JPH07213185A - Plant improved in content of amino acid containing sulfur and method for improvement - Google Patents

Abstract

PURPOSE:To obtain an improved plant capable of improving both the content of an amino acid containing sulfur in a plant in a shorter period with more saved labor than those of variety improvement consisting of conventional crossing containing a specific expression cassette the nutritive value of a plant such as an edible or a drinking crop. CONSTITUTION:This improved plant has a translatable structural gene which is all of a structural gene, containing 14 amino acids with a high sulfur content from the 108th to the 121st positions of an amino acid sequence, expressed by the formula and containing a signal sequence region of a 10K prolamine protein derived from a rice plant on the downstream side of a transcription and translation initiation region operable in a plant and capable of coding a mature protein region except the signal sequence region of the 10K prolamine protein derived from the rice plant and contains an expression cassette having a poly(A) signal operable in the plant and a transcription termination region in an operable form. Furthermore, this method for improvement is to preferably transduce the expression cassette into the plant, express the 10K prolamine protein derived from the rice plant and improve the content of the amino acid containing the sulfur in the plant.

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to an improved plant having a sulfur-containing amino acid content and an improved method.

[0002]

2. Description of the Related Art Humans and livestock depend on many plants such as food and drink crops as protein sources. However, the protein in the seeds of legumes, which is a major protein source crop, shows that when comparing the contents of essential amino acids for humans and livestock,
The content of sulfur-containing amino acids such as methionine and cysteine is lower than that of other essential amino acids, which is directly linked to a decrease in nutritional value. For this reason, in the livestock feed, the deficiency of methionine and cysteine is supplemented by adding fish meal and synthetic amino acids.

[0003]

However, in the case of the above-mentioned compounded feed, it takes time and effort for compounding, and the influence of the price and the amount of supply of fish meal (fish meal) and synthetic amino acid to be added. Further, the improvement of the feed crop itself has been improved to some extent by increasing the content of the protein itself, but in the conventional breeding mainly based on the crossing, the content of particularly important amino acids was increased, or It was extremely difficult to improve labor-saving in a short period of time.

[0004]

Under the circumstances, as a result of intensive investigations by the present inventors, an expression cassette having a protein gene with a high sulfur-containing amino acid content was constructed and introduced into a plant. , Was successfully expressed. That is, the present invention relates to (1) a high content of 108 to 121 in an amino acid sequence including a signal sequence region of a rice-derived 10K prolamin protein downstream of a transcription and translation initiation region functional in a plant. Has a translatable structural gene containing a sulfur amino acid sequence (SEQ ID NO: 1),
(3) An improved plant (hereinafter referred to as a plant of the present invention) containing an expression cassette having a functional poly (A) signal and a transcription termination region capable of functioning in a plant, and the above expression cassette are introduced into the plant. The present invention provides a method for improving the sulfur-containing amino acid content in a plant (hereinafter, referred to as the method of the present invention), which is characterized in that it is expressed.

The present invention will be described in more detail below. Genetic engineering techniques used in the present invention include, for example, J. Sambroo.
k, EFFrisch, T. Maniatis; Molecular Cloning 2nd edition, Cold Spring Harbor Laboratory (Cold Spr)
ing Harbor Laboratory), published in 1989, etc.

