CN103060465A - Method for detecting hatchability of insect eggs by using spermatin gene - Google Patents
Method for detecting hatchability of insect eggs by using spermatin gene Download PDFInfo
- Publication number
- CN103060465A CN103060465A CN2013100314057A CN201310031405A CN103060465A CN 103060465 A CN103060465 A CN 103060465A CN 2013100314057 A CN2013100314057 A CN 2013100314057A CN 201310031405 A CN201310031405 A CN 201310031405A CN 103060465 A CN103060465 A CN 103060465A
- Authority
- CN
- China
- Prior art keywords
- insect
- primer
- sequence
- cssfp066
- candle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting the hatchability of insect eggs by using a spermatin gene. The invention provides an application of a substance for detecting the expression level of a spermatin CSSFP066-coding gene in insect populations fed with different substances in detection of the hatchability of the eggs of the insect populations fed with different substances; and the amino acid sequence of a spermatin CSSFP066 is sequence 2 in a sequence table. According to the method disclosed by the invention, experiments prove that the detection method provided by the invention can be used for detecting the hatchability of the insect eggs, in particular to the hatchability of the eggs of arma chinensis with different nutrient sources; and the detection of the hatchability of the insect eggs by the detection method disclosed by the invention only requires 2-3 days. However, the use of a traditional biological method requires about 30-60 days. The detection method disclosed by the invention has the advantages of wide range of involved material sources, easiness in purchase, simplicity in operation, and time-saving and labor-saving properties, and is suitable for popularization and application in commodity inspection and detection of insects.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of method with spermatine gene test insect egg hatching rate.
Background technology
Biological control of insect pests is being brought into play irreplaceable vital role in the agroforestry Sustainable development.A large amount of productions of natural enemy insect are the most basic in the biological control especially also to be most important link.Predatory natural enemy insect Candle-sticks stinkbug (Armachinensis) can be controlled from multiple agriculture and forestry injurious insects such as lepidopteran, Coleoptera, Hemiptera, Homoptera, Hymenopteras, especially it can also control alien insect pest colorado potato bug and fall webworms, so the Candle-sticks stinkbug is the good natural enemy insect commodity of a kind of application prospect.
As commodity, a large amount of Decrease production costs are the maximized approach of people's profit-push.In natural enemy insect Candle-sticks stinkbug produces, just can use different food and produce the Candle-sticks stinkbug, for example, different insect preys, contain the artificial diet of insect composition and do not contain the artificial diet of insect composition, and then Decrease production cost.But the biological characteristics of using different foodstuffs production Candle-sticks stinkbug out is uneven, can reach the effect of good Control pests after some discharges, have then after release effect not remarkable.Because the Candle-sticks stinkbug that different foods are fed is difficult to distinguish in phenotype, so these natural enemy insects are to be difficult to their biological characteristics of assessment before release.
The egg hatching rate of Candle-sticks stinkbug adult is a very important index estimating the natural enemy insect biological characteristics.Have the Candle-sticks stinkbug population breeding of higher egg hatching rate fast, the doubling time is short, can control rapidly in a short time insect.This can greatly reduce the cost of pest control, increases rate of profit.On the contrary, the Candle-sticks stinkbug that egg hatching rate is lower is because ovum is hatched less, breeding is slow, and the doubling time prolongs, and the time of therefore controlling insect can relatively lag behind, and this has just increased cost accounting greatly, has reduced profit.At present, still be that this method wastes time and energy expensive what of spawning time or artificial its egg hatching rate of specific time build-in test for the detection method of the commodity Candle-sticks stinkbug egg hatching rate of different food sources or different businessmans.Therefore the method that needs a kind of rapid detection natural enemy insect commodity biological characteristics-egg hatching rate.
In the insect body, spermatine (seminal fluid protein CSSFP066) results from the male worm accessory gland, and it can stimulate the storage of sperm, the appropriate property that substitutes and compete, increases significantly male worm of delay sperm.
Summary of the invention
An object of the present invention is to provide the material purposes for detection of spermatine CSSFP066 encoding gene expression amount.
The application of material in detecting the insect egg hatching rate for detection of spermatine CSSFP066 encoding gene expression amount provided by the invention;
The aminoacid sequence of described spermatine CSSFP066 is the sequence 2 in the sequence table.
