the method for exogenous array (peptide and polypeptide) for expressing, reclaiming and be delivered in vitro or in vivo produce in different system (bacterium, yeast, DNA, cell culture, such as Mammals, plant, insect cell culture, protoplastis and whole plant).The sequence from lichenase B (Lic B) is also used to prepare recombinant carrier molecule and discussed various target polypeptides are expressed, reclaim and transmitted to a part used as carrier proteins.

Description

For expressing, transmitting and the recombinant carrier molecule of purification of target polypeptides

The application is the applying date is on May 24th, 2004, and application number is 200480020879.0, and denomination of invention is for expressing, transmitting and the divisional application of application of recombinant carrier molecule of purification of target polypeptides.

According to 35U.S.C § 371, present application for patent is the American National phase application case of the PCT/US2004/016452 international application (international publication number is WO 2005/026375) in application on May 24th, 2004.According to 35U.S.C § 365 and 371, subject application advocates the right of priority of PCT/US2004/016452 international application case, the U.S. Provisional Patent Application case the 60/472nd that described international application claims was applied on May 22nd, 2003, the right of priority of No. 495.The full text of each above-mentioned application is incorporated herein with the form quoted.

Technical field

The present invention be directed to protein expression, purifying and biology field.Particularly, the present invention be directed to carrier proteins and express, wherein use the mature polypeptide of thermophilic enzyme as carrier molecule for generation, recovery and transmission target polypeptides.Carrier molecule is used in the different expression system and host comprising plant and mammalian cell cultures and produces exogenous array.

Background technology

Vaccine prevents and even eliminates the most effective means of communicable disease.Although have in a large number based on the effective vaccine of full pathogenic agent, the safer and more effective and more economical vaccine developed based on fraction of pathogens body (subunit vaccine) is very important.The method that some vaccine antigens are expressed (bacterium, yeast, mammalian cell cultures and plant) and transmitted (DNA, live vector, purifying protein, plant virus particle) has been worked out in past Two decades years.All these methods are on research and development and check the candidate vaccine recently developed to have remarkably influenced.But, need to improve express and transport system more effective and safer and there is the vaccine of less side effect with generation.Some feature desired by future vaccines is: (a) efficient (two arms of immune stimulatory system), b () has known and controlled gene composition, c () has system ageing, d () is suitable for expressing small peptides and large-scale both polypeptide, e () is suitable on different system (bacterium, yeast, mammalian cell cultures, live vector, DNA vector, transgenic plant and transient expression vector) middle expression, and (f) can form being easy to recovery and having immunogenic structure of such as aggregate (aggregate) or viroid particle (viruslike particle).

Therefore, the novel supports molecule being used for changing, develop and transmit effective subunit vaccine with engineering science is needed.These carrier molecules should provide following advantage and handiness: the target polypeptides of expressing commercial sufficient quantity in different system, target polypeptides is reclaimed economically from source material, hold the polypeptide of different size (4 amino acid and more), hold the target polypeptides that series winding repeats, the immunologic function of enhancing is provided, as high flux screening instrument, and be used as the tool for transmitting of vaccine immunogens and disease markers.

Summary of the invention

Find a kind of novel recombinant protein in the present invention.It is using as a kind of carrier molecule for expressing and reclaim useful target polypeptides, and these target polypeptides are used as antagonism communicable disease or the even therapeutic of cancer or preventative medicament.The carrier molecule found herein can hold the polypeptide (target polypeptides) of different size (4 amino acid is to the albumen or larger of 100kD) and can be expressed in different system.Target polypeptides can be vaccine antigen.

In general, the invention provides a kind of recombinant carrier molecule, what described recombinant carrier molecule had a thermophilic enzyme lacking one or more amino acid segment is modified to ripe polypeptide, or the mature polypeptide complete in fact of thermophilic enzyme, its be suitable for this mature polypeptide each N end and C holds and optionally in Huan Qu (loop region) with heterologous polypeptide.Be modified to thermostability and/or enzymic activity that ripe polypeptide and mature polypeptide complete in fact remain them.Modifying mature polypeptide is because it lacks ring district or has interrupted ring district, has at least one and non-natural and be present in restriction site (restriction site) in wild-type thermophilic enzyme in Huo Huan district.

In a preferred embodiment, the carrier molecule found herein is based on lichenase (lichinase B) (licB) gene (registration number: X63355, [gi:40697]) from Clostridium thermocellum (Clostridiumthermocellum).Present inventor finds that this thermally-stabilised bacterial enzyme can be used as producing target polypeptides carrier molecule.It has the ring texture be exposed to away from the surface in active territory.Present inventor has been found that this ring texture can be used for inserting target polypeptides.Described target polypeptides can be expressed as N end or C end merges or inside is merged and/or is expressed as ring texture inset.Express adorned protein and characterize its any parameter, the pH of such as thermostability, optimum activity and temperature condition.Engineered protein (engineered protein) maintains pH and the temperature condition of its optimum activity.Engineered protein does not change its thermostability at 65 DEG C yet.

Therefore, the present invention discloses the recombinant molecule being derived from thermophilic enzyme, and it is used as the carrier of various allos target polypeptides (such as vaccine, hormone, antithrombotics (anticoaulant), immunoglobulin (Ig), Interferon, rabbit, interleukin-(interleukin), hemopoieticgrowth factor etc.).Disclose Rec LicB and LicKM in a particular embodiment.Carrier proteins (namely connect one or more allos target polypeptides modified or engineering science change rec LicB or LicKM) for fusion rotein and its can be expressed in protokaryon or eucaryon system.Particularly have been found that these carrier molecules can hold short polypeptides to the large-scale polypeptide up to 100kD or more, the series winding that can hold phase homopolypeptide repeats; Can be expressed in different system, comprise bacterium, yeast, baculovirus, mammalian cell cultures, plant, DNA and virus vector; Because the ability of its thermostability or formation aggregate can provide the economical advantage reclaiming target product; Can be used as the high-throughput system of screening target polypeptides; Antigen, disease markers or other therapeutical peptide.

The present invention also discloses a kind of with the method for fusion protein form expression peptide, and described method is by the recombinant mature polypeptide of thermophilic enzyme being used as the carrier of heterologous polypeptide and using peptide expression method described in the invention.

Accompanying drawing explanation

Fig. 1 .A: the diagram changing restructuring LicKM carrier molecule with engineering science.1 is ring texture.A represents the upstream region of ring texture.C represents the downstream area of ring texture.For generating LicKM, splitting in ring differentiation and assembling the gene of coding Lic B as shown in the figure.To produce monospecific polyclonal site in engineering science change process.This figure part B shows the nucleotide sequence (SEQ ID NO:1) of engineered molecule LicKM.Auele Specific Primer is used to be divided by PCR.PCR produces 2 subclones (Figure 1A), called after A (159 Nucleotide, 364 to 522) and C (486 Nucleotide, 523 to 1009).In last clone, along the cloned downstream Segment A of fragment C, retain Original amino composition.

Fig. 1 C shows the Rec LicB structure from wild-type LicB.Rec LicB is made up of the maturation protein of not cellulose decomposition agent (cellulosome) binding domain.Target sequence can be held with N and C holds and merges, BamHI and BglII restriction site also can be used to merge in ring texture.

Fig. 1 D shows the nucleotide sequence (SEQ ID NO:2) of engineered molecule Rec LicB.

Fig. 1 E shows the aminoacid sequence (SEQ ID NO:3) of being encoded by LicKM nucleic acid (SEQ ID NO:1).

Fig. 1 F shows the aminoacid sequence (SEQ ID NO:4) of being encoded by Rec LicB (SEQ ID NO:2).

Fig. 1 G shows the nucleotide sequence (SEQ ID NO:5) of LicKM carrier molecule varient.It has equally at the KpnI restriction site of 5' end generation with in the XhoI restriction site of 3' end generation and the BamHI/Bgl site in ring district.

Fig. 1 H shows the aminoacid sequence (SEQ IDNO:6) of being encoded by LicKM carrier molecule varient (SEQ ID NO:5).

Fig. 2. GFP is cloned in the ring texture of rec Lic B to obtain the diagram of restructuring Lic B-GFP.The coding region of GFP is through pcr amplification and be cloned in the open reading frame (open reading frame) of LicB.

Clone is completed by PCR by 2 steps.Primer shown in the legend of Fig. 1 is used to produce 2 subclone A and C.Then the sequence (holding respectively in conjunction with BamHI and BglII restriction site at 5' end and 3' in PCR process) of these codings of pcr amplification GFP.Then, use BamHI and the BglII site of introducing that 3 fragments are connected into A-GFP-C to obtain LicB-GFP.The primer of GFP is:

Normal chain: 5'gcag gga tcc atg gtg agc aag ggc gag3'(SEQ ID NO:7)

Anti-chain: 5'gcag aga tct ctt gta cag ctc gtc cat3'(SEQ ID NO:8).