"10 derived from rice" used in the present invention
"Translatable structural gene containing 14 highly sulfur-containing amino acid sequences (SEQ ID NO: 1) from 108th to 121st in the amino acid sequence including the signal sequence region of K prolamin protein" is It contains 8 sulfur-containing amino acids, and its amino acid content exceeds 50%. The present invention also includes a translatable structural gene containing this highly sulfur-containing amino acid sequence and an amino acid sequence of a protein not limited to the rice-derived 10K prolamin protein. For example, it can be prepared by the following method. 1. Method for Preparing Genomic DNA from Rice Rice genomic DNA is a powerful surfactant used in many plant tissues, CTAB (cetyltrimethe).
ylammonium bromide) and can be prepared from rice leaf tissue. For example, Hirofumi Uchimiya: Plant Gene Manipulation Manual, Published by Kodansha Scientific, 19
90 years, Rogers SO and AJ Bedich, Plant Molecular
The usual methods described in Biology, 5, 69-76, 1985 can be mentioned. 2. Amplification by PCR DNA consisting of an arbitrary nucleotide sequence containing the above gene region
Primers for PCR amplification of DNA are mainly D
Obtained by chemically synthesizing NA. Alternatively, a DNA fragment obtained by a restriction enzyme fragment or the like that can function as a primer can also be used. At this time,
As a primer, a pair of primers for both ends of an arbitrary nucleotide sequence is used. The term "primer" as used herein refers to a DNA that includes the 5'-terminal sequence of one strand of the target DNA sequence to be synthesized and is required for DNA synthesis by a DNA polymerase using the complementary strand as a template. To amplify DNA using the obtained primer, for example, Innis MA, Gelfand DH and JJSninsky ed .: PC
An ordinary method described in R PROTOCOLS, Academic Press Inc., 1990, etc. can be used. 3. Cloning of rice-derived 10K prolamin protein gene As the cloning vector used for cloning the rice-derived 10K prolamin protein gene, many known cloning vectors can be mentioned. Specifically, for example, pBR322, pUC18, pUC1
Examples include known plasmid vectors such as 9, pACYC177 and pACYC184 and their derivatives, or M13 phage-derived phage vectors and their derivatives. Cloning
A restriction enzyme to be used is selected according to the combination of the cloning site of the restriction enzyme present in any cloning vector and the restriction enzyme cleavage site present in the DNA fragment obtained by amplification by PCR, and the selected restriction enzyme is used. This can be carried out by cleaving the cloning vector, and ligating and closing the DNA fragment having the cleavage site of the selected restriction enzyme with ligase.
Whether or not the cloned DNA fragment has the target gene depends on whether it is cleaved with a restriction enzyme or PC.
It can be confirmed by R or the like. The base sequence can be determined using a radioactive label or a fluorescent label by a method according to the Maxam-Gilbert method or the Sanger method. Thus, the target gene, ie, a translatable structural gene containing 14 highly sulfur-containing amino acid sequences (SEQ ID NO: 1) from 108th to 121st in the amino acid sequence containing the signal sequence region of rice-derived 10K prolamin protein A cloned DNA fragment that is confirmed to have, or an arbitrary DNA fragment having a gene of interest is prepared by cutting an appropriate restriction enzyme cleavage site present in a vector carrying the DNA fragment with a restriction enzyme. be able to. Alternatively, the base sequence itself can be wholly synthesized by chemical synthesis. Furthermore, a novel gene can be prepared by introducing the DNA fragment thus obtained into the in-frame of another structural gene.

The gene having a "transcriptional and translational initiation region capable of functioning in a plant" used in the present invention is derived from T-DNA such as nopaline synthase (nos) promoter or octopapine synthase (ocs) promoter. Or normal promoters such as plant virus promoters such as 19S and 35S promoters derived from cauliflower mosaic virus (CaMV). Further, for example, pea or soybean ribulose-1,5-diphosphate carboxylase small subunit promoter, corn zein promoter, soybean 7Sα'conglycinin promoter, soybean glycinin promoter, French bean phaseolin promoter, etc. Can also give.

The gene having a "poly (A) signal capable of functioning in plants and a transcription termination region" used in the present invention is derived from plants such as T-DNA-derived nopaline synthase terminator and soybean glycinin terminator. Garlic virus GV1, the terminator of
Examples thereof include a terminator derived from a virus such as GV2 terminator.

Next, in the present invention, (1) a transcription and translation initiation region (promoter region) functional in plants
(2) has a translatable structural gene of interest, and (3) constructs an expression cassette having a functional poly (A) signal and a transcription termination region (terminator region) in the plant. For this purpose, a method of ligating each of the above genes (1), (2) and (3) by the action of ligase by using a linker, an adapter or the like, if necessary, can be mentioned. The "linker" described here refers to a double-stranded synthetic DNA that can be bound to the DNA end of interest to introduce a target restriction enzyme recognition sequence. The term “adapter” refers to double-stranded synthetic DNA having one blunt end and the other having cohesive ends, or a double-stranded synthetic DNA having different cohesive ends at both ends. Allows end-to-end bonding.

In the expression cassette thus constructed, the target translatable structural gene and the expression regulatory region are operably linked to each other, and the target protein having a high sulfur-containing amino acid content can be expressed. It is a gene construct.
In addition, it is also possible to obtain a plant body having an arbitrary expression form by selecting an expression control region capable of functioning in a specific plant or specifically in a specific plant organ. For example, by constructing an expression cassette of a protein having a high seed-specific sulfur-containing amino acid content by functionally linking a translatable structural gene of interest with a regulatory region such as a promoter specifically expressed in seed. You can also Alternatively, an expression cassette of a protein having a high sulfur-containing amino acid content can be constructed in which an expression control region derived from a plant virus having no tissue specificity and a translatable structural gene of interest are bound to express the protein throughout the plant. Furthermore, if necessary,
A region encoding a functional secretory signal sequence may be operably linked upstream of a translatable structural gene.

