CN103088141B - Method for detecting egg laying amount of insects by heat shock protein 83-1 gene - Google Patents
Method for detecting egg laying amount of insects by heat shock protein 83-1 gene Download PDFInfo
- Publication number
- CN103088141B CN103088141B CN201310031961.4A CN201310031961A CN103088141B CN 103088141 B CN103088141 B CN 103088141B CN 201310031961 A CN201310031961 A CN 201310031961A CN 103088141 B CN103088141 B CN 103088141B
- Authority
- CN
- China
- Prior art keywords
- sequence
- insect
- primer
- heat shock
- shock protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting the egg laying amount of insects by a heat shock protein 83-1 gene, which provides application of a substance which is used for detecting the expression quantity of heat shock protein 83-1 encoding genes of insect populations eating different substances to detection of the egg laying amount of insect populations eating different substances, wherein the amino acid sequence of heat shock protein 83-1 is a sequence 2 in the sequence table. Experiments prove that the detection method provided by the invention can be used for detecting the egg laying amount of the insects and particularly the egg laying amount of arma chinensis with different nutrition sources, and the egg laying amount of the insects can be detected within only 2 to 3 days by the detection method while the detection requires 30 to 60 days by a traditional biological method. The detection method provided by the invention has the advantages that materials have wide sources and are easily available, and the operation is simple as well as time-saving and labor-saving, thus being suitable for popularization and application in insect commodity inspection and detection.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of method by heat shock protein 83-1 gene test insect spawning amount.
Background technology
Biological control of insect pests is being brought into play irreplaceable vital role in agroforestry Sustainable development.A large amount of productions of natural enemy insect are the most basic in biological control is especially also most important link.Predatory natural enemy insect Candle-sticks stinkbug (Armachinensis) can be controlled from multiple agriculture and forestry injurious insects such as lepidopteran, Coleoptera, Hemiptera, Homoptera, Hymenopteras, especially it can also control alien insect pest colorado potato bug and fall webworms, so Candle-sticks stinkbug is the good natural enemy insect commodity of a kind of application prospect.
As commodity, reducing in a large number production cost is the maximized approach of people's profit-push.In natural enemy insect Candle-sticks stinkbug produces, just can apply different food and produce Candle-sticks stinkbug, for example, different insect prey, containing the artificial diet of insect composition with not containing the artificial diet of insect composition, and then minimizing production cost.But the biological characteristics of applying different foodstuffs production Candle-sticks stinkbug is out uneven, some can reach the effect of good Control pests after discharging, have after release effect not remarkable.The Candle-sticks stinkbug of feeding due to different food is difficult to distinguish in phenotype, so these natural enemy insects are to be difficult to their biological characteristics of assessment before release.
The egg laying amount of Candle-sticks stinkbug adult is a very important index evaluating natural enemy insect biological characteristics.Have the Candle-sticks stinkbug population breeding of higher egg laying amount fast, the doubling time is short, can control rapidly in a short time insect.This can greatly reduce the cost of pest control, increases rate of profit.On the contrary, the Candle-sticks stinkbug that egg laying amount is lower is slow owing to breeding, and the doubling time extends, and the time of therefore controlling insect can relatively lag behind, and this has just increased cost accounting greatly, has reduced profit.At present, for the detection method of the commodity Candle-sticks stinkbug egg laying amount of different food sources or different businessmans be still whole adult stage or artificial its egg laying amount of specific time build-in test number, this method wastes time and energy expensive.Therefore need a kind of method of rapid detection natural enemy insect commodity biological characteristics-egg laying amount.
In insect body, the maturation of the ovocyte that heat shock protein 83-1 (heat shock protein83-1) participation is mediated by progesterone.
Summary of the invention
An object of the present invention is to provide the purposes for detection of the material of heat shock protein 83-1 encoding gene expression amount.
The invention provides the application in detecting insect spawning amount for detection of the material of heat shock protein 83-1 encoding gene expression amount;
The aminoacid sequence of described heat shock protein 83-1 is the sequence 2 in sequence table.
In above-mentioned application, described insect is insect individuality or insect population;
Described insect population is specially and takes food different substances insect population; The described different substances insect population that takes food is further specially the insect population that takes food artificial diet or the insect population that takes food prey;
The nucleotides sequence of described heat shock protein 83-1 encoding gene is classified sequence 1 in sequence table or the sequence 1 in sequence table as from 5 ' end 2-250 position Nucleotide.