Fig. 3. there is the zymogram of lichenase (lichenase) activity in lower bacterial detection and yeast extract at 0.1% lichenstarch (lichenan) as matrix.Protein isolate in 12%PAGE.Be loaded into by E.coli strain X L-1blue [C contrast in gel, LicB (wild-type), LicKM (engineered vector molecule) and restructuring LicB-GFP (E)] and yeast saccharomyces cerevisiae (Saccharromyces cerevisiae) the bacterial strain YPH 857 (albumen extracted in LicB-GFP (Y).

Fig. 4. in engineered vector molecule L icKM, clone the diagram of target polypeptides.The DNA fragmentation of target polypeptides of the coding G-protein from respiratory syncytial virus (respiratory syncytial virus) (RSV), the green fluorescent protein (GFP) from gely fish and human interferon α (IFN α) is through pcr amplification and be inserted in the open reading frame of LicKM.

The zymogram of the lichenstarch enzymic activity that Fig. 5 .A detects under 0.1% lichenstarch exists as matrix in bacterial extract.Protein isolate in 12%PAGE.The albumen extracted from E.coli strain X L-1blue is loaded in gel.C is negative control.LicKM is engineered vector molecule.LicKM-RSV, LicKM-GFP and LicKM-IFN α is the engineered protein respectively containing target polypeptides.B shows western blot analytical results.Protein isolate in 12%PAGE, by its electroblotting to nylon membrane and make it with to the peptide from RSV G-protein, there is specific monoclonal antibody reactive.Antibody reacts with the plant virus coating protein (RSV (plant)) containing identical peptide with LicKM-RSV, RSV positive control (RSV (C+)).LicKM extract not containing target peptide does not have specificity to RSV antibody.

Fig. 6. through RSV G peptide-specific serum antibody (IgG) response of the mouse of LicKM-RSV abdominal injection (i.p.) immunity.The plate being coated with restructuring A1MV particle uses ELISA to measure serum antibody response, and these restructuring A1MV particle contains the identical peptide (amino acid/11 71 to 191) being derived from RSV G-protein.The OD490 value that serum (LicKM-RSV is final) before data representative utilizes immunity after (LicKM-RSV Pre) and antigen the 3rd dosage obtains.Numeral 1,2,3 and 4 indicates individual animals.

Fig. 7. use Western analysis to carry out zymetology (A) to LicKM-F200 and detect with serology (B).Protein isolate in 12%PAGE.A is the zymogram of the lichenstarch enzymic activity detected in plant milk extract under 0.1% lichenstarch exists as matrix.LicKM-F200 (F200) with to LicKM, there is specific antibody response.Two kinds of methods all detect the albumen of desired size (47kD).

Fig. 8. the RSV F protein Specific serum antibodies (IgG) through the mouse of LicKM-F200 abdominal injection immunity is replied.The plate being coated with deactivation RSV long-chain is used to measure serum antibody response by ELISA.The OD490 value that serum (LicKM-F200 is final) before data representative utilizes immunity after (LicKM-F200Pre) and antigen the 3rd dosage obtains.Numeral 1,2,3 and 4 represent the immunity of collecting from individual animals before and Post-immunisation serum sample.

Fig. 9. the western blot analysis of restructuring LicKM-PAD4.By protein through electrophoretic separation (12%SDS-polyacrylamide gel), be transferred on film, and react with different antibodies.The all PA specific antibodies comprising monoclonal antibody 14B7 have identified LicKM-PAD4 or contrast PA.A1MV CP or LicKM as negative control does not have and any antibody response.

Embodiment

The present invention is based on following discovery: the carrier of many heredity fusion polypeptide (target polypeptides) that the recombinant forms of particular thermal stabilized enzyme can be used as expressing, stable, display, purifying and/or transmission are discussed or carrier molecule, these polypeptide are such as vaccine antigen, enzyme, antibody (strand) and therapeutical peptide.

The present invention especially discloses (i) from thermophilic enzyme and containing multiple thermally-stabilised carrier molecule derivative the heterologous polypeptide of carrier proteins, (ii) nucleic acid construct of codified recombinant carrier molecule of the present invention and carrier proteins, with cell and the organism of expressing structure conversion with carrier proteins, (iii) in cell and organism, manufacture the method for vaccine antigen, (iv) in animals and human beings body, excite the method producing immunne response, described immunne response is for carrier proteins, especially target antigen of the present invention, v () uses following carrier fusion to induce the body fluid of anti-infection property reagent and the method for cell response, and (vi) manufactures the method for multiple industrial enzyme (except thermophilic enzyme) and human cytokines.

Thermophilic enzyme is the polypeptide of functionating under 60 DEG C or higher temperature.Obtain in the thermophilic organisms that a large amount of thermophilic enzymes known in technique can find from the ground such as hot spring, Volcanic Region, and can be used as carrier molecule use.Lichenase B (LicB) albumen being derived from Clostridium thermocellum is the example of this thermophilic enzyme.Recombinant carrier molecule derivative from the thermophilic enzyme of natural source, i.e. any microbial source (bacterium and fungi) or synthetic source is contained in the present invention.The example of these enzymes is the lichenase B (people such as Piruzian, 2002, Mol Genet Genomics, 266:778-786), to obtain and at 80 DEG C of activated zytases of tool and xylosidase from Bacillus thermactarantis, from transformylase (the formiltransferase) (people such as Shima of methane addicted to the hot bacterium of height (Methanopyrus kandleri), Biochem Soc.Trans., 2004, 32:269-272), Taq polysaccharase, from the α-amylase (people such as Moreira of Aspergillus tamarii (Asperigillus tamarii), J.Basic Microbiology, 2004, beta-glucosidase enzyme (the people such as Wang 44:29-35) or from Thermusnonproteolyticus obtained, J.Bacteriology, 2003, 185:4248-55).

One of ordinary skill in the art know wild-type lichenase B (LicB) gene and albumen molecular structure (referring to, GenBank enters to hide registration number: X63355).Wild-type LicB has single peptide of 27 amino acid longs and the mature peptide of 235 amino acid longs.Mature peptide has the ring district of a catalytic domain and 12 amino acid (a.a.82-94).LicB is member's (lytic enzyme is hydrolyzed on beta glucan 1-4 position) of glycosyl hydrolase family and is heat-stable protein.The optimum temps of enzymic activity is within the scope of 65-70 DEG C.According to the 3D structure of wild-type Lic B, the N petiolarea of albumen and C petiolarea are co-located near active territory place.Outer shroud is positioned at away from active territory place and is exposed on the surface.

The restructuring thermophilic enzyme of the heterologous polypeptide that herein interchangeable term " carrier ", " carrier molecule " " recombinant carrier molecule " refer to for expressing, stablize, show, purifying and/or transmission and the thermophilic enzyme property translated of recombinating merge.Thermophilic enzyme be selected wild-type thermophilic enzyme be modified to ripe polypeptide, with regard to this meaning, it is recombinant chou.Adorned mature polypeptide lacks one or more amino acid moieties (or tandem or sections), but adorned mature polypeptide must keep its enzymic activity or thermostability.For example, described mature polypeptide can lack a Ge Huan district or 5 or more amino acid whose tandem.In addition, such as, destroying ring district is by the several amino acid of (i) introducing coded by least one single restriction site (unique restrictionsite); And/or (ii) is cut two parts (N end and C end portion) producing described mature polypeptide in the ring district of gene, wherein subsequently these two portions are changed (cycle arrangement) extremely from C end to the independent reading frame of N end with genetic engineering again.Therefore, original C end portion maintains the fused upstream with original N end portion.During this reengineering changes, can 5' end to hold with 3' and the inside that comprises corresponding to the position at position of fusion place in conjunction with single restriction site.Carry out recombinating making recombinated polypeptide edge-on in N end and C end by 5 or more amino acid whose impaired loop sections or tandem.

In content of the present invention, described single restriction site means and during engineering science changes, is introduced into restriction site in nucleic acid and it is present in the described unique site changed by engineering science in nucleic acid.

Or to be recombinant chou be thermophilic enzyme because it is completely or the in fact completely mature polypeptide of selected wild-type thermophilic enzyme and described recombinant chou coding nucleic acid hold with 3' at 5' end and optionally had single restriction site for hold at N and in C Duan Hehuan district and heterologous polypeptide in ring district.Single restriction site upstream is held, in conjunction with ATG codon at 5'.Single restriction site downstream is held, combination termination codon at 3'.One of ordinary skill in the art can know how by manufacturing carrier molecule of the present invention at the enterprising line operate of nucleic acid level.

In one embodiment, modify to make it to lack signal peptide and cellulose decomposition agent binding domain to utilize the monospecific polyclonal site of introducing ring district to manufacture recombinant chou LicB carrier molecule to wild-type LicB albumen.