[0011] The constructed expression cassette can be prepared by using, for example, monocotyledonous plants such as corn, sorghum, rye, rye wheat, barley, oats, wheat and onions, or beans such as soybean, bird's foot trefoil and pea, alfalfa, Tobacco, oilseed rape, rape, melon, cucumber, squash, Cucurbitaceae, potato,
Pepper, a method of introducing into solanaceous plants such as tomatoes, carrots, dicotyledons such as celery plants such as celery,
Depending on the plant species, there are systems that utilize infection with the soil bacterium Agrobacterium, systems that introduce genes by electroporation into protoplasts, and systems that introduce genes by particle gun into plant tissues or protoplasts. I can give you. Then, the plant into which the constructed expression cassette has been introduced is regenerated according to a method usually used in plant tissue culture technology, and a plant can be obtained. Such a method
For example, Gelvin, SB, RASchilperoort and DPSVer
by ma .; Plant Molecular Biology / Manual., Kluwer Academic Publis
published in 1988 etc. More specifically, for example, 1. Transformation in soybean The plasmid pSUM-GY1-prolamin described below having the soybean glycinin-prolamin chimeric gene was mixed with the selection GUS / HPT co-expression vector pSUM-GH: NotI, and these mixed plasmids were used, for example, Asako Iida, According to the method described by Toshiya Yamashita, Etsuko Hattori, Hiromichi Morikawa, Gene Transfer Experiment 1-Particle Gun Method-, Plant Cell Engineering, 2,631-637, 1990, somatic embryos are introduced by particle gun bombardment. . After the introduction, the culture is continued in a liquid medium containing hygromycin, and transformed somatic embryos are selected. A plant individual is regenerated from the selected hygromycin-resistant soybean somatic embryo to obtain a transformant soybean with the glycinin-prolamin chimeric gene. 2. Transformation in Bird's Foot Trefoil Transformation in bird's foot trefoil is described, for example, in Petit, A., J. Stougaard, A. Kuhle, KAMarcker a.
nd J. Tempe. “Transformation and regeneration of t
he legume Lotus corniculatus: A system for molecul
ar studies of symbiotic nitrogen fixation. "Molecul
ar and General Genetics, 207, 245-250, 1987 according to the method described above using the soil bacterium Agrobacterium rhizogenes. Seeds of sterilized bird's foot trefoil are germinated and grown on hormone-free MS medium. Agrobacterium rhizog, a soil bacterium having a glycinin-prolamin chimera gene as a plasmid (antibiotic resistance marker) on the hypocotyl of a seedling 8 days after germination
Infect enes. The transformed hairy roots are selected on MS medium containing an antibiotic for selection. Antibiotic-resistant shoots regenerated from hairy roots MS containing antibiotics
Transfer to medium. The expressed plants are transferred to acid-washed sand and grown in a plant cultivator at 22 ° C. 3. Transformation in alfalfa Transformation in alfalfa is described, for example, in Shahi.
n, EA, A. Spielmann, K. Sukhapinda, RBSimpson an
d M. Yashar. “Cell Biology & Molecular Genetics: T
ransformation of Cultivated Alfalfa Using Disarmed
Agrobacterium tumefaciens. "CROP SCIENCE, 26, 123
It can be carried out according to the method of Shahin et al. A stalk of alfalfa (about 5 cm) is sterilized with hypochlorous acid and then aseptically cut to a thickness of 2 to 3 mm. A soil bacterium Agrobacterium tumefaciens having a plasmid (antibiotic resistance marker) constructed by ligating the obtained section with a terminator of 35S promoter / nopaline synthase (nos) derived from cauliflower mosaic virus and a prolamin chimera gene.
Infect. The transformed callus is selected on MS medium containing an antibiotic for selection. The selected callus is regenerated on a regeneration medium to obtain a recombinant plant.

[0012]

EXAMPLES Examples will be described below in more detail, but the present invention is not limited thereto.