In the above-mentioned application, described insect is insect individuality or insect population;
Described insect population is specially and takes food the different substances insect population; The described different substances insect population that takes food further is specially the insect population that takes food artificial diet or the insect population that takes food prey;
The nucleotides sequence of described spermatine CSSFP066 encoding gene is classified sequence 1 in the sequence table or the sequence 1 in the sequence table as from 5 ' terminal 1-312 position Nucleotide.
Described insect is specially the Candle-sticks stinkbug.
Above-mentioned artificial diet are prepared as follows: live pig liver 60g, soyflour 10g, water 100ml, egg 20ml, casein food grade 2g, sucrose 8g, VC0.2g, choline chloride 60 0.4g, calcium pantothenate 8mg, folic acid 0.1mg, niacinamide 0.2mg, gentamicin 3.9mg; Concrete feeding method is seen embodiment 2;
Above-mentioned prey is tussah (Antheraea pernyi) pupa; Concrete feeding method is seen embodiment 2.
In the above-mentioned application, described material for detection of spermatine CSSFP066 encoding gene expression amount is following 1)-3) in any one:
1) primer is to A: described primer is to being comprised of primer 1 and primer 2; The nucleotides sequence of described primer 1 is classified sequence 3 in the sequence table as; The nucleotides sequence of described primer 2 is classified sequence 4 in the sequence table as;
2) contain described primer to the RT-PCR reagent of A;
3) contain described primer to the test kit of A or described RT-PCR reagent.
In the above-mentioned application, described RT-PCR reagent is comprised of A, fluorescence dye and Taq enzyme water, RT-PCR amplification buffer, magnesium ion, dNTPs, described primer;
Described primer is specially 0.2-1 μ M to the final concentration of each bar primer in described RT-PCR reagent among the A, and described primer further is specially 0.25 μ M to the final concentration of each bar primer in described RT-PCR reagent among the A;
Described test kit also comprises the confidential reference items primer to B, and described confidential reference items primer is comprised of primer 3 and primer 4 B; The nucleotides sequence of described primer 3 is classified the sequence 6 in the sequence table as; The nucleotides sequence of described primer 4 is classified the sequence 7 in the sequence table as.
Another object of the present invention provides a kind of method that detects the insect egg hatching rate.
Method provided by the invention comprises the steps: with described primer A or described RT-PCR reagent or described test kit to be carried out the RT-PCR amplification to insect A to be measured and B;
If the expression amount of the spermatine CSSFP066 gene of described insect A is higher than described insect B, then described insect A egg hatching rate is higher than described insect B.
In the aforesaid method, described insect is insect individuality or insect population; The template of described RT-PCR amplification is the cDNA of insect;
Described insect is specially the Candle-sticks stinkbug.
In an embodiment of the present invention, described insect A is the insect population that takes food prey; Described insect B is the insect population that takes food artificial diet.
Of the present inventionly experiment showed, that detection method provided by the present invention can detect by detecting spermatine CSSFP066 gene expression amount the egg hatching rate of Candle-sticks stinkbug of the insect egg hatching rate, particularly Different Nutrition source of different population.Experiment showed, that the egg hatching rate with detection method detection insect of the present invention only needs 2-3 days.And need about 30-60 days with traditional biological method.The material source that detection method of the present invention relates to is wide, easily buys, and is simple to operate, saves time, laborsaving, is suitable for applying in the insect commodity inspection detects.
Description of drawings
Fig. 1 is Candle-sticks stinkbug beta-actin confidential reference items amplification curves
Fig. 2 is Candle-sticks stinkbug beta-actin confidential reference items melt curve analysis
Fig. 3 is Candle-sticks stinkbug spermatine CSSFP066 gene amplification curve
Fig. 4 is Candle-sticks stinkbug spermatine CSSFP066 gene melt curve analysis
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
Spermatine CSSFP066 and the discovery of encoding gene and the design of primer special of embodiment 1, detection insect egg hatching rate
Research is found, the spermatine gene is a kind of good molecule marker that detects the insect egg hatching rate, so the present invention detects the egg hatching rate of Candle-sticks stinkbug by spermatine (the seminal fluid protein CSSFP066) expression of encoding gene that detects the Candle-sticks stinkbug.