Referring to the LicB shown in Fig. 1 C, wild-type LicB is made up of leading peptide (27 amino acid, refer to by Lp), mature polypeptide (235 amino acid is symbolically divided into 3 regions (A, 1 and C)), Pro-thr-frame and the cellulose decomposition agent binding domain that is expressed as C-BD.And Rec LicB is only containing the open reading frame of maturation protein (235a.a.) lacking Lp and C-BD sequence.But, still retain C-BD in certain embodiments.

In another embodiment, wild-type LicB albumen is modified to make jointly to delete its specific region and its specific region through resetting and exchanging to manufacture recombinant carrier molecule.Particularly varying cyclically N holds and C end regions (being expressed as A and C).For example, the recombinant carrier molecule being called LicKM herein can be prepared as follows.As described in Fig. 1 brief description, use primer sets to obtain Segment A and C, subsequently they are connected for C-A, Segment A is merged in the open reading frame of fragment C.LicKM retains the enzymic activity similar to wild-type and thermostability.

Carrier molecule recLicB and LicKM is only preferred and exemplary enzyme molecule.Should it is evident that, by these preferred vector molecules that suddenly change, such as, by deleting, increasing or replace amino acid or by making these molecular orientation evolvements (directed evolution) or gene rearrangement make, there is a large amount of variation that is identical or similar or more high thermal stability or equivalent recLicB or LicKM carrier molecule (and nucleotide sequence of coding equivalent molecules).One of ordinary skill in the art can understand how to perform replacement to reach equivalent or variation LicB base carrier molecule.Term variation vector molecule used herein will have the ability identical with recLicB or LicKM, to contribute to expressing, stable, display, purifying or transmit and at least one effect in heterologous polypeptide that described molecule merges.

Variation or equivalent barrier molecule will have and exemplary preferred molecule (such as LicKM or Rec LicB) amino acid similarity to a certain degree or identity.This amino acid whose similarity or identity are greater than 60% usually, are preferably greater than 75%, more preferably greater than 80%, still more preferably greater than 90%, and can be greater than 95%.Amino acid similarity or identity should be the highest at the critical area of carrier molecule (critical region), and described region determines the thermostability of molecule or relates to the 3-d modelling determining final its function vector responsible.In this connection, if some amino acid replace be acceptable and also these replace be in the region that activity is not critical or these replace be do not affect molecule three-dimensional structure conserved amino acid replace so they are expected.One class (nonpolar, as Ala, Val, Leu, Ile, Pro, Met, Phe, Trp; Without charge polarity, as Gly, Ser, Thr, Cys, Tyr, Asn, Gln; Alkalescence, as Lys, Arg, His; Or acid class, as Asp, Glu) in a seed amino acid by the another kind of amino acid in similar by conservative property replace substitute, as long as the not essential Shangdi of described replacement changes its thermostability or three-dimensional structure.In some instances, also non-conservation replacement can be carried out.Key factor is that these replace that should not detract significantly " variation vector molecule " promotes to express, stable, display, purifying or transmit the ability of at least one function in heterologous polypeptide.

Term used herein " carrier fusion or carrier proteins " generally refers to chimeric fusion polypeptide or albumen, and one of them or more than one heterologous polypeptide and carrier molecule merge.

The ordinary construction of carrier proteins can be such as following any one:

NH ₂-carrier molecule-heterologous polypeptide-COOH

NH ₂-label (tag)-cleavage site-carrier molecule-heterologous polypeptide-COOH

NH ₂-carrier molecule-cleavage site-heterologous polypeptide-COOH

NH ₂-label-carrier molecule-cleavage site-heterologous polypeptide-COOH

NH ₂-label-cleavage site-carrier molecule-heterologous polypeptide-COOH.

Described carrier molecule also can have inner fusion, and heterologous polypeptide side joint is in arbitrary limit of a recombinant carrier molecule sections in the case.Carrier proteins shows high heat resistance (being at least about 60 DEG C), this high heat resistance contribute to making lysate to carry out heating and/or centrifugal after isolate fusion rotein from other host cell proteins all, nucleic acid, pyrogen and analogue thereof.Heterologous polypeptide is at carrier molecule N end or C end or merge the loss that can not cause enzymic activity and thermostability in inside.

Described carrier molecule or carrier proteins also can connect a label as tools for purification.Described label will be used as the additional means of cmy vector molecule or carrier proteins.Described label also can be used as reverse (fall back) instrument of purification.Described label refers to for promoting that purifying is by the peptide of the fusion rotein made by DNA recombinant expression.Better situation be label and its can in conjunction with matrix between bonding be reversible.Such as, described label can for having the glutathione s-transferase of avidity, wherein Histidine and metal to have the known analogue of the peptide sequence of the histidine residues of avidity and affiliated field with gsh.In a preferred embodiment of the invention, this label is His His His His His His (SEQ ID NO:2), i.e. (His6).In the present invention, one or more linkers (linker) sequence can be put on demand in carrier proteins.Term used herein " heterologous polypeptide or albumen " refer to by the encoded by nucleic acid introduced in host cell by polypeptide or albumen (for prevention, diagnosis or therepic use) are discussed.Term heterologous polypeptide or albumen do not comprise thermophilic enzyme or thermophilic enzyme territory or its signal peptide.Heterologous polypeptide for the object of the invention represents and generally refers to the endogenic polypeptide of any non-selected host up to 100kDa and more much higher peptide and it, but this definition also comprises endogenous peptide when this overexpression of needs.In addition, heterologous polypeptide also using show certain form Useful active, be generally antigenic activity for recombiant vaccine and/or immunoassay or other biological activity (such as peptide hormone, biomarker etc.).

Described heterologous polypeptide comprises somatomedin, phytokinin, part, acceptor and supression, and antigenic determinant and antibody.Heterologous protein also can comprise the enzyme of such as lytic enzyme, and lytic enzyme comprises carbohydrase and lipase.Representative polypeptide in scope includes, but is not limited to: GFP, IFN α, such as from tetanus toxin, anthrax, Measles virus, tubercule bacillus (Mycobacterium tuberculosis), pestilence obtain antigen (or epitope) and RSV monoclonal antibody specific, Regular Insulin and analogue thereof.

In addition, also other peptide or albumen (or its fragment) can be used on demand to carry out the different effect subsystem of supplementary immune system, and this type of peptide or albumen are such as the epitope that obtains from phytokinin or the granulocyte-macrophage colony stimulating factor (GM-CSF) of such as interleukin II (IL-2) or the peptide simultaneously determining position containing T cell and B cell antigen.For example, the available core nucleotide sequence of based target antigen, can clone computer produce open reading frame, express in a suitable system target polypeptides and utilize from infected individual obtain material screening they.Can be used for developing candidate vaccine, therapeutic or diagnostic reagent based on the target polypeptides selected by its immune response originality (immunoreactogenicity).If screening can provide highly save time and effective means and the illness outbreak that needs to be grasped new emerging pathogens or such as SARS dynamically so this will become and will be even more important.In addition, described carrier molecule can be used measure the suitable vaccine antigen for developing effective vaccine and the subunit vaccine (such as, using the anti-viral hepatitis type b of surface antigen) resisting such as SARS, phthisical pathogenic agent.

Depending on the position of described heterologous polypeptide in described carrier proteins, one or more cleavage sites can be introduced between carrier molecule and heterologous polypeptide.This can promote being further purified of target polypeptides.It also can provide the advantage exceeding current protein synthesis methods, and current method produces a large amount of reactant and the solvent toxicity refuse that have to pass through process.

For example, can introduce and these enzymes of effective hydrolysising peptide key or chemical substance be can be used for proteolytic enzyme or other there are a large amount of cleavage sites known in specific prior art appoint whichever.Known to endopeptidase and the activated proteolytic enzyme of the equal tool of exopeptidase in affiliated field.For example, protease specificity cleavage site can be introduced in restructuring LicKM carrier proteins, at N end, there is poly-His label to make described LicKM carrier molecule and at C end, there is cleavage site, after connect such as antigenic determinant and/or by the target polypeptides that therapeutical peptide (as Interferon, rabbit) is discussed.

In certain embodiments, the qualitative and quantitative parameter of secretory signal sequence for Further aim polypeptide can be added.Leader sequence or secretory signal sequence is used to be only selectivity and non-essential to practice the present invention.For example, the recombinant vectors containing the carrier proteins with a leader sequence can be constructed, the secretory product of heterologous protein guiding to be used for cultivating in the substratum of different hosts cell.

This system can make it possible to homology synthesis recombinant protein and this individual system can allow equal proportion simply to increase and subsequent downstream process, such as purifying.These modifications have applied to the known a large amount of albumen in affiliated field.