Example 1 (Cloning of rice-derived 10K prolamin protein gene) About 1 g of rice (variety name: Nipponbare) leaf tissue was ground in liquid nitrogen using a mortar. 10 ml of 2x CTAB solution (2% cetyltrimethyla in a 50 ml Falcon tube)
mmonium bromide, 100mM Tris-HCl (pH8.0), 20mM EDTA, 1.
4M NaCl, 1% polyvinylpyrrolidone) was added and the temperature was kept at 60 ° C. The leaves were put into a tube little by little, shaken lightly, and then kept at 60 ° C. for 30 minutes. 10 ml
Chloroform: isoamyl alcohol (24: 1) was added and shaken for 15 minutes, followed by centrifugation (10,000g, 10min, 20
℃) was transferred to a new 50ml tube. To this, 7 ml of isopropyl alcohol was added and mixed. Centrifuge (10,000g, 15min, 20
DNA was precipitated at 1 ° C.) and the obtained DNA was mixed with 1 ml of T
It was dissolved in E (10 mM Tris-HCl (pH 8.0), 1 mM EDTA). 10
μg / ml of RNase A was added, and the mixture was left standing at 37 ° C. for about 45 minutes. After phenol extraction was performed once, 1/2 volume of phenol and an equal volume of chloroform were added and extraction was performed again. The upper layer obtained by performing centrifugation (10,000 g, 10 min, 20 ° C.) was transferred to a 15 ml Falcon tube. Chloroform extraction once more, then 1/10
Volume of 3M sodium acetate (pH5.2) and 2.5 volumes of ethanol were added and mixed, followed by centrifugation (10,000g, 15min, 4
Genomic DNA was obtained. Obtained genomic DNA
Two synthetic primer DNAs having the following nucleotide sequences (SEQ ID NOS: 2 and 3) N-1 (28mer) using 50 μg as a sample: 5′-GATGGTACCGTCTACACCATCTGG
AATC-3 'C-1 (29mer): 3'-TCCGTCGACGCAAGTCTGAAAATG
Amplification of the rice-derived 10K prolamin protein gene was performed using the PCR method with ATTGA-5 '(see FIG. 1). The amplified gene was cut at the KpnI and SalI sites, and the resulting gene fragment was ligated to the commercially available cloning vector pUC119 (Takara Shuzo Co., Ltd.), which was also cut at the KpnI and SalI sites.
The plasmid pUC-prolamin was obtained. KpnI and Sal
For the gene fragment cleaved at the I site, Applied Biosystems model 373A fluorescence D based on the dideoxy method was used.
By examining the base sequence with an NA sequencer, the base sequence of the rice-derived 10K prolamin protein gene (SEQ ID NO: 7: position numbers 51 to 455 of the base sequence).
(See reference).

Example 2 (Construction of expression cassette) From the BglII site to the SalI site of the rice-derived 10K prolamin protein gene fragment obtained in Example 1,
Seed-specific expression vector pSUM-GY1 (Department No. FERM BP-41, Institute of Biotechnology, Institute of Biotechnology, Industrial Technology Institute)
31: T4DNA with a synthetic linker NcoBgl (SEQ ID NO: 6) between the promoter and terminator of the soybean seed storage protein glycinin gene GY1 of Escherichia coli HB101 / pSUM-GY1), that is, between the NcoI site and the SalI site.
It was introduced using ligase to obtain the desired expression cassette, plasmid pSUM-GY1-prolamin (see FIG. 2). The obtained expression cassette had a single BglII site, and the cloned BglII-SalI fragment of the rice-derived 10K prolamin protein gene was confirmed.
In addition, pSUM-GY1-derived EcoRI-HindIII fragment, EcoRI-
A SalI fragment was also confirmed, and it was confirmed that the obtained expression cassette was the desired plasmid pSUM-GY1-prolamin.

Example 3 (Introduction of Expression Cassette into Plant) Plasmid pSUM-GY1-prol obtained in Example 2
After digesting amin with the restriction enzyme EcoRI, the ends were blunt-ended with T4 DNA polymerase. A plasmid pSUM-GY1-prolamin (Hin, in which Hind III linker (CCAAGCTTGG) was introduced into the obtained blunt end using T4 DNA ligase
d) was digested with the restriction enzyme Hind III. The gene fragment cut out by this digestion was introduced into the Hind III site of a commercially available binary vector pBI121 (manufactured by Clontech) to prepare two types of plasmids (plasmid pBI-GY1-prola).
min, plasmid pBI-GY1-prolamin R) was obtained (see FIG. 3). With each of the two types of plasmids obtained,
Agrobacterium tumefaciens (LBA4404 strain: streptomycin-resistant rifampicin-resistant), which had been previously made competent by calcium chloride treatment, was transformed. The transformant is a kanamycin resistance gene (neomycin phosphotransferase: NPTII) contained in the introduced plasmid.
Utilizing the trait of resistance to kanamycin conferred by K., L-medium containing streptomycin 300 μg / ml, rifampicin 100 μg / ml, kanamycin 25 μg / ml [bacto-tryptone 10 g, yeast extract 5 g, Na
Cl 5 g, dist. Water 1 L (pH 7.0)]. The resulting transformant, Agrobacterium (Agrobacterium tumefaciens LBA4404 strain: SmR Ri
fR) was cultured in L-medium containing streptomycin (300 μg / ml), rifampicin (100 μg / ml) and kanamycin (25 μg / ml) at 28 ° C. for one day and the obtained bacterial solution was added to Gelvin, SB,
RASchilperoort and DPSVerma .; Plant Molecular Biology / Manual (Plant Molecula
r Biology / Manual.), published by Kluwer Academic Publishers, published by Ruwer Academic Publishers, 1988, etc., and used for infection of leaf disc pieces of tobacco by a usual method. MS-N infected leaf disc pieces
The cells were cultured on B agar medium for 4 days. On the 4th day, the cells were transferred to MS-NB + cefotaxime (500 μg / ml) agar medium to eradicate Agrobacterium. MS-NB + on the 11th day
Cefotaxime (500 μg / ml) + Kanamycin (20
0 μg / ml) was transferred to an agar medium, and selection of transformant tobacco cells was started. After about 4 weeks, the green differentiated seedlings were excised and transplanted to hormone-free MS + cefotaxime (300 μg / ml) + kanamycin (50 μg / ml) agar medium. After selection with kanamycin while further substituting, recombinant plants were obtained.