Described insect is specially Candle-sticks stinkbug.
Above-mentioned artificial diet are prepared as follows: live pig liver 60g, soyflour 10g, water 100ml, egg 20ml, casein food grade 2g, sucrose 8g, VC0.2g, choline chloride 60 0.4g, calcium pantothenate 8mg, folic acid 0.1mg, niacinamide 0.2mg, gentamicin 3.9mg; Concrete feeding method is shown in embodiment 2;
Above-mentioned prey is tussah (Antheraea pernyi) pupa; Concrete feeding method is shown in embodiment 2.
In above-mentioned application, the described material for detection of heat shock protein 83-1 encoding gene expression amount is following 1)-3) in any one:
1) primer pair A: described primer pair is comprised of primer 1 and primer 2; The nucleotides sequence of described primer 1 is classified sequence 3 in sequence table as; The nucleotides sequence of described primer 2 is classified sequence 4 in sequence table as;
2) the RT-PCR reagent that contains described primer pair A;
3) test kit that contains described primer pair A or described RT-PCR reagent.
Another object of the present invention is to provide a kind of primer pair A.
Primer pair A provided by the invention, is comprised of primer 1 and primer 2;
The nucleotides sequence of described primer 1 is classified sequence 3 in sequence table as; The nucleotides sequence of described primer 2 is classified sequence 4 in sequence table as.
The RT-PCR reagent that contains above-mentioned primer pair A is also the scope of protection of the invention; Above-mentioned RT-PCR reagent is specifically comprised of water, RT-PCR amplification buffer, magnesium ion, dNTPs, above-mentioned primer pair A, fluorescence dye (SYBR GreenI) and Taq enzyme;
The final concentration of each primer in described primer pair A in described RT-PCR reagent is specially 0.2-1 μ M, and the final concentration of each primer in described primer pair A in described RT-PCR reagent is further specially 0.25 μ M.
The test kit that contains above-mentioned primer pair A or above-mentioned RT-PCR reagent is also the scope of protection of the invention.
Mentioned reagent box also comprises internal reference primer pair B, and described internal reference primer pair B is comprised of primer 3 and primer 4; The nucleotides sequence of described primer 3 is classified the sequence 6 in sequence table as; The nucleotides sequence of described primer 4 is classified the sequence 7 in sequence table as.
The 3rd object of the present invention is to provide a kind of method that detects insect spawning amount.
Method provided by the invention, comprises the steps:, with above-mentioned primer pair A or above-mentioned RT-PCR reagent or above-mentioned test kit, insect A to be measured and B are carried out to RT-PCR amplification;
If the expression amount of the heat shock protein 83-1 gene of described insect A is higher than described insect B, the egg laying amount of described insect A is higher than described insect B.
In aforesaid method, described insect is insect individuality or insect population;
The cDNA that the template of described RT-PCR amplification is insect;
Described insect is Candle-sticks stinkbug.
In an embodiment of the present invention, described insect A is the insect population that takes food prey; Described insect B is the insect population that takes food artificial diet.
The 4th object of the present invention is to provide a kind of albumen or its encoding gene.
The aminoacid sequence of albumen provided by the invention is the sequence 2 in sequence table;
The nucleotides sequence of the encoding gene of albumen provided by the invention is classified sequence 1 in sequence table or the sequence 1 in sequence table as from 5 ' end 2-250 position Nucleotide.
Of the present inventionly experiment showed, that detection method provided by the present invention can detect by detecting heat shock protein 83-1 gene expression amount the egg laying amount of Candle-sticks stinkbug of the insect spawning amount, particularly Different Nutrition source of different population.Experiment showed, with the egg laying amount of detection method detection insect of the present invention and only need 2-3 days.And need about 30-60 days with traditional biological method.The material source that detection method of the present invention relates to is wide, easily buys, simple to operate, saves time, laborsaving, is suitable for applying in insect commodity inspection detects.