No matter be in single position or at noncontiguous locations, described heterologous polypeptide can as previously summarize and carrier molecule frame fusion.Generally speaking; in the content of carrier proteins as vaccine; one or more epitopes contained can excite the heterologous polypeptide of immunne response or aminoacid sequence (meaning namely have two or more identical or non-equal epitope containing epitope sections) to be candidate polypeptide, and described immunne response is protected from or protecting from infection property disease or anaphylaxis.When attempt to create for test, diagnose or the bifunctional antibody of therepic use time, preferably use the sections containing epitope, in this sections, show two or more independent antigen determine position.Heterologous polypeptide can B cell antigen determines position, T cell antigen determines that position or B cell and T cell antigen determine the epitope of position mixture containing can be.In some contents, preferred epitope is that B cell antigen determines position, and it is known as the target for neutralizing antibody.

A preferred embodiment of the present invention is the carrier proteins about having recombinant carrier molecule, and described recombinant carrier molecule and two or more non-adjacent heterologous polypeptide sections containing epitope merge.The noncontiguous locations being suitable for merging is interior location in carrier proteins, comprises the ring district of described recombinant carrier molecule or N end or C end.

Find in the present invention to carry out inserting and replacing in these ring districts, and do not destroyed the integrity of carrier molecule or elimination and described restructuring thermophilic enzyme is become transmit to express each peptide species or the display feature containing the useful carrier of epitope heterologous polypeptide.The relation that insertion in these ring districts and replacement can't change between the remarkable constructional feature of described carrier molecule.Those skilled in the art can understand how by preparing carrier proteins of the present invention at the enterprising line operate of nucleic acid level.

In certain embodiments, described carrier proteins will have cleavage site, can in vivo or in vitro be excised by specific proteases to make the heterologous polypeptide held with the C of recombinant carrier molecule of the present invention, N holds and/or its inside is merged.This allows to wait to cast peptide to cell as the part of more larger fusion protein, thus described in making more larger fusion protein be easier to purifying and process compared with free heterologous polypeptide.After Cell uptake, described in be attached to carrier molecule heterologous polypeptide can shear from described molecule.

It will be understood by one of ordinary skill in the art that how by preparing carrier proteins of the present invention at the enterprising line operate of nucleic acid level.Construct the standard that the suitable carrier containing required coding and control sequence have employed known by affiliated field to connect and restriction technologies.By the cutting of the oligonucleotide of be separated plasmid, DNA sequence dna or synthesis, cut out (tailor) and reconnect and be connected into expectation form.The virus vector such as such as plant, insect and mammalian disease poisonous carrier or bacterial plasmid can be used as carrier.

Below can be used as the representative example of expression vector: virus particle, plasmid, glutinous grain, bacterial artificial chromosome, viral DNA (such as cowpox, adenovirus, rotten poxvirus (foul pox virus), pseudorabies virus and SV40 derivative), yeast plasmid, yeast artificial chromosome and any other have specific carrier to specific discussed host (such as bacterium, yeast and other fungi, plant etc.).Therefore, for example, any one in the expression vector of multiple expression recombinant vectors albumen all can comprise DNA.A large amount of suitably carrier has been known by those skilled in the art and has had commercially available.Citing provides following carrier; Bacterium: pQE70 (Qiagen), pBluescript SK, pBluescript KS (Stratagene); PTRC99a, pRIT2T (Pharmacia); Eukaryote: pWLNEO, pXT1, pSG (Stratagene), pSVK3, pSVLSV40 (Pharmacia).They other plasmid any or carrier can be used, as long as can copy and survive in host.

Can be inserted in described carrier the recombinant DNA of encoding carrier proteins by multiple programs.Generally speaking, by the program that affiliated field is known, DNA sequence dna is inserted in suitable restriction endonuclease site.

DNA sequence dna in expression vector connects suitable expression control sequenc with manual mode of operation or guides the promotor of mRNA synthesis.The promotor used in the present invention can be the whole body property or composition and/or tissue-specific promoter that are derived from protokaryon and most eukaryotes.The example of composition promotor is CaMV 35S promoter, nopaline synthase promoter, octopine synthase promoter, ribulose-1,5-bisphosphate, 5-bisphosphate carboxylase promoter, Act1, SAM synthase promoter and Ubi promotor and chlorophyll a/b associated proteins promotor.The example of tissue-specific promoter is: potato proteinase inhibitor II (pin2) gene promoter, rape albumen (napin) gene promoter, rape storage protein (cruciferin) gene promoter, β-soya bean protein (β-conglycinin) gene promoter, Phaseolin (phaseolin) gene promoter, zein (zein) gene promoter, oleosin (oleosin) gene promoter, acyl carrier protein stearyl-ACP delta 8 desaturase genes promotor, fatty acid desaturase (desaturase) gene promoter, glycinin, Bec4 and many promotors from dross (nodule) gene.This type of promotors many are known in affiliated field.Also contemplated specificly-response in the inducible promoters of some chemical substance (copper etc.) or heat-shocked (HSP).In addition, described promotor also comprises the artificial sequence being designed to serve as promotor.Suitable carrier and promotor is selected fully to be positioned at affiliated skilled person's horizontal extent.Expression vector also contributes to the region transcribed, translate and select containing other suitable control sequence or other.

Described expression vector can be introduced in a suitable host.Described host cell can be eukaryotic cells, as mammalian cell, vegetable cell or yeast cell; Or described host cell can be prokaryote, as bacterial cell.Also carrier proteins of the present invention can be manufactured with plant and animal cell culture.Suitable host is selected to be regarded as in this paper teachings one of ordinary skill in the art category.Preferred host cell is vegetable cell and organism is plant.Can will construct body by known other method of conversion, calcium phosphate transfection, DEAE-Dextran mediated transfection or electric shock (electroporation) or affiliated field to introduce in host cell.

Depending on host cell used, use the standard technique being suitable for described cell to complete transformation.The cell that can contain parenchyma wall barrier to eukaryote or other uses the Calcium treatment of employing calcium chloride known in art.Be converted in yeast according to method known in affiliated field.Mammalian cell for acellular wall can use electric shock or DNA absorption process.Known and the conventional insect cell being used for protein expression object also can be used as host cell of the present invention.Agrobacterium tumefaciens (Agrobacterium tumefaciens) is used to infect to certain plants cell.Therefore, in the methods of the invention, utilize containing transforming by the carrier that carrier proteins is discussed by plant being discussed to manufacture transgenic plant.Method for transformation based on Agrobacterium (Agrobacterium) can be used for manufacturing transgenic plant.The method of other stable conversion plants some can obtain in the art (referring to people such as Piruzian, 2002, Mol Genet Genomics 266:778-786, it is incorporated herein by reference).In the present invention, RecLicB and LicKM that can express in plant containing several target antigen constructs body, and described target antigen comprises RSV peptide and HbsAg.

After with selected viral vector infection host plant, also can express carrier proteins of the present invention from Suitable viral vector.Recombinant viral vector assigns to construct by the genomic constitution operating wild-type virus.Preferred virus is the plant virus containing RNA.Although many plant viruses have rna gene group, the function of organization that we know genetic information is different in each group.Therefore, virus can be monad, two split, triad virus." genome " refers to total genetic stocks of virus." rna gene group " illustrates the genome existed as virosome (virus particle) form is rna form.

Address this need and be therefore applicable to some viruses comprise: alfalfa mosaic virus (Alfalfa Mosaic Virus) (A1MV), Deng unstable ring spot virus group (ilarvirus) of axle, Cucumovirus (cucumovirus), as cucumber green statin mosaic virus (Cucumber Green Mottle Mosaic virus) (CGMMV), Closterovirus (closterovirus) or tobacco mosaic virus (TMV) group (tobamavirus, tobacco mosaic virus group), as tobacco mosaic virus (TMV) (Tobacco Mosaic virus) (TMV), marmor erodens (Tobacco Etch Virus) (TEV), cowpea mosaic virus (Cowpea Mosaic virus) (CMV), and be derived from the virus of brome mosaic virus group (Brome mosaicvirus group), such as brome mosaic virus (BMV), flower of Broadbean mosaic virus (broad bean mottle virus) and cowpea chlorotic mosaic virus (cowpea chlorotic mottle virus).Virus suitable in addition comprises: the geminivirus infection (geminivirus) of necrosis virus (Rice Necrosis virus) (RNV) and such as tomato golden mosaic virus (tomato golden mosaic virus) (TGMV), cassava latent virus (Cassava latent virus) (CLV) and maize streak virus (maize streak virus) (MSV).Each groups of these appropriate virus groups is subject to fully characterizing and knows for one of ordinary skill in the art.One of ordinary skill in the art have used a large amount of recombinant viral vector transient expression not homopolypeptide in plant materials.For example, referring to United States Patent (USP) the 5th, 316, No. 931 and the 6th, 042, No. 832; And PCT International Publication case WO 00/46350, WO 96/12028 and WO 00/25574, these patent contents are all incorporated herein by reference.Therefore, development recombinant viral vector of the present invention can be instructed for transmission trans-acting factor (transacting factor) by the method that affiliated field is known.