Example 4 (Detection of Expressed Rice-derived 10K Prolamin Protein: Analysis by Electrophoresis) 100 μl of an extract (60% n-propanol, 5%) was added to 10 mg of the seeds of the recombinant plant obtained in Example 3. 2-me
rcaptoethanol, 1 mM phenylmethanesufonylfuloride)
After destroying the tissue, centrifuge (15,000 rpm, 5 mi
n, 4 ° C.), and the supernatant was collected as an extracted sample (alcohol-soluble prolamin protein fraction). The recovered extracted sample was subjected to 20% SDS-PAGE and the protein in the gel was detected by silver staining. The result is shown in FIG.
In the seeds of the recombinant plant (the present invention section), rice-derived 10K
A band of prolamin protein (molecular weight about 10 Kdal) was detected. On the other hand, no corresponding band was present in the seeds (control group) of plants that did not have the rice-derived 10K prolamin protein gene.

Example 5 (Detection of Expressed Rice-derived Prolamin Protein: Immunological Analysis by Western Blot) A mature protein region excluding the signal sequence of rice-derived 10K prolamin protein as an antigen for preparing an antibody against the prolamin protein A protein gene in which G. thaliana was fused to glutathione S transferase was constructed by the following procedure. First, as a plasmid pUC-prolamin 1.4 ng sample, two synthetic primers DN having the following base sequences were used.
A (SEQ ID NOS: 4 and 5) N (35mer): 5'-GGTGAATTCATCACCACTATGCAGTATTTC
CCACC-3 'C (39mer): 3'-GGTGAATTCAAGCTTTCAACAACAACCACA
A gene in the mature protein region was amplified by the PCR method using GGAAGAGAG-5 '. The amplified gene is cleaved at the EcoRI site,
The obtained gene fragment was ligated to a commercially available fusion protein preparation vector pGEX-1λT (manufactured by Pharmacia) which was also cleaved at the EcoRI site to obtain a plasmid pGEX-1λT-prolamin. The orientation of the introduced gene fragment was confirmed by analysis with a restriction enzyme and PCR using a synthetic primer DNA. Obtained fusion protein expression plasmid pGEX-1
Escherichia coli HB101 into which λT-prolamin had been introduced was cultured in L-medium, and expression was induced by IPTG according to a conventional method to carry out large-scale expression of the fusion protein. The cells obtained by culturing were ultrasonically disrupted on ice water (40 W, 10 min, 4 ° C.) and then centrifuged (10,000 g, 20 min, 4 ° C.) to obtain an insoluble protein fraction. The resulting insoluble protein fraction was subjected to 20% SDS-PAGE to separate the fusion protein. The fusion protein thus separated was cut out from the gel, and then 50 mM Tris-HCl (pH 8.
The fusion protein was extracted with 0), 0.1% SDS and 1% 2-mercaptoethanol, and the fusion protein was recovered by acetone precipitation. Then, using the recovered fusion protein as an antigen, intravenous injection was performed on mouse Balb / c together with Freund's adjuvant. Thus immunized mouse Balb
Whole blood was collected from / c to prepare antiserum containing an antibody against the fusion protein. The alcohol-soluble prolamin protein fraction extracted from the recombinant plant was subjected to 20% SDS-PAGE in the same manner as in Example 4, and the separated protein was electrically transferred to a nitrocellulose membrane. Then, the transcribed protein was subjected to antigen-antibody reaction with the antiserum prepared as described above, followed by detection. The result is shown in FIG. The band detected by silver staining in Example 4 was also detected by the immunological detection method, and it was confirmed that the expressed protein was rice-derived 10K prolamin protein.