Accompanying drawing explanation
Fig. 1 is Candle-sticks stinkbug beta-actin internal reference amplification curve
Fig. 2 is Candle-sticks stinkbug beta-actin internal reference melt curve analysis
Fig. 3 is Candle-sticks stinkbug heat shock protein 83-1 gene amplification curve
Fig. 4 is Candle-sticks stinkbug heat shock protein 83-1 gene melt curve analysis
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Heat shock protein 83-1 and the discovery of encoding gene and the design of primer special of embodiment 1, detection insect spawning amount
Research finds, heat shock protein 83-1 gene is a kind of good molecule marker that detects insect spawning amount, so heat shock protein 83-1 (the heat shock protein83-1) expression of encoding gene of the present invention by Candle-sticks stinkbug is used for detecting the egg laying amount of Candle-sticks stinkbug.
The nucleotides sequence of the heat shock protein 83-1 encoding gene of Candle-sticks stinkbug is classified sequence 1 in sequence table or the sequence 1 in sequence table as from 5 ' end 2-250 position Nucleotide, and the aminoacid sequence of this albumen is the sequence 2 in sequence table.
The primer that is designed for this encoding gene of amplification according to the heat shock protein 83-1 encoding gene of Candle-sticks stinkbug is as follows:
Upstream primer: CGGAGTTCATCGGCTACGA(sequence 3);
Downstream primer: GTCGCGCGTCCACAC(sequence 4).
The application in detecting Candle-sticks stinkbug egg laying amount of embodiment 2, heat shock protein 83-1 or encoding gene or primer special
Candle-sticks stinkbug (the Arma chinensis adopting in following experiment; be documented in Taxonomic and bionomic notes onArma chinensis (Fallou) (Hemiptera:Pentatomidae:Asopinae; Zootaxa; 3382:41-52; 2012; public Ke Cong Plant Protection institute, Chinese Academy of Agricultral Sciences obtains) according to the difference that takes food material, be divided into two groups, 50 every group:
Take food artificial diet group Candle-sticks stinkbug: the Candle-sticks stinkbug of the artificial diet of feeding every adult (27 ± 1 ° of C, 16:8 (L:D), 75 ± 5%RH) every day 160 μ l artificial diet of feeding, until the natural death of Candle-sticks stinkbug;
Take food prey group Candle-sticks stinkbug: every pair of adult of the Candle-sticks stinkbug of the prey of feeding (27 ± 1 ° of C, 16:8 (L:D), 75 ± 5%RH) prey of feeding, was taken food situation every 7-15 days according to prey and change a prey, until the natural death of Candle-sticks stinkbug;
Artificial diet make a living pork liver 60g, soyflour 10g, water 100ml, egg 20ml, casein food grade 2g, sucrose 8g, VC0.2g, choline chloride 60 0.4g, calcium pantothenate 8mg, folic acid 0.1mg, niacinamide 0.2mg, gentamicin 3.9mg;
Prey is tussah (Antheraea pernyi) pupa (commercially available).
One, the acquisition of Candle-sticks stinkbug cDNA
1, Candle-sticks stinkbug RNA extracting
Step is as follows:
Each group Candle-sticks stinkbug sample is moved into and added in the mortar of appropriate liquid nitrogen, fast, firmly grind to form homogenate, move in 1.5ml centrifuge tube.
Add 1000 μ lTri zol in 1.5ml centrifuge tube, standing 5 minutes.
Add 200 μ l chloroforms, vortex vibration 10 seconds, standing 5 minutes, put into whizzer, 12,000g4 ℃ is centrifugal 15 minutes.
Supernatant liquor is transferred in new 1.5ml centrifuge tube, adds isopyknic Virahol, vibration mixes, and places 1 hour standing 10 minutes of room temperature for-20 ℃.
Put into whizzer, 12,000g, 4 ℃ are centrifugal 10 minutes.
Abandon supernatant liquor, Virahol is eliminated, add the dehydrated alcohol of 1ml75%, 12,000g, 4 ℃ are centrifugal 5 minutes.
Abandon supernatant liquor, add DEPC to process water after precipitation is dry ,-80 ℃ of preservations, obtain RNA.
2, reverse transcription
Adopt Superscript Ш Reverse Transcriptasekit test kit (Invitrogen18080044) to carry out reverse transcription:
A) get the pipe of the eppendorf without RNA enzyme of a sterilizing, each sample adds component as shown in table 1 below to obtain mix1;
Table 1 adds component 1 for reverse transcription
| Component | Volume | Source |
| Up?to5μg?total?RNA | 5μl | ? |
| Primer(50μM?ol?igio(dt) | 0.5μl | Invi?trogen |
| Random?primer | 0.5μl | Invi?trogen |
| 10mM?dNTP?Mix | 1μl | Invi?trogen |
| DEPC-treated?water | 5μl | ? |
| Total | 12μl | ? |
B) mix165 ℃ of temperature bathed 5 minutes, then put immediately ice 1 minute;
C) in mix1, add composition as shown in table 2 below, obtain mix2 totally 20 μ l systems;
Table 2 adds component 2 for reverse transcription
D) process 5 minutes for 25 ℃;
E) process 60 minutes for 50 ℃;
F) process 15 minutes for 70 ℃, be placed into immediately on ice;
G) obtain cDNA, and this cDNA can preserve half a year at-20 ℃.
