CN103060343A - Duck plague virus g E protein genes and application thereof - Google Patents
Duck plague virus g E protein genes and application thereof Download PDFInfo
- Publication number
- CN103060343A CN103060343A CN201210549913XA CN201210549913A CN103060343A CN 103060343 A CN103060343 A CN 103060343A CN 201210549913X A CN201210549913X A CN 201210549913XA CN 201210549913 A CN201210549913 A CN 201210549913A CN 103060343 A CN103060343 A CN 103060343A
- Authority
- CN
- China
- Prior art keywords
- duck plague
- plague virus
- duck
- protein
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to a duck plague virus g E protein genes and application thereof. The high expression of nucleotide sequence of g E protein genes is SEQ ID NO:1 after codon usage optimization. The duck plague virus g E protein gene engineering subunit vaccine is inoculated into ten-day-age ducks through muscles and the ducks are negative to duck plague virus. Antibody of duck plague virus is detected by drawing blood after fourteen days of inoculating and antibodies of duck plague virus of an immunization group are all positive, so the efficiency rate is 100%. However, no antibody in a control group is detected. The result shows that immunogenicity of the prepared recombination protein is good and the further preparation of duck plague virus gene engineering subunit vaccine can cause immune response of ducks.
Description
Technical field
The invention belongs to poultry recombinant vaccine technical field, be specifically related to a kind of duck plague virus gE protein gene and application thereof.
Background technology
China aquatic bird aquaculture development is swift and violent in recent years, and the world-class position of the long-term maintenance of breeding stock and the amount of delivering for sale just reaches 20.84 hundred million to 2010 amounts of delivering for sale of being only the meat duck.But along with development intensive, large-scale cultivation, various diseases often causes duck group Large Scale Death, only causes direct and indirect culturing economic to lose 5,000,000,000 yuan because of duck group various diseases accumulative total in 2010.In multiple normal the disease of duck, duck plague is popular extensively, propagates rapidly, and sickness rate is high, and case fatality rate is large, and case fatality rate already develops very harmful usually more than 90% to aquatic bird.Duck plague its conventional prevention of common disease frequently-occurring disease and the medicine for treatment of growing as the duck group support has 1,500,000,000 yuan of selling markets at home every year at least according to a preliminary estimate.At present, DPV attenuated vaccine commonly used comes the preventing duck plague disease clinically, and obtains certain clinical effectiveness.But the side effect that the application of attenuated vaccine brings is also relatively outstanding, exists virulence to return strong risk, clinically be difficult to distinguish wild poison and vaccine virus, can't eradicate duck plague disease etc. such as attenuated vaccine.Therefore, the research that duck plague genetically engineered marker vaccine is carried out in urgent clinical needs improves the shortcoming of above-mentioned vaccine, for the duck plague disease of thoroughly eradicating the aquatic bird industry lays the first stone.
Cause of disease duck plague virus (Duck Plague Virus) belongs to the filtrable virus in the herpetoviridae Herpesvirus.The feature of the typical herpes virus DNA of DNA tool of duck plague virus, size is about 150kb, and two ends are terminal repeat, and there is internal repeat the centre.Envelope protein is the main protection antigen of simplexvirus, and it is mediating the cell entry cell, and all plays an important role in the maturation of virus and the release.To be simplexvirus invade the necessary virulence gene of central nervous tissue from retina, olfactory sensory epithelium cell, gasserian ganglion to simplexvirus gE gene, to simplexvirus in vivo Virulence Expression, invasion and attack are neural and play conclusive effect along neurotransmission.Simplexvirus gE albumen is for virus infection and to copy all be nonessential.In the simplexvirus, membrane glycoprotein not only mediates virus to the infection of target cell but also is the major antigen of infected host immune system identification.Along with development and the utilization of DNA recombinant technology, the research of recombinant vaccine has obtained fast development, and wherein subunit vaccine becomes the study hotspot of current new generation vaccine.By the duck plague gE protein subunit vaccine of preparation, the lower and protein mass of cost is stable, and immunne response that can excitating organism, has important practical significance undoubtedly and the market development is worth.But the recombinant expressed efficient of duck plague gE albumen is very low at present, is difficult to satisfy the demand of actual production.