The recombinant viral vector used in the present invention can be heterologus virus carrier.The virus vector that heterologus virus carrier as referred to herein divides for the recombination composition with a given viroid (such as TMV), it has the floating preteins of described given viroid nucleotide sequence of encoding, but coating protein (total length or brachymemma but tool the is functional) nucleotide sequence with inhomogeneity virus (such as AlMV) substitutes the primary coating protein nucleotide sequence of described given viroid.Equally, primary floating preteins nucleotide sequence is replaced but not coating protein sequence by allos (meaning and the non-protogenous) floating preteins from another kind of virus.For example, the TMV genome composition with A1MV coating protein is a kind of described Heterologous vectors.Similarly, the A1MV genome composition with TMV coating protein is another kind of described Heterologous vectors.Described carrier through design make these carriers through infect after can copy in host cell and in host cell transient expression vector albumen.

In the present invention on the other hand, by utilizing Transactivation (transactivation) system that provides virus vector and transgenic plant all for expressing carrier proteins of the present invention in host plant cell.Transactivation system has two kinds of compositions: (i) transgenic plant and (ii) recombinant viral vector.The genetic transformation cell of host plant has and is integrated into deactivation in its Matrix attachment region or silent carrier protein-encoding nucleotide sequence, and described cell only can encoding carrier proteins after activation silencing sequence.For activating this silencing sequence, use a recombinant RNA virus vector, it can infection host plant cell and encode one wherein for activating the factor that deactivation or silent carrier protein nucleic acid sequence are expressed.The nucleotide sequence of encoding carrier proteins becomes silence by settling one to intercept sequence between promoter sequence and the nucleotide sequence of encoding carrier proteins.Described obstruct sequence (such as washability identification element or other nucleotide sequence any (stuffer)) should be enough to the ability intercepting promoters driven genetic expression.Described obstruct sequence must by recombinase target site (such as " FRT " site) with the 5' to 3' defined direction side joint in every one side.FRT refers to a kind of nucleotide sequence, can this Site-specific recombinase effect of catalysis at product, i.e. the FLP recombinase of described sequence part FLP gene.Except the genomic elements infecting, copy, move and distribute needed for described virus vector, these carriers also contain the nucleotide sequence of sequence for the reticent encoding carrier proteins of activation of encodes recombinase (such as FLP) or other factors (such as GAL4-VP16).

According to the present invention, host plant included in scope is the more high of vegitabilia's all kinds and comparatively lower plant.Scope comprises maturation plant, seedling and seed.Maturation plant is in the plant of any etap after being included in seedling.Seedling is in very little, the jejune plant growing commitment.Particularly, can be used as host to include, but is not limited to the plant producing exogenous array and polypeptide: angiosperm, such as Hepaticae (the Hepaticae) (bryophyte (Bryophyte) of liverwort (liverwort) and moss guiding principle (Musci) (mosses (moss)); Pteridophyte (Pteridophyte), such as Cyclosorus (fern), Equisetum (horsetail) and Lycopodium (lycopod); Gymnosperm (Gymnosperm), such as coniferals (conifer), cycad (cycad), ginkgo (Ginkgo) and Stem of Smalleaf Jointfir (Gnetale); And algae (Algae), comprise Chlorophyceae (Chlorophyceae), Phaeophyceae (Phaeophpyceae), Rhodophyceae (Rhodophyceae), Cyanophyceae (Myxophyceae), Xanthophyceae (Xanthophyceae) and Euglenophyceae (Euglenophyceae).

Depending on type and the geographical position of selected plant, the host plant for generation of carrier proteins can in vivo and/or in vitro grow.Importantly selected plant is easy to cultivate under condition in suitable field conditions and/or in vitro, comprises cell cultures.

In angiosperm, contain especially and use crop and/or the member with crop dependency section.The plant members used in the methods of the invention also comprises between kind and/or bigeners, through the plant that sudden change produces and/or genetic engineering changes.These sections include, without being limited to: pulse family Leguminosae (Fabaceae), comprises pea, clover and soybean; Gramineae Gramineae (Poaceae), comprises paddy rice, corn, wheat; Solanaceae (Solanaceae), especially tomato (Lycopersicon) belong to, especially tomato species (esculentum) (tomato), Solanum (Solanum), especially potato seed (tuberosum) (potato) and eggplant kind (melongena) (eggplant), Capsicum (Capsicum), especially capsicum kind (Capsicum annum) (pepper), tobacco and similar plants thereof; Umbelliferae (Umbelliferae), especially Daucus (Daucus), especially carrot seed (Daucus carota) (Radix Dauci Sativae), (Apium), especially celery kind (graveolens dulce) (celery (celery)) and similar plants thereof is belonged to celery; Rutaceae (Rutaceae), especially Citrus (Citrus) (oranges and tangerines (orange)) and similar plants thereof; Composite family (Compositae), especially Lactuca (Lactuca), with lettuce (Lactuca sativa) (lettuce (lettuce)) and similar plants thereof and Cruciferae (Cruciferae), especially Btassica (Brassica) and sinapsis alba belong to (Sinapis)." vegetables " crop member example of Cruciferae (Brassicaceae) includes but not limited to: diplochromosome group tetraploid (digenomictetraploid), such as mustard type rape (Brassica juncea (L.) Czern.) (leaf mustard), brassicacarinata (B.carinata Braun) (ethopian mustard); With monosome group diploid (monogenomic diploid), such as wild cabbage (B.oleracea (L.)) (cole crop (cole crops)), black mustard (B.nigra (L.) Koch) (blackmustard), turnip type rape (B.campestris (L.)) (turnip (turnip rape)) and radish (Raphanus sativus (L.)) (radish (radish))." oleaginous seed " crop member example of Cruciferae includes but not limited to: swede type rape (B.napus (L.)) (Semen Brassicae campestris), turnip type rape, mustard type rape (B.juncea (L.) Czern.) and B.tournifortii and sinapsis alba (Sinapis alba (L.)) (white mustard).Also line is contained.

Particularly preferred host plant can be the host plant infected by A1MV.For example, in affiliated field, known alfalfa mosaic virus has full host range.Other species of known easily infected virus are: okra (Abelmoschusesculentus), Ageratum conyzoides (Ageratum conyzoides), amaranthus caudatus (Amaranthus caudatus), Amaranthus retroflexus (Amaranthus retroflexus), Common Snapdragon (Antirrhinum majus), celery (Apium graveolens), celeriac (Apium graveolens var.rapaceum), peanut (Arachis hypogaea), Astragalus glycyphyllos, beet (Beta vulgaris), Plantula Brassicae chinensis (Brassica campestris ssp.Rapa), Potmarigold Calendula (Calendulaofficinalis), pimento (Capsicum annuum), capsicum (Capsicum frutescens), Herba Caryopteridis Incanae (Caryopterisincana), Vinca (Catharanthus roseus), feather cockscomb (Celosia argentea), Flower of Common Wallflower (Cheiranthuscheiri), lamb's-quarters (Chenopodium album), Chenopodium amaranticol, the raw lamb's-quarters of wall (Chenopodiummurale), white lamb's-quarters (Chenopodium quinoa), garbanzo (Cicer arietinum), witloof (Cichium endiva), coriander (Ciandrum sativum), Herba Hedyotis platystipulae (Crotalaria spectabilis), muskmelon (Cucumis melo), cucumber (Cucumis sativus), summer squash (Cucurbita pepo), guar-bean (Cyamopsis tetragonoloba), Radix Dauci Sativae (Daucus carota (var.sativa)), sweetwilliam (Dianthus barbatus), Dianthus caryophyllus L. (Dianthuscaryophyllus), Sowthistle Tasselflower Herb (Emilia sagittata), sweet buckwheat (Fagopyrum esculentum), soybean (Glycinemax), Globeamaranth Flower (Gomphrena globosa), Sunflower Receptacle (Helianthus annuus), pale reddish brown Dolichos lablab (Lablabpurpureus), lettuce (Lactuca sativa), Lathyrus odatus, Lens culinaris (Lens culinaris), flax (Linumusitatissimum), Lupinus albus (Lupinus albus), tomato (Lycopersicon esculentum), large winged bean (Macroptilium lathyroides), Malva parvifla, violet (Matthiola incana), medicago hispida (Medicagohispida), alfalfa (Medicago sativa), white sweet clover (Melilotus albus), Nicotiana bigelovii, Cleveland cigarette (Nicotiana clevelandii), De Bainayi cigarette (Nicotiana debneyi), Nicotiana glutinosa (Nicotianaglutinosa), Mai Gelong puts out rich cigarette (Nicotiana megalosiphon), rustica (Nicotiana rustica), woods tobacco (Nicotiana sylvestris), safflower tobacco (Nicotiana tabacum), sweet basil (Ocimum basilicum), petunia (Petunia x hybrida), lima bean (Phaseolus lunatus), Kidney bean (Phaseolus vulgaris), Philadelphus (Philadelphus), Physalis flidana, Cape of Good Hope gooseberry (Physalis peruviana), dyers' grapes (Phytolacca americana), pea (Pisum sativum), wild potato kind (Solanum demissum), eggplant (Solanum melongena), black nightshade (Solanum nigrum), Solanum nodiflum, thorn calyx black nightshade (Solanumrostratum), potato (Solanum tuberosum), sonchus oleraceus (Sonchus oleraceus), spinach (Spinaciaoleracea), chickweed (Stellaria media), New Zealand spinach (Tetragonia tetragonioides), little golden hop trifolium (Trifolium dubium), Alsike (Trifolium hybridum), deep red three leaves (Trifolium incarnatum), red clover (Trifolium pratense), Trifolium repense (Trifolium repens), ground three leaves (Trifolium subterraneum), Flower of Chinese Globeflower (Tropaeolum majus), Viburnum opulus Jia Opulus (Viburnum opulus), broad bean (Vicia faba), mung bean (Vigna radiata), cowpea (Vigaung uiculata), asparagus bean (Vigna unguiculata ssp.Sesquipedalis) and Herba Zinnia elegansae (Zinnia elegans).