Two, RT-PCR amplification
In RT-PCR amplification system, the volume of each component is as shown in table 3 below, adopts SYBR (R) GreenINucleicAkit (Invitrogen S7567):
Table 3 is the volume of each component in pcr amplification system
PCR reaction conditions is as shown in table 4:
Table 4 is PCR reaction conditions
| Circulation | Loop cycle |
| 95 ℃, 2 minutes | ? |
| 40 circulations | The first step sex change: 95 ℃, 10 seconds |
| ? | Second step annealing: 60 ℃, 30 seconds |
| Solubility curve | 60 ℃-95 ℃, within every 5 seconds, increase by 0.5 ℃ |
Using Candle-sticks stinkbug beta-actin (ACTB) as reference gene (sequence 5), and the primer of this reference gene that increases is as follows:
Internal reference upstream primer: TGTCCAAGCAGGAGTACGAC(sequence 6);
Internal reference downstream primer: GGTTCCTCTTTGGAGTCCGATT(sequence 7).
If take food heat shock protein 83-1 gene average expression amount in the Candle-sticks stinkbug group of prey higher than the Candle-sticks stinkbug group that takes food artificial diet, take food the Candle-sticks stinkbug group egg laying amount of prey higher than the Candle-sticks stinkbug group that takes food artificial diet.
As Figure 1-4, Fig. 1 is two groups of Candle-sticks stinkbug beta-actin internal reference amplification curves to result; Fig. 2 is two groups of Candle-sticks stinkbug beta-actin internal reference melt curve analysis; Two groups of Fig. 3 are Candle-sticks stinkbug heat shock protein 83-1 gene amplification curve; Two groups of Fig. 4 are Candle-sticks stinkbug heat shock protein 83-1 gene melt curve analysis; Can find out, amplification curve is level and smooth, reproducible; Solubility curve is simple spike, illustrates and there is no non-specific amplification, and fluorescent quantitation result is accurate.
Candle-sticks stinkbug beta-actin (ACTB) reference gene ct value is as shown in table 5:
Table 5 is each group Candle-sticks stinkbug beta-actin (ACTB) reference gene ct value
Candle-sticks stinkbug heat shock protein 83-1 gene quantification result is as shown in table 6:
Table 6 is each group Candle-sticks stinkbug heat shock protein 83-1 gene quantification result
From the above results, find, compare with the Candle-sticks stinkbug that takes food insect prey, the expression amount of heat shock protein 83-1 gene that takes food the Candle-sticks stinkbug of artificial diet is obviously lowered; And this heat shock protein 83-1 gene can be detected in taking food the Candle-sticks stinkbug of insect prey, obviously raise; This proof, takes food the egg laying amount that the egg laying amount of the Candle-sticks stinkbug group of insect prey organizes than the Candle-sticks stinkbug that takes food artificial diet high.
By traditional biological method, (method according to above-mentioned two groups is fed, and collect every day and respectively organize the pieces of an egg that Candle-sticks stinkbug produces, counting, until the natural death of Candle-sticks stinkbug) detect the egg laying amount of feed group Candle-sticks stinkbug and prey group Candle-sticks stinkbug, the Candle-sticks stinkbug that takes food the Candle-sticks stinkbug of insect prey and take food artificial diet in life average egg laying amount is respectively 458 and 213; Can find out, this detected result is consistent with the result detecting by traditional biological method, proves that method of the present invention is correct.
Result shows, the variation of the expression amount of the heat shock protein 83-1 gene of Candle-sticks stinkbug that can rapid detection Different Nutrition source by detection method of the present invention, judges the difference of the egg laying amount of live body population with this.