Example 6 (Amino Acid Analysis of Recombinant Plant) 1 g of the seed of the recombinant plant prepared in Example 3 was crushed in a mortar chilled on ice, and then 10 ml of extraction liquid (60%) was added. It was suspended in n-propanol, 5% 2-ME, 1 mM PMSF) and left in ice for about 1 hour. The suspension was separated by centrifugation (10,000g, 10min, 4 ° C), and the supernatant was collected. Furthermore, 10 ml of the same extraction solution was added to the precipitate, and
After leaving for a minute, the supernatant was collected in the same manner. The collected supernatants were combined and the resulting oily substance was removed by a pipette to obtain a plant extract. The plant extract 10
The ml was hydrolyzed with 6N hydrochloric acid (110 ° C., 22 hours).
After the hydrolysis, the treatment liquid was dried and the volume was adjusted to 10 ml with 0.02N hydrochloric acid to prepare a sample solution for analysis. Amino acid analysis was performed on 40 μl of this sample solution. The result is shown in FIG.
The recombinant plant by pBI-GY1-prolamin R (the present invention group) is a recombinant plant by pBI121 (control group).
It was revealed that the methionine content was significantly higher than that of

Example 7 (Transformation in soybean) Soybean cultivar "Fayett" adventitious embryos were arranged in a layer at a central portion of a 6 cm agar plate and within a circumference of 20 mm in diameter. Example 2 having a soybean glycinin-prolamin chimeric gene
The plasmid pSUM-GY1-prolamin obtained by was mixed with β-glucuronidase for selection (GUS) / hygromycin resistance gene (HPT) co-expression vector pSUM-GH: NotI,
These mixed plasmids were applied to the soybean somatic embryos described above by particle gun bombardment (800 mg / coated gold particles 200 μg / shot, projectile stopper /
The distance between samples was 100 mm). After the introduction, using a MS-modified growth liquid medium (Sigma) containing hygromycin 25 to 50 μg / ml, the cells were cultivated by rotation under illumination at 25 ° C. for 16 hours to select transformed somatic embryos. Synthetic DNA NcoBg1 was isolated from hygromycin-resistant soybean somatic embryos selected after 3 months that had a yellow-green color and retained the ability to grow.
(SEQ ID NO: 6) and C-1 (SEQ ID NO: 3) are used as primers to check whether or not the rice-derived 10K prolamin protein gene region is amplified, and confirm the insertion of the rice-derived 10K prolamin protein gene into the soybean chromosome. did. Furthermore, a plant individual was regenerated from the obtained somatic embryo, and after about 4 months, a transformant soybean with the glycinin-prolamin chimeric gene was obtained.

The compositions of the MS medium and MS-NB medium used in the examples are shown below. 1. MS medium [MS-1 100 culture solution] Na2EDTA 1865 mg, FeSO4-7H2O 1390 mg, dist.water 500 ml [MS-2 100 culture solution] MgSO4 / 7H2O 18500 mg, MnSO4-4H2O 1115 mg, ZnSO4 / 7H2O 430 mg, CuSO4-5H2O 1250 μl ( 1 mg / ml stock), dist.water 500 ml [MS-3 100 medium] CaC12 ・ 2H2O 22000 mg, KI 42 mg, CoC12 ・ 6H2O 1250 μl (1 mg / ml stock), dist.water 500 ml [MS-4 100 medium] KH2PO4 8500 mg, H3BO3 310 mg, Na2MoO4 · 2H2O 12500 μl (1 mg / ml stock), dist.water 500 ml [MS-5 50 medium] KH4N03 82500 mg, dist.water 1000 ml [MS-6 50 medium] KN03 95000 mg, dist.water 1000 ml [MS-7 100 medium] m-inositol 5000 mg, thiamine chloride 5 mg pyridoxine hydrochloride 25 mg, nicotinic acid 25 mg glycine 100 mg, dist.water 500 ml [MS-1 100 medium] 10 ml, [MS-2 100 medium] To 10m
l, 10 ml of [MS-3 100 medium], 1 of [MS-4 100 medium]
0 ml, 20 ml of [MS-5 50 medium], 20 ml of [MS-6 50 medium], 10 ml of [MS-7 100 medium], and pH 5.8
After the preparation, the final liquid volume was adjusted to 1000 ml. 2. MS-NB medium NAA (1-naphthalene acetic acid) 0.1 mg in the above MS medium
/ L, BA (benzyl adenine) 1.0 mg / l was added.

[0021]

Industrial Applicability According to the present invention, it becomes possible to improve the sulfur-containing amino acid content in a plant in a short period of time and labor-saving, as compared with the conventional breeding mainly based on crosses. It has become possible to improve the nutritional value of many plants, such as beverage crops.