On the one hand, the present invention is also included within animal body the method exciting immunne response.Carrier proteins of the present invention excites the purposes of immunne response to be described in more detail at following EXAMPLEPART.Particularly, these experiments prove containing B cell and T cell antigen, (such as) determines that the immunogenicity heterologous polypeptide of base excites antigen-specific immune response in carrier fusion.It is shocking, the desired specificities immunogenicity of the antigenic determinant merged with carrier molecule of the present invention is significantly better than the desired specificities immunogenicity of the antigenic determinant of the independent administration of carrier free molecule.In addition, experiment proves likely to produce humoral immunoresponse(HI) to the polypeptide segment containing epitope that inside is inserted.Although in vivo data reported here produce in the experiment adopting the Muridae analysis generating anti-carrier protein antibodies, ultimate principle is applicable to the mankind and other animal, as rabbit, pig, sheep, monkey and chimpanzee.In view of the disclosure of present application for patent and the general knowledge of one of ordinary skill in the art, select institute that heterologous polypeptide is discussed and these discussed polypeptide be incorporated in carrier molecule being the problem of normal experiment as immunogen.One of ordinary skill in the art can identify has the heterologous polypeptide that B cell antigen determines position, and they can in the strong humoral immunoresponse(HI) of the rear drive of administration animal.Selected B cell antigen determines that base is by the intended use depending on carrier proteins.For example, if described carrier proteins will be used as vaccine, so described heterologous polypeptide can be derived from by virus, bacterium or other and cause disease-related infectious organisms expressed by albumen.Selected heterologous polypeptide should be a kind of heterologous polypeptide of epitope containing manifesting strong immune response.Generally speaking, this heterologous polypeptide should be included in the albumen that infectious organisms finds on the surface, and this proteinoid relates to combination and antibody is highly close to it.

The selection of immunogenicity heterologous polypeptide is not limited to the albumen relevant to infectious organisms.For example, can use and insert polypeptide containing the inside being derived from prostate specific antigen (or N or C end) and carry out elicit strong immune response.One of ordinary skill in the art will be appreciated that and can be included driving any heterologous polypeptide containing one or more B cell or T cell antigen decision base of humoral immunoresponse(HI), as a part for carrier proteins of the present invention.Known many described heterologous polypeptides and other determine by normal experiment.

In some instances, wish that irritation cell toxoid T cell is as a part of cellullar immunologic response.In these examples, tool T cell antigen determines that the heterologous polypeptide of base and carrier molecule merge, and preferred inside is inserted in carrier.Cytotoxic T-Lymphocyte such as virus infection, bacteriological infection, parasitize and cancer supervisory and control in play a significant role.The testing program of T cell activation allows the cytotoxic T-Lymphocyte response exciting selectivity larger, and it has larger treatment effect.

Usually, the fusion that peptide and carrier molecule C hold has a cleavage site therebetween, and this fusion can produce desiredly constructs body, and it in vivo splits by recombinant vectors protein-specific cutting reagent.Described carrier proteins specificity cutting reagent (such as proteolytic enzyme) is cut vector protein fusion after C holds residue, thus discharges C end peptide.

Therefore, depending on the heterologous polypeptide type merged with carrier proteins, the vaccine based on this carrier proteins can be used for driving cell and/or humoral immunoresponse(HI).The therapeutic dose giving the carrier proteins of an animal species determines by the dosage being considered to effectively manifest wanted immunne response.Administration carrier proteins in pharmaceutically acceptable or compatible carrier or adjuvant.Therefore, the medical composition for administration carrier proteins is also contained in the present invention.The specified disease example that can process by this way comprises (such as): HIV, cancer, gastrointestinal illness, respiratory tract infection etc.Described medical composition is prepared by the method that one of ordinary skill in the art are known.Generally speaking, essential mixing diluents known in carrier proteins and supporting agent and field belonging to other, stablizes with supplement production and the product that can offer medicine.The some methods known by one of ordinary skill in the art complete coming into operation of this medical composition.These methods comprise in abdominal injection (i.p.), oral, intracutaneous, subcutaneous, nose, intravenously or intramuscular.Usually the subcutaneous injection that patient to be treated accepts carrier proteins is weekly, continues a few week.But, also can adopt oral cavity or intranasal administration within the time of similar-length.Its result is irritated and/or autoimmunity response declines.

Except known inoculation method, the present invention also can be used for DNA inoculation.In this method, the DNA of the suitable carrier proteins of coding is introduced in the cell of organism.In these cells, directly express the carrier proteins containing epitope.In inoculation animal, raw cell directly expresses carrier proteins of the present invention, and this allows continuous agitation humoral and cellular immune response response within the period extended.By introduce in zooblast coding want the DNA of carrier proteins to construct body can to complete direct expression.These construct body usually containing the transcriptional control element that promoter element and other guide carrier proteins to express.DNA can be introduced by any known method and construct body, comprise direct injection.Preferred administration site is muscle tissue.Different from Standard immunoassays scheme, this direct expression by vaccine a single injection location once or once more than.After injection, vaccine intersperses among in lymphoid organ, in these lymphoid organs, single immunne response occurs.

Example

There is provided following instance to provide further guidance to one of ordinary skill in the art, and and should not be construed as and limit the present invention by any way.

Example 1: construct carrier molecule and carrier proteins

This example is for constructing for the carrier proteins expression vector at protokaryon and eukaryotic expression.

Fig. 1 shows that engineering science changes the schematic diagram of recombinant carrier molecule LicKM and recLicB.Letter " l " represents ring texture, and A represents the upstream region (structural domain) of ring texture and C represents the downstream area (structural domain) of ring texture.In order to produce LicKM, splitting in ring differentiation and assembling the gene of encoding mature Lic B as shown in the figure.Monospecific polyclonal site is produced in engineering science change process.The part B of Fig. 1 is shown through modifying gene (LicKM) sequence.

LicKM is produced in 2 step PCR clones.5 are used with 3' primer, lic 1 B gene to be increased into 2 fragments, called after A (the lie 1 B gene of 159 Nucleotide, 364 to 522) and C (the lie 1 B gene of 486 Nucleotide, 523 to 1009).In final clone, Segment A is cloned into the downstream of fragment C, retains the composition of Original amino.

Below used Auele Specific Primer:

Fragment C:

5' primer: 5'gga tcc ATG GGC GGT TCA TAT CCG TAT-3'(SEQ ID NO:10)

3' primer: 5'g cag aga TCT ATA TTC CCT GTC AAG GGT-3'(SEQ ID NO:11)

Segment A:

5' primer: 5'aga tcc ATG GTG GTA AAT ACG CCT TTT-3'(SEQ ID NO:12)

3' primer: 5'g cac aga TCT ACC GTT AGG ATA GTA TTT TAC-3'(SEQ ID NO:13)

Fig. 1 C displaying constructs rec LicB schematic diagram from wild-type LicB.

Example 2: use recLic B cloning and expressing GFP

As shown in Figure 2, symbolically recLic B is divided into 3 regions; L is ring texture.This ring texture upstream region (structural domain) is expressed as A and the downstream of ring texture is expressed as C.In order to use recLic B as carrier molecule, in the ring district of described gene, introduce monospecific polyclonal site (BamHI and and Bgll).The gene clone of GFP (green fluorescent protein) will be encoded in the ring district of recLic B to obtain recLic B-GFP (Fig. 2).Use intestinal bacteria (Esherichiacoli) and express recombinant protein (Fig. 3) with yeast two kinds of expression body systems.Target polypeptides not only can insert by shown in this embodiment by the insertion ring texture of target polypeptides, and N or C of target polypeptides and carrier proteins can be made to hold merge.