Therefore the material of detection heat shock protein 83-1 of the present invention genetic expression can be used as molecule marker for detection of the egg laying amount that takes food the Candle-sticks stinkbug population in Different Nutrition source; And for the primer of the heat shock protein 83-1 gene that increases or RT-PCR reagent, can be used as the component of the egg laying amount test kit that detects the Candle-sticks stinkbug population that takes food Different Nutrition source;
Above-mentioned RT-PCR reagent is by ultrapure water, 10 * pcr amplification buffer, magnesium ion, dNTPs, upstream primer, SYBR(SYBR Green I fluorescence dye), downstream primer, Taq enzyme form; Wherein the final concentration of magnesium ion in RT-PCR reagent is 1.25mM; In dNTPs, each final concentration in RT-PCR reagent is 0.25mM; Upstream primer and downstream primer are 0.25 μ M at the final concentration in RT-PCR reagent; The final concentration of Taq enzyme in RT-PCR reagent is 0.05u/ μ l.
Claims (10)
1. the application in detecting insect spawning amount for detection of the material of heat shock protein 83-1 encoding gene expression amount;
The aminoacid sequence of described heat shock protein 83-1 is the sequence 2 in sequence table;
Described insect is specially Candle-sticks stinkbug;
The described material for detection of heat shock protein 83-1 encoding gene expression amount is following 1)-3) in any one:
1) primer pair A: described primer pair is comprised of primer 1 and primer 2; The nucleotides sequence of described primer 1 is classified sequence 3 in sequence table as; The nucleotides sequence of described primer 2 is classified sequence 4 in sequence table as;
2) the RT-PCR reagent that contains described primer pair A;
3) test kit that contains described primer pair A or described RT-PCR reagent.
2. application according to claim 1, is characterized in that: described insect is insect individuality or insect population; The nucleotides sequence of described heat shock protein 83-1 encoding gene is classified sequence 1 in sequence table or the sequence 1 in sequence table as from 5 ' end 2-250 position Nucleotide.
3. a primer pair A, is comprised of primer 1 and primer 2;
The nucleotides sequence of described primer 1 is classified sequence 3 in sequence table as; The nucleotides sequence of described primer 2 is classified sequence 4 in sequence table as.
4. the RT-PCR reagent that contains primer pair A claimed in claim 3; Described RT-PCR reagent is specifically comprised of water, RT-PCR amplification buffer, magnesium ion, dNTPs, primer pair A claimed in claim 3, fluorescence dye and Taq enzyme;
The final concentration of each primer in described primer pair A in described RT-PCR reagent is specially 0.2-1 μ M.
5. RT-PCR reagent according to claim 4, is characterized in that: the final concentration of each primer in described primer pair A in described RT-PCR reagent is 0.25 μ M.
6. the test kit that contains the RT-PCR reagent described in primer pair A claimed in claim 3 or claim 4 or 5.
7. test kit according to claim 6, is characterized in that: described test kit also comprises internal reference primer pair B, and described internal reference primer pair B is comprised of primer 3 and primer 4; The nucleotides sequence of described primer 3 is classified the sequence 6 in sequence table as; The nucleotides sequence of described primer 4 is classified the sequence 7 in sequence table as.
8. detect a method for insect spawning amount, comprise the steps:, with the RT-PCR reagent described in primer pair A claimed in claim 3 or claim 4 or 5 or the test kit described in claim 6 or 7, insect A to be measured and B are carried out to RT-PCR amplification;
If the expression amount of the heat shock protein 83-1 gene of described insect A is higher than described insect B, the egg laying amount of described insect A is higher than described insect B;
Described insect is specially Candle-sticks stinkbug.
9. method according to claim 8, is characterized in that: described insect is insect individuality or insect population; The cDNA that the template of described RT-PCR amplification is insect.