The nucleotides sequence of the spermatine CSSFP066 encoding gene of Candle-sticks stinkbug is classified sequence 1 in the sequence table or the sequence 1 in the sequence table as from 5 ' terminal 1-312 position Nucleotide, and the aminoacid sequence of this albumen is the sequence 2 in the sequence table.
The primer that is designed for this encoding gene of amplification according to the spermatine CSSFP066 encoding gene of Candle-sticks stinkbug is as follows:
Upstream primer: TCACCAGTCCTTGCTTCGAC(sequence 3);
Downstream primer: TGCACTCGTAGGGATTTTGTC(sequence 4).
The application in detecting Candle-sticks stinkbug egg hatching rate of embodiment 2, spermatine CSSFP066 or encoding gene or primer special
Candle-sticks stinkbug (the Arma chinensis that adopts in the following experiment; be documented in Taxonomic and bionomic notes onArma chinensis (Fallou) (Hemiptera:Pentatomidae:Asopinae; Zootaxa; 3382:41-52; 2012; the public can obtain from Plant Protection institute, Chinese Academy of Agricultral Sciences) be divided into two groups, 50 every group according to the difference that takes food material:
Take food artificial diet group Candle-sticks stinkbug: the Candle-sticks stinkbug of the artificial diet of feeding (27 ± 1 ° of C, 16:8 (L:D), 75 ± 5%RH) every days every adult 160 μ l artificial diet of feeding, until the natural death of Candle-sticks stinkbug;
Take food prey group Candle-sticks stinkbug: (75 ± 5%RH) every pair of adults prey of feeding was taken food situation every 7-15 days according to prey and is changed a prey, until the natural death of Candle-sticks stinkbug the Candle-sticks stinkbug of the prey of feeding for 27 ± 1 ° of C, 16:8 (L:D);
Artificial diet make a living pork liver 60g, soyflour 10g, water 100ml, egg 20ml, casein food grade 2g, sucrose 8g, VC0.2g, choline chloride 60 0.4g, calcium pantothenate 8mg, folic acid 0.1mg, niacinamide 0.2mg, gentamicin 3.9mg;
Prey is tussah (Antheraea pernyi) pupa (commercially available).
One, the acquisition of Candle-sticks stinkbug cDNA
1, Candle-sticks stinkbug RNA extracting
Step is as follows:
Each group Candle-sticks stinkbug sample is moved in the mortar that adds an amount of liquid nitrogen, fast, firmly grind to form homogenate, move in the 1.5ml centrifuge tube.
Add 1000 μ lTri zol in the 1.5ml centrifuge tube, left standstill 5 minutes.
Add 200 μ l chloroforms, vortex vibration 10 seconds was left standstill 5 minutes, put into whizzer, and 12,000g4 ℃ centrifugal 15 minutes.
Supernatant liquor is transferred in the new 1.5ml centrifuge tube, adds isopyknic Virahol, the vibration mixing was placed 1 hour for-20 ℃, and room temperature left standstill 10 minutes.
Put into whizzer, 12,000g, 4 ℃ are centrifugal 10 minutes.
Abandon supernatant liquor, Virahol is eliminated, add the dehydrated alcohol of 1ml75%, 12,000g, 4 ℃ are centrifugal 5 minutes.
Abandon supernatant liquor, add DEPC and process water after precipitation is dry ,-80 ℃ of preservations obtain RNA.
2, reverse transcription
Adopt Superscript Ш Reverse Transcriptasekit test kit (Invitrogen18080044) to carry out reverse transcription:
A) eppendorf without the RNA enzyme that gets a sterilization manages, and each sample adds component as shown in table 1 below and obtains mix1;
Table 1 adds component 1 for reverse transcription
| Component | Volume | The source |
| Up?to5μg?total?RNA | 5μl | ? |
| Primer(50μM?oligio(dt) | 0.5μl | Invitrogen |
| Random?primer | 0.5μl | Invitrogen |
| 10mM?dNTP?Mix | 1μl | Invitrogen |
| DEPC-treated?water | 5μl | ? |
| Total | 12μl | ? |
B) mix165 ℃ of temperature bathed 5 minutes, then put immediately 1 minute on ice;
C) in mix1, add composition as shown in table 2 below, obtain mix2 totally 20 μ l systems;
Table 2 adds component 2 for reverse transcription
D) processed 5 minutes for 25 ℃;
E) processed 60 minutes for 50 ℃;
F) processed 15 minutes for 70 ℃, be placed into immediately on ice;
G) obtain cDNA, and this cDNA can preserve half a year at-20 ℃.