Summary of the invention
The purpose of this invention is to provide a kind of duck plague virus gE gene and application thereof, i.e. a kind of Nucleotide that can efficiently express duck plague virus gE albumen, and as the application of vaccine.
One aspect of the invention provides a kind of Nucleotide for coding duck plague virus gE albumen, and its sequence is SEQ ID NO:1.
The invention still further relates to above-mentioned sequence is the complementary sequence of the Nucleotide of SEQ ID NO:1.
The invention provides a kind of expression vector, described expression vector is entrained above-mentioned Nucleotide.
Above-mentioned duck plague virus gE albumen, its aminoacid sequence are SEQ ID NO:2.
The application of duck plague virus gE albumen of the present invention in preparation duck plague virus genetic engineering subunit vaccine.
The duck plague virus genetic engineering subunit vaccine that the present invention obtains inoculate and is got blood survey Antibody To Duck Plague Virus after 14 days through the negative duck of intramuscular inoculation 10 age in days duck plague viruses, and the immune group Antibody To Duck Plague Virus is all positive, efficiently reaches 100%, and control group does not detect antibody.The result shows that the recombinant protein immunogenicity of preparation is good, and its duck plague virus genetic engineering subunit vaccine that further prepares can cause the immunne response of duck.
Description of drawings
Fig. 1: expression amount Western trace figure relatively before and after the gE gene optimization.
Embodiment
Optimization of the present invention has obtained the high duck plague virus gE gene of expression amount, and genetic expression obtains recombinant protein and has good antigenicity, can defend duck plague virus, thereby facilitate the present invention.
The present invention depends on routine techniques and the method in genetic engineering and biology field use.Following resource has comprised the description that the useful general method of the present invention is learned: Sambrook et al., MOLECULAR CLONING:A LABORATORY MANUAL (2nd Ed., 1989); Kreigler, GENE TRANSFER AND EXPRESSION; A LABORATORY MANUAL (1990) and Ausubel etal., Eds. CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (1994).These general reference provide definition well known by persons skilled in the art and method.
One, duck plague virus gE gene is codon optimized
Because the gE gene order high conservative of the Pestivirus suis of present known array, therefore select the gE gene order of duck plague Anatid herpesvirus1 strain to carry out codon optimized, be applied in the optimal codon in the prokaryotic cell prokaryocyte, reduce the not even generation of expression of the low expression of foreign protein that rare codon causes.GE gene nucleotide series after the optimization is SEQ ID NO:1, and the aminoacid sequence of its translation is SEQ ID NO:2.Sending genome company to carry out full gene the gE gene order after optimizing synthesizes.
Two, the acquisition of the structure of engineered protein expression vector and engineering bacteria
1. make up the pET-E expression vector
(1) design primer
Utilize Primer 5.0 software design gene amplification primers according to the gE gene order SEQ ID NO:1 after optimizing, the primer upstream and downstream is introduced respectively restriction endonuclease EcoRI and XhoI action site (underscore), and the design primer is as follows:
gE-F: 5′G
GAATTCATGATGGTTACCTTCATC′ 3 （EcoRI）
gE-R: 5′A
CTCGAGTTAGATACGGAAAGAAGATT′3 （XhoI）
Fusion tag has used 6 His amino acid labels of the N end on the pET carrier.The gE gene order (SEQ ID NO:1) synthetic according to genome company is the template amplification goal gene.
The PCR reaction system is as follows: 5 * PrimeSTARE
TMBuffer 10 μ L; DNTP Mixture (2.5 mM) 4 μ L; PrimeSTARE
TMHS DNA Polymerase 0.5 μ L; Template 0.5 μ L; Primer 1 μ L/1 μ L; DdH
2O 33 μ L.