Example 3: the recovery of fermentation and carrier proteins

Cultivate by cultivation process overnight in LB substratum or fermented and construct intestinal bacteria (E.coli) the dH5alpha cell of body conversion through recLic B-GFP.Fermentation is carried out 12 hours continuously and is l0 at cell concn ⁴shi Jinhang collects.Two liters of cell cultures or fermented liquid (broth) to be divided in each container/bottle 1 liter, and under 10,000rpm centrifugal 30 minutes.Abandoning supernatant also records body protein back and forth with spherolite (pellet).

Example 4: use and carry out cloning and expressing plurality of target polypeptide through transformation LicKM

This example has been set forth and has been used three target polypeptides below transformation LicKM cloning and expression:

A. the peptide (24a.a.) of respiratory syncytial virus G-protein is derived from

b．GFP(27kD)

c．IFNα.(19kD)

For proving through the ability of transformation LicKM as carrier molecule, manufactured 3 and constructed body, wherein target sequence polypeptide (a) coding source to be cloned in the open reading frame through transforming LicKM through pcr amplification as shown in Figure 4 from the open reading frame of the DNA fragmentation of 24 amino acid peptides of respiratory syncytial virus G-protein, the open reading frame of (b) GFP or (c) human interferon α.These three through transformation target polypeptides as shown in Figure 5 at expression in escherichia coli and in yeast (non-display data) express.Fig. 5 A is presented at 0.1% lichenstarch exists lichenstarch enzymic activity in the lower bacterial extract detected zymogram as substrate.Isolated protein in 12%PAGE.The albumen extracted from coli strain XL-1blue is loaded in gel.C is negative control.LicKM is through transformation carrier molecule.LicKM-RSV, LicKM-GFP and LicKM-IFN α be containing respective target polypeptides through engineered protein.Fig. 5 B shows western-blot analytical results.Protein isolate in 12%PAGE, will its electroblotting to nylon membrane make it and has specific monoclonal antibody to the peptide from RSV G-protein and react.Antibody reacts with the plant virus coating protein (RSV (plant)) containing identical peptide with LicKM-RSV, RSV positive control (RSV (C+)).LicKM extract not containing target peptide does not have specificity to RSV antibody.

Example 5: with containing being derived from the LicKM-RSV of 24 amino acid peptides of RSV G-protein to mouse immune

The restructuring LicKM-RSV of every dosage 200 μ g is used to carry out immunity to female balB/c mouse in eight week age, this restructuring LicKM-RSV through transformation for 24 amino acid (171-191 of the G-protein) (people such as Johnson expressing RSV G-protein, 2004, J Virol.2004 June; 78 (11): 6024-32).

Immunity is carried out at intraperitoneal three administration 0.1ml, (the first administration uses Fu Shi (Freund) Freund's complete adjuvant (CFA) that volume ratio is 1:1 to every minor tick fortnight, second administration uses the Freund's incomplete adjuvant (CFA) that volume ratio is 1:1, and the 3rd administration does not use any adjuvant).Use the LicKM of equivalent in contrast.Pre-immune serum sample is collected in the day before yesterday of the first antigen administration.From individual mice, collect serum sample behind immunization each time ten two (12) sky and assess the titre of RSV specific antibody.Solid-phase enzyme-linked immune absorption is used to detect the antigen-specific antibodies analysis that (ELISA) performs serum.Wrap by elisa plate (Denmark Nunc Polysorp) containing identical sources from the restructuring A1MV of RSV G-protein (in phosphate-buffered saline 10 μ g/ml) peptide with every hole 100 μ 1 (every hole 1.0 microgram), at room temperature (RT, about 25 DEG C) overnight.Plate through bag quilt is washed 3 times with PBS-Tween (0.05%) and then at room temperature closes at least 1 hour with the 0.5%I-block (Tropix) in PBS-Tween.In plate, at room temperature add a series of serum dilution (every hole 30 μ l), last 2 to 4 hours.Then PBS-Tween (0.05%) is used to wash 3 times to plate and at room temperature to be dissolved in 1:10 in PBS-Tween, the final extent of dilution of 000 adds the secondary antibodies (sheep anti-mouse igg of (every hole 100 microlitre) and peroxidase conjugation, or full molecule or specificity γ chain), last one hour.Then with PBS-Tween 5 times washed to plate and under room temperature, be in the dark added in OPD (the Sigma Fast in urea-containing phosphate citrate buffer ^tM) substrate (the 100 every hole of μ l), last 30 minutes.With 2M H ₂sO ₄(every hole 50 microlitre) stopped reaction and by ELISA plate reader (ELISA plate-reader) (Spectramax Plus ³⁸⁴) colour-change caused by institute's binding specificity antibody is measured at 490nM place.Fig. 6 shows with the result of O.D. unit representation.

Example 6: use the LicKM-F200 containing RSV F protein 200 amino acid moiety to carry out engineering science to mouse and change and experimental immunization

The engineering science change of LicKM-F200 performs as follows: use the plasmid DNA of the cDNA of F, G and M gene containing RSV as template DNA, this plasmid DNA obtains the (people such as Johnson from NIH (National Institute ofHealth), 2004, J Virol.2004 June; 78 (ll): 6024-32).

Use 5'-GCACAGATCTGGGTCCAACATCTGTTTAAC-3'(SEQ ID NO:14) and 5'-GCACAAGCTTATTTGTGGTGGATTTACCA-3'(SEQ ID NO:15) carry out a part for the F gene of amplification coding amino acid 324 to 524 as 5' and 3' primer for clone.Be used in PCR reaction process the single restriction site (being respectively BglII site and the HindIII that holds of 3' of 5' end) introduced digest the fragment through pcr amplification and be cloned in final carrier.Target dna is cloned in E.coli, edaphic bacillus and plant virus-based expression vector.Use LicKM-F200 to obtain result described by this example, wherein target gene to be cloned in plant viral vector D4 and to be expressed in wherein.

In order to express, the LicKM-F200 transcription in vitro synthesized is inoculated on plant.The known program of prior art is used to carry out plant inoculating.About the guide of infectious RNA transcription and virus infection program referring to PCT International Publication case WO 00/46350.After inoculation fortnight, collect sample for the expression of evaluating objects albumen and recovery.Recombinant protein maintains enzymic activity (Fig. 7 A) and by the specific antibody recognition of LicKM (Fig. 7 B).

For exciting immunne response, use the female balB/c mouse of every dosage 200 μ g restructuring LicKM-F200 to eight week age to carry out immunity, described restructuring LicKM-F200 changes 200 amino acid (amino acid 324 to 524 of F protein) for expressing RSV F protein through engineering science.At intraperitoneal administration antigen three dosage (0.1 milliliter/dosage), (the first administration uses the Freund's complete adjuvant (CFA) that volume ratio is 1:1 to every minor tick fortnight, second administration uses the Freund's incomplete adjuvant (CFA) that volume ratio is 1:1, and the 3rd administration does not use any adjuvant).Use the LicKM of equivalent in contrast.In first time, the day before yesterday of antigen administration collects pre-immune serum sample.From individual mice, obtain serum sample behind each immune ten two (12) skies and assess RSV Specific antibody titre.Solid-phase enzyme-linked immune is utilized to adsorb the antigen-specific antibodies detecting (ELISA) serum analysis.With deactivation RSV long-chain (the Hy Test of every hole 100 μ 1 (every hole 1.0 microgram), 10 μ g/ml in phosphate buffered saline (PBS)) wrap by elisa plate (Denmark Nunc Polysorp), at room temperature (RT, about 25 DEG C) overnight.Then plate PBS-Tween (0.05%) washing through bag quilt uses for 3 times the 0.5%I-block (Tropix) in PBS-Tween at room temperature to close at least 1 hour.Under RT, in these plates, add a series of serum dilution (30 microlitres/hole), last 2 to 4 hours.Then PBS-Tween (0.05%) is used to wash 3 times to plate and at room temperature with 1:10 in PBS-Tween, the final extent of dilution of 000 adds (100 microlitres/hole) peroxidase conjugation secondary antibodies (sheep anti-mouse igg, full molecule or γ chain specificity), last 1 hour.Then under room temperature, with PBS-Tween wash plate 5 times and in the dark add OPD (the Sigma Fast in (100 microlitres/hole) urea-containing phosphate citrate buffer ^tM) substrate, last 30 minutes.With 2M H ₂sO ₄(every hole 50 microlitre) stopped reaction and by ELISA plate reader (ELISAplate-reader) (Spectramax Plus ³⁸⁴) colour-change that institute binding specificity antibody causes is measured at 490nM place.Fig. 8 shows with the result of O.D. unit representation.