Two, RT-PCR amplification
The volume of each component is as shown in table 3 below in the RT-PCR amplification system, adopts SYBR (R) Green I NucleicA kit (Invitrogen S7567):
Table 3 is the volume of each component in the pcr amplification system
The PCR reaction conditions is as shown in table 4:
Table 4 is the PCR reaction conditions
| Circulation | Loop cycle |
| 95 ℃, 2 minutes | ? |
| 40 circulations | The first step sex change: 95 ℃, 10 seconds |
| ? | Second step annealing: 60 ℃, 30 seconds |
| Solubility curve | 60 ℃-95 ℃, increased by 0.5 ℃ in per 5 seconds |
As reference gene (sequence 5), the primer of this reference gene that increases is as follows with Candle-sticks stinkbug beta-actin (ACTB):
Confidential reference items upstream primer: TGTCCAAGCAGGAGTACGAC(sequence 6);
Confidential reference items downstream primer: GGTTCCTCTTTGGAGTCCGATT(sequence 7).
If the spermatine CSSFP066 gene average expression amount that takes food in the Candle-sticks stinkbug group of prey is higher than the Candle-sticks stinkbug group that takes food artificial diet, the Candle-sticks stinkbug group egg hatching rate that then takes food prey is higher than the Candle-sticks stinkbug group that takes food artificial diet.
The result is shown in Fig. 1-4, and Fig. 1 is two groups of Candle-sticks stinkbug beta-actin confidential reference items amplification curves; Fig. 2 is two groups of Candle-sticks stinkbug beta-actin confidential reference items melt curve analysis; Fig. 3 is two groups of Candle-sticks stinkbug spermatine CSSFP066 gene amplification curves; Fig. 4 is two groups of Candle-sticks stinkbug spermatine CSSFP066 gene melt curve analysis; Can find out that amplification curve is level and smooth, good reproducibility; Solubility curve is simple spike, and illustrating does not have non-specific amplification, and the fluorescent quantitation result is accurate.
Candle-sticks stinkbug beta-actin (ACTB) reference gene ct value is as shown in table 5:
Table 5 is each group Candle-sticks stinkbug beta-actin (ACTB) reference gene ct value
The result is as shown in table 6 for Candle-sticks stinkbug spermatine CSSFP066 gene quantification:
Table 6 is each group Candle-sticks stinkbug spermatine CSSFP066 gene quantification result
Find from the above results, compare with the Candle-sticks stinkbug that takes food the insect prey that the expression amount of spermatine CSSFP066 gene of Candle-sticks stinkbug that takes food artificial diet is extremely low, can't detect its existence; And in taking food the Candle-sticks stinkbug of insect prey, can detect the existence of this spermatine gene; This proof takes food the egg hatching rate of Candle-sticks stinkbug group of insect prey than the egg hatching rate height of the Candle-sticks stinkbug group that takes food artificial diet.
(feed according to above-mentioned two groups method by traditional biological method, every day record from the pieces of an egg hatching one age nymph quantity calculate the hatching rate of ovum) detect the egg hatching rate of feed group Candle-sticks stinkbug and prey group Candle-sticks stinkbug, the Candle-sticks stinkbug that takes food the Candle-sticks stinkbug of insect prey and take food artificial diet in life average egg hatching rate is respectively 96.1% and 67.5%; Can find out that this detected result is consistent with the result who detects with the traditional biological method, proves that method of the present invention is correct.
The result shows, with detection method of the present invention can rapid detection Different Nutrition source the variation of expression amount of spermatine CSSFP066 gene of Candle-sticks stinkbug, judge the difference of the egg hatching rate of live body population with this.