React at the PCR instrument by following parameter: 98 ℃ of denaturation 30 s, then carry out 25 circulations with 98 ℃ of 10 s, 55 ℃ of 15 s, 72 ℃ of 1 min.React and get 5 μ L reaction product after complete, 1.0 % agarose gel electrophoresis detect the PCR effect.
(2) the PCR product reclaims
But record the 1.0 % sepharoses of loading 50 μ L, pcr amplification product is added respectively in the electrophoresis loading hole, stop electrophoresis when indicator migrates to the appropriate location, under 365 nm UV-light, downcut the gel that contains the purpose fragment, move in the 1.5 mL EP pipes, after taking by weighing weight, reclaim test kit (DP209) specification sheets with reference to the sugared gel DNA of day plain agar of root biotech company and carry out.
2, the gE gene fragment is connected on the pET carrier and transforms DH5 α competent cell
(1) gE gene and pET vector plasmid utilize respectively EcoR I and Xho I enzyme to carry out double digestion.It is as follows that enzyme is cut system:
EcoRI 2 μ L, Xho I 2 μ L, 10 * H Buffer, 5 μ L, dna profiling 10 μ L add water to 50 μ L.
(2) enzyme is cut the recovery of rear purpose fragment: the double digestion product reclaims glue by 1.0% agarose, 5 μ L, 10 * Loading buffer will respectively be added in the above-mentioned endonuclease reaction system, stop electrophoresis when to be instructed dose of 80 V electrophoresis migrate to apart from gel forward position 1.5 cm, cutting meets the sepharose of the purpose fragment of theoretical value respectively, uses the plain agar sugar gel DNA recovery test kit (DP209) of day root biotech company to reclaim required fragment.
(3) ligation: be the principle of 1:2～10 according to carrier segments and Insert Fragment mole ratio, the design linked system is as follows: the pET enzyme is cut rear fragment 1 μ L; Enzyme is cut rear E gene 5 μ L; T4 DNA ligase 1 μ L; 10 * ligation buffer, 1 μ L; Dd H
2O 2 μ L, 16 ℃ of connections are spent the night.
(4) connect product Transformed E .coli DH5 α competent cell: get each 100 μ L of E.coli DH5 α competence bacteria liquid, add ligation product 10 μ L, flick with light finger and severally put ice-water bath 30 min after lower.42 ℃ of water-bath thermal stimulus 90 s place rapidly ice-water bath 1 ~ 2 min, and every pipe adds 300 μ L LB nutrient solutions (non-resistant), and 37 ℃ of shaking tables are cultivated 45 min.The above-mentioned bacterium liquid of mixing is got an amount of bacterium liquid (200 μ L) and is evenly coated and contain Kan
+The LB of resistance is dull and stereotyped, is inverted plate, 37 ℃ of incubator overnight incubation after bacterium liquid is absorbed by substratum fully.
(5) screening of positive transformant and evaluation
Kan
+The LB flat board has colony growth, and picking is separated good bacterium colony and is inoculated in respectively LB liquid nutrient medium (Kan
+Resistance) in, 37 ℃ of shaking table overnight incubation.Draw 1 μ L bacterium liquid, identify positive colony as bacterium liquid pcr template.
The order-checking of positive colony is finished by the large genome company of China, and the Blast that the gE gene order after the sequence after the order-checking and the optimization is carried out nucleotide sequence analyzes, and makes up and finishes plasmid called after pET-gE.Sequencing result shows that the plasmid of preparation has inserted correct purpose fragment.
3, pET-gE Plasmid Transformation E.coli BL21 (DE3) competent cell
(1) plasmid extraction test kit (Takara company) is adopted in the extraction of pET-gE plasmid, operates with reference to specification sheets.
(2) (step is with transforming DH5 α competent cell) in pET-gE Plasmid Transformation BL21 (DE3) competent cell.
(3) choose 5 single bacterium colonies at Kan
+Cultivate in the LB liquid nutrient medium, identify positive colony by full bacterium PCR.Choose a strain positive colony called after BL21-pET-gE bacterial strain.