10. an albumen or its encoding gene:
The aminoacid sequence of described albumen is the sequence 2 in sequence table;
The nucleotides sequence of the encoding gene of described albumen is classified sequence 1 in sequence table or the sequence 1 in sequence table as from 5 ' end 2-250 position Nucleotide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310031961.4A CN103088141B (en) | 2013-01-28 | 2013-01-28 | Method for detecting egg laying amount of insects by heat shock protein 83-1 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310031961.4A CN103088141B (en) | 2013-01-28 | 2013-01-28 | Method for detecting egg laying amount of insects by heat shock protein 83-1 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103088141A CN103088141A (en) | 2013-05-08 |
| CN103088141B true CN103088141B (en) | 2014-02-05 |
Family
ID=48201268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310031961.4A Expired - Fee Related CN103088141B (en) | 2013-01-28 | 2013-01-28 | Method for detecting egg laying amount of insects by heat shock protein 83-1 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103088141B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102771670A (en) * | 2012-08-03 | 2012-11-14 | 中国农业科学院植物保护研究所 | Artificial diet for predative natural enemy insect-true bugs |
-
2013
- 2013-01-28 CN CN201310031961.4A patent/CN103088141B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102771670A (en) * | 2012-08-03 | 2012-11-14 | 中国农业科学院植物保护研究所 | Artificial diet for predative natural enemy insect-true bugs |
Non-Patent Citations (3)
| Title |
|---|
| 捕食性天敌——蠋蝽;郑友贤等;《昆虫天敌》;19850228;第6卷(第2期);第87-90页 * |
| 郑友贤等.捕食性天敌——蠋蝽.《昆虫天敌》.1985,第6卷(第2期),第87-90页. |
| 高卓等.蠋蝽(Ａｒｍａ ｃｈｉｎｅｎｓｉｓ)生物学特性研究.《黑龙江大学工程学报》.2011,第2卷(第4期),第72-77页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103088141A (en) | 2013-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Girard et al. | Global gene expression in granulosa cells of growing, plateau and atretic dominant follicles in cattle | |
| CN103088140B (en) | Method for detecting egg laying amount of insects by vitellogenin gene | |
| CN103060467B (en) | Method for detecting self-mutilation rate of insects by using odorant binding protein 15 gene | |
| CN103571844B (en) | DsRNA and the application be combined in control aphid damage thereof | |
| Schanzenbach et al. | Can milk cell or skim milk miRNAs be used as biomarkers for early pregnancy detection in cattle? | |
| Peterson et al. | Potential for sexual conflict assessed via testosterone-mediated transcriptional changes in liver and muscle of a songbird | |
| CN108754000A (en) | Drug resistant gene mcr-4/5/8 fluorescent quantitative PCR detection methods | |
| CN103937822B (en) | The sequence of locust I type chitinase gene and the application of dsRNA thereof | |
| CN103740815B (en) | Primer for multi-PCR (Polymerase Chain Reaction) detection aiming at fusaria and application of primer | |
| Fu et al. | Functional screen for microRNAs of Nilaparvata lugens reveals that targeting of glutamine synthase by miR-4868b regulates fecundity | |
| Bichele et al. | TNF superfamily members play distinct roles in shaping the thymic stromal microenvironment | |
| Adelman et al. | Sindbis virus induces the production of a novel class of endogenous siRNAs in Aedes aegypti mosquitoes | |
| Zhang et al. | Interleukin 18 accelerates the hepatic cell proliferation in rat liver regeneration after partial hepatectomy | |
| Billa et al. | Nutrigenomic analyses reveal miRNAs and mRNAs affected by feed restriction in the mammary gland of midlactation dairy cows | |
| CN103088142B (en) | Method for detecting egg laying amount of insects by heat shock protein 90 gene | |
| CN104293899B (en) | A kind of method of horseflesh ingredient in detection food | |
| Woźny et al. | Differential gene expression in rainbow trout (Oncorhynchus mykiss) liver and ovary after exposure to zearalenone | |
| CN103088141B (en) | Method for detecting egg laying amount of insects by heat shock protein 83-1 gene | |
| CN103088143B (en) | Method for detecting egg laying amount of insects by spermatine gene | |
| CN103060465B (en) | Method for detecting hatchability of insect eggs by using spermatin gene | |
| CN103060466B (en) | Method for detecting self-mutilation rate of insects by using phylaxin gene | |
| Bove et al. | cDNA‐amplified fragment length polymorphism to study the transcriptional responses of Lactobacillus rhamnosus growing in cheese‐like medium | |
| CN103602681A (en) | dsRNA (double-strand ribose nucleic acid) capable of inhibiting wheat aphid salivary protein MYS2 gene expression and application thereof | |
| Snyman et al. | The expression, secretion and activity of the aspartic protease MpAPr1 in Metschnikowia pulcherrima IWBT Y1123 | |
| Habib et al. | The association of the polymorphism and gene expression of heat shock protein HSP70 gene in winter and summer in the semen of Holstein bulls born in Iraq |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140205 Termination date: 20160128 |
|
| EXPY | Termination of patent right or utility model |