Therefore the material of detection spermatine CSSFP066 of the present invention genetic expression can be used as molecule marker for detection of the egg hatching rate of the Candle-sticks stinkbug population that takes food the Different Nutrition source; And be used for the increasing primer of spermatine CSSFP066 gene or the component that RT-PCR reagent can be used as the egg hatching rate test kit that detects the Candle-sticks stinkbug population that takes food the Different Nutrition source;
Above-mentioned RT-PCR reagent is by ultrapure water, 10 * pcr amplification buffer, magnesium ion, dNTPs, upstream primer, SYBR(SYBR Green I fluorescence dye), downstream primer, Taq enzyme form; Wherein the final concentration of magnesium ion in RT-PCR reagent is 1.25mM; Each final concentration in RT-PCR reagent is 0.25mM among the dNTPs; Upstream primer and downstream primer are 0.25 μ M at the final concentration in RT-PCR reagent; The final concentration of Taq enzyme in RT-PCR reagent is 0.05u/ μ l.
Claims (6)
1. for detection of the application in detecting the insect egg hatching rate of the material of spermatine CSSFP066 encoding gene expression amount;
The aminoacid sequence of described spermatine CSSFP066 is the sequence 2 in the sequence table.
2. application according to claim 1 is characterized in that: described insect is insect individuality or insect population;
The nucleotides sequence of described spermatine CSSFP066 encoding gene is classified sequence 1 in the sequence table or the sequence 1 in the sequence table as from 5 ' terminal 1-312 position Nucleotide;
Described insect is specially the Candle-sticks stinkbug.
3. application according to claim 1 and 2 is characterized in that: described material for detection of spermatine CSSFP066 encoding gene expression amount is following 1)-3) in any one:
1) primer is to A: described primer is to being comprised of primer 1 and primer 2; The nucleotides sequence of described primer 1 is classified sequence 3 in the sequence table as; The nucleotides sequence of described primer 2 is classified sequence 4 in the sequence table as;
2) contain described primer to the RT-PCR reagent of A;
3) contain described primer to the test kit of A or described RT-PCR reagent.
4. application according to claim 3 is characterized in that:
Described RT-PCR reagent is comprised of A, fluorescence dye and Taq enzyme water, RT-PCR amplification buffer, magnesium ion, dNTPs, described primer;
Described primer is specially 0.2-1 μ M to the final concentration of each bar primer in described RT-PCR reagent among the A, and described primer further is specially 0.25uM to the final concentration of each bar primer in described RT-PCR reagent among the A;
Described test kit also comprises the confidential reference items primer to B, and described confidential reference items primer is comprised of primer 3 and primer 4 B; The nucleotides sequence of described primer 3 is classified the sequence 6 in the sequence table as; The nucleotides sequence of described primer 4 is classified the sequence 7 in the sequence table as.
5. method that detects the insect egg hatching rate, the primer described in comprising the steps: to use with claim 3 or 4 carries out the RT-PCR amplification to A or described RT-PCR reagent or described test kit to insect A to be measured and B;
If the expression amount of the spermatine CSSFP066 gene of described insect A is higher than described insect B, then the egg hatching rate of described insect A is higher than described insect B.