Three, engineering bacteria BL21-pET-gE expresses target protein gE-His
1, IPTG induces the BL21-pET-gE bacterial strain to express
Recombinant bacterial strain BL21-pET-gE carries out the SDS-PAGE electrophoresis after IPTG induces, Coomassie brilliant blue dyeing is observed target protein and expressed, and is accredited as the gE albumen that merges the His label by the Western trace.
Collect the recombinant bacterium of abduction delivering according to 1:9(w/v) the ratio mixing in the PBS damping fluid, the thickness no longer in the broken bacterium of ultrasonic cell disruption instrument ice-bath ultrasonic to bacterium liquid, lysate is carried out the centrifugal 20min of differential centrifugation: 700g, abandon precipitation, the centrifugal 20min of the centrifugal 12000g of supernatant, collect respectively ultrasonic cleer and peaceful precipitation, use with the resuspended precipitation of the damping fluid of volume, the preparation sample carries out SDS-PAGE and Western engram analysis.The result shows that the expression-form of target protein mainly is inclusion body.
2, the purifying of target protein
(1) washing of inclusion body
Precipitate resuspended with the inclusion body washings respectively, 4 ℃ of agitator treating 40min.The centrifugal 20min of 12000rpm abandons supernatant, and repeated washing once.Above-mentioned precipitation is resuspended with inclusion body washings II, and 4 ℃ are stirred 20min.The centrifugal 20min of 12000rpm abandons supernatant, and repeated washing once.
(2) dissolving of inclusion body
Above-mentioned precipitation and solubilization of inclusion bodies liquid are with 1:9(w/v) ratio resuspended, 4 ℃ of stirring and dissolving are spent the night.The centrifugal 20min of 12000g, supernatant are recombinant protein inclusion body solution.
(3) purifying of target protein
Adopt the nickel ion affinity chromatograph post, column volume (CV) is 1 mL.The deionization current rush to sample A, B pipe and affinity column, and are steady to baseline; Rush to sample A, B pipeline with buffer A 1, buffer B 1 stream respectively, then steady to baseline with buffer A 1 balance affinity column.With ultrasonic supernatant loading, affinity chromatography buffer A 1 flushing affinity column is collected and is passed the peak; Peak to be passed disappears and returns back to baseline, dissociates with affinity chromatography buffer B 1 gradient elution, collects elution peak, is protein sample behind the purifying.
(4) albumen dilution refolding
With the albumen behind the 1mL purifying (containing 30% glycerine), slowly splash into (10mM TrisCl, 0.5M NaCl, pH8.0 in the 100mL renaturation solution; 30 % glycerine; 1 mM GSH; 0.1 mM GSSG; 0.5 M Arg), hatch 48 h for 4 ℃, 4 ℃, centrifugal 30 min of 12000 g are the good recombinant protein diluent of renaturation.
Conclusion: make up BL21 (DE3) engineering bacteria that contains the pET-gE expression vector, the gE albumen of the fusion His label behind the acquisition purifying.
Four, the comparison of codon optimized front and back gE expressing quantity
Before the gE gene order is codon optimized and the gE protein expression engineering bacteria equal proportion inoculation medium that makes up respectively after optimizing, cultivate 10h after, carrying out ultrasonic bacteria breaking is carried out determination of protein concentration with the whole bacterial protein sample.Get the equal sample of whole bacterial protein total amount and carry out the Western engram analysis, the purpose gE protein band after the result is optimized is larger than the gE protein band concentration before optimizing, and the results are shown in Figure 1.Thereby show that the Nucleotide that the present invention optimizes has outstanding effect.
Five, the preparation of polyclonal serum
(1) animal is selected: two of New Zealand's large ear rabbits.
(2) route of inoculation: subcutaneous injection.
(3) inoculation position: back, left and right sides pin foot pad, left and right sides inguinal region.
(4) adjuvant uses: Freund's complete adjuvant (CFA), Freund's incomplete adjuvant (IFA) are Sigma company product.