[Sequence list]

SEQ ID NO: 1 Sequence length: 14 Sequence type: Amino acid Topology: Linear sequence Characteristics Origin Biological name: Rice (Oryza sativa L.) Breed name: Nipponbare Type of tissue: Seed : Peptide location: 1. ． 14 (108 ... 121) Characterization Method: E Sequence Met Met Lys Met Ala Met Gln Met Pro Tyr Met Cys Asn Met 1 5 10 14 (108) (121)

SEQ ID NO: 2 Sequence Length: 28 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence GATGGTACCG TCTACACCAT CTGGAATC 28

SEQ ID NO: 3 Sequence Length: 29 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence TCCGTCGACG CAAGTCTGAA AATGATTGA 29

SEQ ID NO: 4 Sequence Length: 35 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence GGTGAATTCA TCACCACTAT GCAGTATTTC CCACC 35

SEQ ID NO: 5 Sequence Length: 39 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence GGTGAATTCA AGCTTTCAAC AACAACCACA GGAAGAGAG 39

SEQ ID NO: 6 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CATGGCAGCATACACCAGCAA CGTCGTATGTGGTCGTTCTAG

SEQ ID NO: 7 Sequence length: Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear sequence Characteristics Origin Biological name: Rice (Oryza sativa L.) Breed name: Nipponbare Type of organization : Seed Characteristic symbol: peptide Location: 51. ． 455 Method of Characterizing: E Sequence CGTCTACACC ATCTGGAATC TTGTTTAACA CTAGTATTGT AGAATCAGCA 50 ATG GCA GCA TAC ACC AGC AAG ATC TTT GCC CTG TTT GCC TTA ATT GCT 98 Met Ala Ala Tyr Thr Ser Lys Ile Phe Ala Leu Ale 10 Leu Ale 10 Leu Ale 15 CTT TCT GCA AGT GCC ACT ACT GCA ATC ACC ACT ATG CAG TAT TTC CCA 146 Leu Ser Ala Ser Ala Thr Thr Ala Ile Thr Thr Met Gln Tyr Phe Pro 20 25 30 CCA ACA TTA GCC ATG GGC ACC ATG GAT CCG TGT AGG CAG TAC ATG ATG 194 Pro Thr Leu Ala Met Gly Thr Met Asp Pro Cys Arg Gln Tyr Met Met 35 40 45 CAA ACG TTG GGC ATG GGT AGC TCC ACA GCC ATG TTC ATG TCG CAG CCA 242 Gln Thr Leu Gly Met Gly Ser Ser Thr Ala Met Phe Met Ser Gln Pro 50 55 60 ATG GCG CTC CTG CAG CAG CAA TGT TGC ATG CAG CTA CAA GGC ATG ATG 290 Met Ala Leu Leu Gln Gln Gln Cys Cys Met Gln Leu Gln Gly Met Met 65 70 75 80 CCT CAG TGC CAC TGT GGC ACC AGT TGC CAG ATG ATG CAG AGC ATG CAA 338 Pro Gln Cys His Cys Gly Thr Ser Cys Gln Met Met Gln Ser Met Gln 85 90 95 CAA GTT ATT TGT GCT GGA CTC GGG CAG CAG CAG ATG ATG AAG ATG GCG 386 Gln Val Ile Cys Ala Gly Leu Gly Gln Gln Gln Met Met Lys Met Ala 100 105 110 ATG CAG ATG CCA TAC ATG TGC AAC ATG GCC CCT GTC AAC TTC CAA CTC 434 Met Gln Met Pro Tyr Met Cys Asn Met Ala Pro Val Asn Phe Gln Leu 115 120 125 TCT TCC TGT GGT TGT TGT TGA TCAAA CGTTGGTTAC ATGTACTCTA 480 Ser Ser Cys Gly Cys Cys *** 130 GTAATAAGGT GTTGCATACT ATCGTGTGCA AACACTAGAA ATAAGAACCA TTGAATAAAA 540 TATCAATCAT GC

[Brief description of drawings]

FIG. 1 P of rice-derived 10K prolamin protein gene
Amplification by CR method The base sequence of the synthetic primer DNA used in the PCR method is shown above. The arrow "5'-pr" shown in this nucleotide sequence
“Olamin” and “3′-prolamin” indicate the upstream and downstream ends of the rice-derived 10K prolamin protein gene, respectively, and “matureprolamin” indicates the final rice-derived 10K prolamin protein gene.
The gene region encoding the K prolamin protein is shown. The direction of the arrow indicates the direction of transcription of the rice-derived 10K prolamin protein gene. The structure of the rice 10K prolamin protein gene is shown below. Synthetic primer DN
It shows which position each A corresponds to, and the direction of the DNA synthesized from each synthetic primer DNA is indicated by an arrow. "Signal sequence" is
The sequence required for the protein to be secreted from the endoplasmic reticulum is shown, and "mature prolamin" (mature protein) shows the gene region encoding the final rice-derived 10K prolamin protein.