Example 7: with the LicKM-PAD4 of 145 amino acid domain 4 containing anthrax PA albumen, engineering science change and experiment immunization effect are carried out to mouse

The engineering science change of LicKM-PAD4 performs as follows:

E.coli plasmid DNA containing the full structural domain 4 (amino acid 621 to 760) of anthrax protective antigen is obtained as the template DNA (people such as Moayeri from NMRC; 2004; Curr Opin Microbiol., 7 (1): 19-24).

Use 5'GCACAGATCTAATATTTTAATAAGAGATAAACG3'(SEQ ID NO:16) with 5'GCACAAGCTTTCCTATCTCATAGCCTTTTT3'(SEQ ID NO:17) as the structural domain 4 of 5' and 3' primer amplification coded amino acid 621 to 760 for clone.Fragment through pcr amplification is digested and utilizes the single restriction site (being respectively the BglII site of 5' end and the HindIII of 3' end) introduced in PCR reaction process to be cloned in final carrier.By DNA clones of interest in E.coli, edaphic bacillus and plant virus-based expression vector.Use LicKM-PAD4 obtains the result described by this example, and wherein target gene is cloned and is expressed in plant viral vector D4.

The LicKM-PAD4 transcription in vitro synthesized is inoculated on tobacco plant to express.Plant vaccine program is identical with above-mentioned example.After inoculation fortnight, collection organization's sample is for the expression of evaluating objects albumen and recovery.Recombinant protein (Fig. 9) is gone out by having specific antibody recognition to anthrax protective antigen.

In order to bring out immunne response, use the female mouse of the balB/c of restructuring LicKM-PAD4 to eight week age of every dosage 200 μ g to carry out immunity, this restructuring LicKM-PAD4 changes through engineering science with 145 amino acid (PA Argine Monohydrochloride 621 to 760) of expressing anthrax PA albumen.Abdominal cavity dispensing 0.1ml carries out immunity three times, (the first dosage uses the Freund's complete adjuvant (CFA) that volume ratio is 1:1 to every minor tick fortnight, second dosage uses the Freund's incomplete adjuvant (CFA) that volume ratio is 1:1, and the 3rd dosage does not use any adjuvant).Use the LicKM of equivalent in contrast.Pre-immune serum sample is collected in the day before yesterday of antigen first time administration.From individual mice, collect serum sample behind each immune ten two (12) skies and assess RSV Specific antibody titre.Solid-phase enzyme-linked immune is utilized to adsorb the antigen-specific antibodies detecting (ELISA) serum analysis.Wrap by elisa plate (Denmark Nunc Polysorp) with the restructuring PA (10 μ g/ml are 10 μ g/ml in phosphate buffered saline (PBS)) of every hole 100 μ l (every hole 1.0 μ g), overnight at room temperature (RT; About 25 DEG C).Then the 0.5%I-block (Tropix) in PBS-Tween is used for 3 times at room temperature to close at least 1 hour plate PBS-Tween (0.05%) washing through bag quilt.Under RT, in these plates, add a series of serum dilution (30 μ l microlitre/hole), last 2 to 4 hours.Use these plates of PBS-Tween (0.05%) elution wash 3 times subsequently and at room temperature with 1:10 in PBS-Tween, the final extent of dilution of 000 adds (every hole 100 μ l) peroxidase conjugation secondary antibodies (sheep anti-mouse igg, full molecule or γ chain specificity), last 1 hour.Plate with after in the dark last under room temperature and within 30 minutes, add through 5x PBS-Tween elution wash 5 times OPD (the Sigma Fast added in urea-containing phosphate citrate buffer ^tM) substrate (100 μ l microlitre/hole), last 30 minutes.With 2M H ₂sO ₄(μ l/ hole, every hole 50) whole stopped reaction and the colour-change caused in conjunction with specific antibody are by ELISA plate reader (ELISA plate-reader) (Spectramax Plus ³⁸⁴) in 490nM, the colour-change that institute's binding specificity antibody causes is measured at place.Figure 10 illustrates with the result of O.D. unit representation.

Also LicKM-HbsAg is expressed in plant.Tobacco plant is used to produce target antibody as merging with carrier proteins.

All publication, patent and patent application case mentioned by this specification sheets represent the level of those skilled in the art of the invention.All application cases, patent and patent application case are herein incorporated herein by reference, and this quotes degree just as specifically and being individually incorporated to each publication or patent application case full content by reference.Although invention has been described with reference to specific embodiment, for modification and the combination that obviously can use these methods one of ordinary skill in the art, and expection can also with herein the mode done outside specific description put into practice.Therefore, the present invention includes all modifications contained in the present invention's spirit defined by claims and category.

Claims (28)

1. modified lichenase B (lichenase B) polypeptide, described lichenase B polypeptide is made up of the aminoacid sequence shown in SEQ ID NO:3 or SEQ ID NO:6.

2. the nucleic acid of lichenase B modified as claimed in claim 1 of encoding.

3. nucleic acid as claimed in claim 2, wherein said nucleic acid is SEQ ID NO:1 or 5.

4. a nucleic acid for encoding recombinant polypeptide,

Wherein said recombinant polypeptide comprises modified lichenase B polypeptide, and described lichenase B polypeptide and the allogeneic polypeptide sequence be not included in described lichenase B polypeptide merge; Wherein said allogeneic polypeptide sequence is in the ring district of described lichenase B polypeptide;

Wherein said modified lichenase B polypeptide is by SEQ ID NO:1 or 5 coding.

5. nucleic acid as claimed in claim 4, wherein said modified lichenase B polypeptide and two or more heterologous polypeptide segments containing epitope merge.

6. nucleic acid as claimed in claim 4, wherein said allogeneic polypeptide sequence comprises and comes from somatomedin, phytokinin, part, acceptor, supression, antigen, epitope, T cell antigen determines position, B cell antigen determines position, a sequence of antibody, lytic enzyme, green fluorescent protein, Interferon, rabbit, interleukin-, pathogenic agent associated protein or toxin.

7. nucleic acid as claimed in claim 4, wherein said allogeneic polypeptide sequence comprises a vaccine antigen.

8. nucleic acid as claimed in claim 4, wherein said recombinant polypeptide also comprise one for separating of or purifying or the label both it.

9. nucleic acid as claimed in claim 8, wherein said label is His6.

10. nucleic acid as claimed in claim 4, wherein said recombinant polypeptide also comprises a cleavage sites.

11. nucleic acid as claimed in claim 10, wherein said cleavage site is between described heterologous polypeptide and described modified lichenase B polypeptide.

12. nucleic acid as claimed in claim 4, wherein said recombinant polypeptide also comprises a label and a cleavage site, and wherein said cleavage site position is adjacent with described label.

13. nucleic acid as claimed in claim 4, wherein said recombinant polypeptide also comprises a linker.

14. 1 kinds of expression vectors comprised as the nucleic acid as described in arbitrary in claim 2-13.

15. expression vectors as claimed in claim 14, wherein said carrier is plant viral vector.

16. 1 kinds of host cells comprising expression vector as claimed in claim 14.

17. host cells as claimed in claim 16, wherein said host cell transforms with described expression vector.

18. host cells as claimed in claim 16, wherein said host cell is selected from the group be made up of vegetable cell, bacterial cell, insect cell, yeast cell and mammalian cell.

19. host cells as claimed in claim 16, wherein said host cell is vegetable cell.

20. 1 kinds for producing the method for recombinant polypeptide in plant, it comprises:

A () provides a plant, described plant contains an expression cassette, described expression cassette has the nucleic acid of the encoding recombinant polypeptide of a coding as described in claim arbitrary in claim 4-13, and described nucleic acid connects a promotor to operably with the expression making the expression of described box cause described recombinant polypeptide; And

B () makes described plant can be used to express described nucleic acid and grow under producing the condition of described recombinant polypeptide.

21. methods as claimed in claim 20, it also comprises the described recombinant polypeptide of recovery.

22. methods as claimed in claim 20, wherein said promotor is selected from the group be made up of plant composition promotor and plant tissue specificity promoter.

23. methods as claimed in claim 20, wherein said expression of recombinant proteins is in the leaf of described plant, root or seed.

24. methods as claimed in claim 20, wherein said promotor is plant virus promoters.

25. methods as claimed in claim 20, wherein said plant is dicotyledons or monocotyledons.

26. methods as claimed in claim 20, wherein said expression cassette is provided by a plant viral vector.

27. 1 kinds of methods reclaiming described recombinant polypeptide after protokaryon or eukaryotic expression recombinant polypeptide, described recombinant polypeptide is by the nucleic acid encoding as described in claim arbitrary in claim 4-13, and described method comprises:

A described cytolysis is produced lysate by ();

B soluble substance is separated with insoluble substance with a tripping device by () after step (a);

And

C () reclaims the recombinant protein in described soluble substance.

28. methods as claimed in claim 27, it also comprises the described lysate of heating to being enough to make non-thermostable protein denaturation.