(5) vaccination strategies:
1) every large ear rabbit antigen immune consumption 1.0 mg.The gE albumen of getting behind the 2.5 mg purifying adds Freund's complete adjuvant 2.5 mL, and clockwise direction grinds until form " water-in-oil " sample emulsion.
2) fixing large ear rabbit, 75 % ethanol disinfections, respectively at back, left and right sides pin foot pad, left and right sides inguinal region subcutaneous injection emulsion, injection volume 2 mL/ are only.
3) week about booster immunization once, wherein second and third time adds Freund's incomplete adjuvant, the 4th injections of antigens solution.
4) arise from rabbit ear edge venous blood sampling the 5th week, with tiring of the two expansion method detection specificity antibody of agarose.
5) antiserum(antisera) separates: treat under the heart bloodletting, room temperature that serum separates fully, and centrifugal rear packing serum ,-70 ℃ are frozen for subsequent use.
Two-way immunodiffusion(ID) result shows that when anti-gE protein antiserum extent of dilution is 1:32, the obvious sediment line occurs, the anti-gE protein polyclone antibody of rabbit is tired and is respectively 1:32.
Conclusion: gE albumen can make New Zealand's large ear rabbit produce polyclonal serum.
The Western trace detects serological specificity:
Choose the negative contrast of BL21 (DE3) bacterium, simultaneously carry out SDS-PAGE with the positive contrast of the gE-His behind the purifying, electrotransfer is to the NC film, the rabbit anti-serum of preparation is take the 1:5000 dilution as primary antibodie, the HRP mark goat anti-rabbit igg of 1:5000 dilution is two anti-, detects the immunoreactivity of the anti-gE-His serum of rabbit.
The result shows: obvious immune response can occur with the anti-gE-His serum of rabbit in the gE-His albumen of purifying, and BL21 (DE3) has no the appearance of reaction band in corresponding molecular weight position, show to have good immunoreactivity.
Six, the animal experiment of the duck plague virus genetic engineering subunit vaccine of recombinant protein preparation
Through 10 of the negative ducks of intramuscular inoculation 10 age in days duck plagues, other gets 10 in contrast with the duck plague virus genetic engineering subunit vaccine of preparation.Inoculate and get blood after 14 days and survey Antibody To Duck Plague Virus, the immune group Antibody To Duck Plague Virus is all positive, efficiently reaches 100%, and control group does not detect antibody; The result shows that the recombinant protein immunogenicity of preparation is good.The duck plague virus genetic engineering subunit vaccine that further prepares with this recombinant protein can cause the immunne response of duck, can effectively prevent duck plague.
Claims (5)
1. Nucleotide that is used for coding duck plague virus gE albumen, its sequence is SEQ ID NO:1.
2. Nucleotide, described Nucleotide is the complementary sequence of Nucleotide claimed in claim 1.
3. duck plague virus gE albumen claimed in claim 1, its aminoacid sequence is SEQ ID NO:2.
4. the application of duck plague virus gE albumen claimed in claim 3 in preparation duck plague virus genetic engineering subunit vaccine.