[Fig. 2] Plasmid pS which is a seed-specific expression vector.
Construction of expression cassette by UM-GY1 Plasmid pSUM-GY1 is a seed-specific expression vector, and the region between EcoRI and NcoI sites is the region between soybean glycinin gene promoter region and SalI and HindIII sites. Indicates the transcription termination region of the glycinin gene. The base sequence shown at the top shows double-stranded DNA synthesized as an NcoBgl linker. Plasmid pU
C-prolamin is a plasmid into which the rice-derived 10K prolamin protein gene has been cloned. The finally obtained plasmid pSUM-GY1-prolamin having the glycinin-prolamin chimeric gene is shown at the bottom. GY1-pro, GY1-t
er represents the promoter region and transcription termination region of the soybean glycinin gene, respectively.

[Fig. 3] Construction of a plasmid for gene transfer by Agrobacterium infection. Two diagrams shown by pBI-GY1-prolamin and pBI-GY1-prolamin R are binary vector pBI121 for gene transfer.
3 shows the direction in which the glycinin-prolamin chimeric gene introduced in 1. was introduced. Here, “prolamin” indicates a gene encoding a protein containing the signal sequence region of the rice-derived 10K prolamin protein. `` GY1-pro
And "GY1-ter" respectively indicate the promoter region and transcription termination region of the soybean glycinin gene. NPTI
"I" indicates a kanamycin resistance gene (neomycin phosphotransferase) derived from Escherichia coli transposon Tn5. "Β
-Glucuronidase "indicates a β-glucuronidase gene derived from Escherichia coli. "NOS pro" and "NOS ter" represent the promoter region and transcription termination region of Agrobacterium-derived nopaline synthase, respectively, and "CaMV35S" represents the cauliflower mosaic virus 35S promoter region.

FIG. 4 Rice-derived 10 in seeds of recombinant plants
Analysis of K prolamin protein by electrophoresis The numbers shown on the left side of the photograph show the molecular weight of the standard protein. Lane "pBI121" is a binary vector for gene transfer, the protein extracted with alcohol from recombinant tobacco seed introduced pBI121, lane "GYI-prolamin R", lane "GYI-prolamin", each expression cassette 2 shows a protein extracted with alcohol from a recombinant tobacco seed transformed with a plasmid containing The arrow on the right indicates the migration position of the expressed rice-derived 10K prolamin protein.

FIG. 5: Immunological analysis by Westen blot The numbers shown on the left side of the photograph show the molecular weight of the standard protein. The arrow on the right indicates the migration position of the expressed rice-derived 10K prolamin protein.

FIG. 6 shows changes in amino acid content in a protein fraction extracted from a recombinant tobacco seed into which a rice-derived 10K prolamin protein gene has been introduced by alcohol extraction. The vertical axis represents the total of 16 kinds of amino acid contents described on the vertical axis. The content of each amino acid when 100% is shown.
The abscissa represents the amino acid content value (%) in the recombinant tobacco (the present invention group) into which the rice-derived 10K prolamin protein gene was introduced, and the recombinant tobacco into which the gene-transducing binary vector pBI121 was introduced ( The value was divided by the same value in the control group). The graphs shown in black and white show the results of two independent experiments for the same strain.

 ─────────────────────────────────────────────────── ─── Continuation of the front page (72) Inventor Kenji Oeda 4-2-1 Takashi, Takarazuka-shi, Hyogo Sumitomo Kagaku Kogyo Co., Ltd.

Claims (4)

[Claims] 1. A 1 in an amino acid sequence containing a signal sequence region of a rice-derived 10K prolamin protein (1) downstream of a transcription and translation initiation region functional in a plant.
It has a translatable structural gene containing 14 high-sulfur amino acid sequences (SEQ ID NO: 1) from the 08th to the 121st, and (3) functions in plants as a poly (A) signal and a transcription termination region. Improved plants containing expression cassettes having possible forms. 2. A translatable structural gene derived from rice is 10K.
The improved plant according to claim 1, which is all of the structural genes encoding the mature protein region excluding the signal sequence region of the prolamin protein. 3. The improved plant according to claim 1, which is a plant cell, a plant seed or a plant. 4. An amino acid sequence comprising (1) a signal sequence region of a rice-derived 10K prolamin protein downstream of a transcription and translation initiation region functional in a plant (2).
It has a translatable structural gene containing 14 high-sulfur amino acid sequences (SEQ ID NO: 1) from the 08th to the 121st, and (3) functions in plants as a poly (A) signal and a transcription termination region. A method for improving the sulfur-containing amino acid content in a plant, which comprises introducing an expression cassette having a possible form into the plant and expressing the same.