6. method according to claim 5, it is characterized in that: described insect is insect individuality or insect population;
The template of described RT-PCR amplification is the cDNA of insect;
Described insect is specially the Candle-sticks stinkbug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310031405.7A CN103060465B (en) | 2013-01-28 | 2013-01-28 | Method for detecting hatchability of insect eggs by using spermatin gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310031405.7A CN103060465B (en) | 2013-01-28 | 2013-01-28 | Method for detecting hatchability of insect eggs by using spermatin gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103060465A true CN103060465A (en) | 2013-04-24 |
| CN103060465B CN103060465B (en) | 2014-02-05 |
Family
ID=48103356
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310031405.7A Expired - Fee Related CN103060465B (en) | 2013-01-28 | 2013-01-28 | Method for detecting hatchability of insect eggs by using spermatin gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103060465B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102771670A (en) * | 2012-08-03 | 2012-11-14 | 中国农业科学院植物保护研究所 | Artificial diet for predative natural enemy insect-true bugs |
-
2013
- 2013-01-28 CN CN201310031405.7A patent/CN103060465B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102771670A (en) * | 2012-08-03 | 2012-11-14 | 中国农业科学院植物保护研究所 | Artificial diet for predative natural enemy insect-true bugs |
Non-Patent Citations (5)
| Title |
|---|
| 《昆虫天敌》 19850228 郑友贤等 捕食性天敌--蠋蝽 第87-90页 1-6 第6卷, 第2期 * |
| 王权等: "蠋蝽生物学特性观察", 《吉林农业》, no. 12, 31 December 2011 (2011-12-31), pages 185 * |
| 郑友贤等: "捕食性天敌——蠋蝽", 《昆虫天敌》, vol. 6, no. 2, 28 February 1985 (1985-02-28), pages 87 - 90 * |
| 高卓等: "蠋蝽(Ａｒｍａ ｃｈｉｎｅｎｓｉｓ)生物学特性研究", 《黑龙江大学工程学报》, vol. 2, no. 4, 30 November 2011 (2011-11-30), pages 72 - 83 * |
| 高长启等: "蠋蝽人工饲养技术的研究", 《吉林林业科技》, no. 2, 30 April 1993 (1993-04-30), pages 16 - 18 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103060465B (en) | 2014-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103088140B (en) | Method for detecting egg laying amount of insects by vitellogenin gene | |
| CN103060467B (en) | Method for detecting self-mutilation rate of insects by using odorant binding protein 15 gene | |
| Xu et al. | Differential gene expression in the peripheral blood of Chinese Sanhe cattle exposed to severe cold stress | |
| Unuma et al. | The sea urchin major yolk protein is synthesized mainly in the gut inner epithelium and the gonadal nutritive phagocytes before and during gametogenesis | |
| An et al. | Chronic toxicity of biodegradable microplastic (Polylactic acid) to Daphnia magna: A comparison with polyethylene terephthalate | |
| CN103088142B (en) | Method for detecting egg laying amount of insects by heat shock protein 90 gene | |
| CN103060465B (en) | Method for detecting hatchability of insect eggs by using spermatin gene | |
| Huang et al. | Function of the MOB kinase activator-like 1 in the innate immune defense of the oriental river prawn (Macrobrachium nipponense) | |
| Cordero et al. | Comparative ontogenetic development of two marine teleosts, gilthead seabream and European sea bass: New insights into nutrition and immunity | |
| CN103088141B (en) | Method for detecting egg laying amount of insects by heat shock protein 83-1 gene | |
| CN103088143B (en) | Method for detecting egg laying amount of insects by spermatine gene | |
| CN102181523A (en) | Method for identifying sex of early embryo of goat | |
| Golovanov | Influence of various factors on upper lethal temperature | |
| CN103060466B (en) | Method for detecting self-mutilation rate of insects by using phylaxin gene | |
| Parmeggiani et al. | Initial ontogeny of digestive enzymes in the early life stages of captive-bred European eels during fasting: A partial characterization | |
| Lin et al. | Housekeeping genes for cryopreservation studies on zebrafish embryos and blastomeres | |
| CN103602681A (en) | dsRNA (double-strand ribose nucleic acid) capable of inhibiting wheat aphid salivary protein MYS2 gene expression and application thereof | |
| Gallant et al. | Developmental expression profiles and thyroidal regulation of cytokines during metamorphosis in the amphibian Xenopus laevis | |
| Liu et al. | Quantitative analysis of the genes affecting development of the hypopharyngeal gland in honey bees (Apis mellifera L.) | |
| Dumrongsri et al. | Determination of male-specific gene expression of White Lamphun cattle semen treated by monoclonal antibodies | |
| Huo et al. | Sea cucumbers in a world of high temperature and low dissolved oxygen: An overview focusing on Apostichopus japonicus | |
| KR101693616B1 (en) | Primer for species identification of the nine kinds of jellyfish from 28S ribosomal DNA origin | |
| CN103667518A (en) | Method for judging lateolabrax japonicus aquatic water | |
| Habib et al. | The Association of the polymorphism and gene expression of heat shock protein hsp 70 gene in winter and summer in the semen of Holstein bulls born in Iraq | |
| Sahu et al. | Relative mRNA expression of CRBP IV gene and its association with layer economic traits in Rhode Island Red chicken |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140205 Termination date: 20160128 |
|
| EXPY | Termination of patent right or utility model |