5. vaccine claimed in claim 4 is used for the preventing duck seasonal febrile diseases.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210549913XA CN103060343A (en) | 2012-12-17 | 2012-12-17 | Duck plague virus g E protein genes and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210549913XA CN103060343A (en) | 2012-12-17 | 2012-12-17 | Duck plague virus g E protein genes and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103060343A true CN103060343A (en) | 2013-04-24 |
Family
ID=48103239
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210549913XA Pending CN103060343A (en) | 2012-12-17 | 2012-12-17 | Duck plague virus g E protein genes and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103060343A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576294A (en) * | 2018-12-26 | 2019-04-05 | 四川农业大学 | The seamless gene-deleted strain CHv-BAC-G- Δ gE of duck plague virus gE gene and its construction method |
-
2012
- 2012-12-17 CN CN201210549913XA patent/CN103060343A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| CHENG, A.C., ET AL.: "GenBank accession number:ABW35297.1", 《GENBANK》 * |
| HUA CHANG, ET AL.: "Cloning, expression and characterization of gE protein of Duck plague virus", 《VIROLOGY JOURNAL》 * |
| WU,Y., ET AL.: "Genbank accession number:AFC61897.1", 《GENBANK》 * |
| 常华: "鸭瘟病毒gE基因功能初步研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576294A (en) * | 2018-12-26 | 2019-04-05 | 四川农业大学 | The seamless gene-deleted strain CHv-BAC-G- Δ gE of duck plague virus gE gene and its construction method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106282216B (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| CN102864157B (en) | Immune protective antigen of haemophilus parasuis | |
| CN101900731B (en) | ELISA kit for distinctively detecting antibodies of classical swine fever (CSF) vaccine immunity and wild virus infection and preparation method thereof | |
| CN103585625A (en) | Porcine epidemic diarrhea recombinant baculovirus gene engineering subunit vaccine, preparation method and application thereof | |
| CN103386128B (en) | Tuberculosis subunit vaccine containing unite adjuvant | |
| CN108324936A (en) | A kind of grass carp reovirus VP35 protein subunit vaccines and its preparation method and application | |
| CN105949287A (en) | A-type avibacterium paragallinarum immunizing protective antigen and application thereof | |
| CN102977194B (en) | Duck tembusu virus (DTMUV) E protein gene and application thereof | |
| CN103897065B (en) | Ox Asia1/O type aftosa bivalent polyepitope vaccines and its preparation method and application | |
| CN104250304B (en) | The vaccine combination of a kind of fusion protein and its coding and application | |
| CN109568572A (en) | A kind of preparation method and applications of Aeromonas Multivalent DNA Vaccine | |
| CN107936123B (en) | Swine transmissible gastroenteritis virus fusion protein and preparation method and application thereof | |
| CN108530522A (en) | A kind of OmpK multi-epitopes polypeptide, construction method and its application of recombination | |
| CN104093419B (en) | The preparation method of the wide spectrum vaccine of prevention birds colibacillosis | |
| CN102590503A (en) | Indirect blocking ELISA (Enzyme-Linked Immuno Sorbent Assay) detection kit of antibody of porcine torque teno virus type II | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN102533629B (en) | Preparation method of avian encephalomyelitis virus VP1 protein subunit vaccine | |
| CN102240399B (en) | Application of siniperca chuatsi ISKNV (Infectious Spleen and Kidney Necrosis Virus) ORF093 protein | |
| CN101979581B (en) | S7 gene and coded recombinant protein of grass carp reovirus strain, and acquisition method and application thereof | |
| CN103060343A (en) | Duck plague virus g E protein genes and application thereof | |
| CN102154306B (en) | Codon-optimized swine CD40L gene and preparation method for recombinant rhabdovirus for expressing protein coded by same | |
| CN102206257A (en) | Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application | |
| CN108059685A (en) | Swine foot-and-mouth disease virus A type Fc polypeptide vaccines and its preparation method and application | |
| CN109517044B (en) | Porcine epidemic diarrhea virus genetic engineering antigen and antibody | |
| CN102586166A (en) | Construction of recombinant bacteria expressing avian encephalomyelitis virus VP1 protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB02 | Change of applicant information |
Address after: 266111 Shandong city of Qingdao province Chengyang Qingda Industrial Park, the first northbound dual Applicant after: QINGDAO VLAND BIOLOGICAL CO., LTD. Applicant after: Qingdao Boite Biopharmaceutical Co., Ltd. Address before: 266061 Shandong city of Qingdao province high tech park of Laoshan district by the No. 29 Shandong Road, building 6F high speed Applicant before: Qingdao KDN Pharmaceutical Co., Ltd. Applicant before: Qingdao Boite Biopharmaceutical Co., Ltd. |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: APPLICANT; FROM: QINGDAO KDN PHARMACEUTICAL CO., LTD. TO: QINGDAO WEILAN BIOLOGY CO., LTD. |
|
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130424 |