CN102154306B - Codon-optimized swine CD40L gene and preparation method for recombinant rhabdovirus for expressing protein coded by same - Google Patents
Codon-optimized swine CD40L gene and preparation method for recombinant rhabdovirus for expressing protein coded by same Download PDFInfo
- Publication number
- CN102154306B CN102154306B CN 201110029283 CN201110029283A CN102154306B CN 102154306 B CN102154306 B CN 102154306B CN 201110029283 CN201110029283 CN 201110029283 CN 201110029283 A CN201110029283 A CN 201110029283A CN 102154306 B CN102154306 B CN 102154306B
- Authority
- CN
- China
- Prior art keywords
- cd40l
- gene
- pig
- dh10bac
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a codon-optimized swine CD40L gene, which is in accordance with the preference of the codon of cells of insects and is suitable to be expressed in a rhabdovirus system. The expressed swine CD40L molecules have high bioactivity and can increase the immune response ability of microorganisms. The invention also provides the preparation method of a recombinant rhabdovirus for expressing a protein coded by the gene.
Description
Technical field
The present invention relates to codon optimized pig CD40L gene and express the preparation method of the recombinant baculovirus of its proteins encoded, belong to the genetically engineered field.
Background technology:
Pig CD40L molecule is the part of Tumor Necrosis Factor Receptors CD40 molecule, mainly is expressed in the CD4 of activation
+The T lymphocytic cell surface.Natural CD40L molecule exists with two kinds of forms, is solvable type and transmembrane, and that current research is more deep is transmembrane CD40L.
Pig CD40L molecule is an II type transmembrane glycoprotein, full-length cDNA coding 261 amino-acid residues (AA), wherein 22 AA of amino end form the endochylema section of CD40L molecule, and 23 AA that are right after consist of the cross-film section, and 216 AA of carboxyl terminal form the extracellular fragment of CD40L.The proteins encoded of pig CD40L cDNA is 28kDa approximately.
Pig CD40L and its acceptor CD40 molecule play vital effect in immune response, have pivotal role to regulating humoral immunization and cell immune response.CD40L combine with the CD40 Development And Differentiation that participates in bone-marrow-derived lymphocyte and the type conversion of immunoglobulin (Ig); Promote lymphocytic the exciting with directed of T to activate; The differentiation and the function that participate in antigen presenting cell are regulated.
Many data show, CD40L can be used as a kind of novel immunostimulant and regulates the animal immune response, therefore set up the CD40L expression system of a boar, for further experiment research lays the foundation.
It is clear that escherichia expression system has genetic background, the destination gene expression level is high, cultivate simple to operate, the conversion transduction efficiency is high, the growth and breeding fast period is short, and contamination resistance is strong, and is with low cost, can produce the advantages such as target protein by rapid large-scale, the outer rim albumen of expression can account for 30% of total bacterial protein.Therefore escherichia expression system occupies an important position in gene expression technique, is the important tool in molecular biology research and the biotechnology industry development process.
The codon of coded amino acid has degeneracy, and every kind of biology has the Preference of oneself to the selection of synonym.The expression of goal gene is subject to the impact of many factors, such as the inclined to one side preferendum of genetic code, the structure of target protein, the expression condition that expression system is selected etc., wherein the codon preference according to expressive host is optimized goal gene, can greatly improve the expression efficiency of expressive host, thereby improve the expression amount of target protein.
Summary of the invention
The purpose of this invention is to provide codon optimized pig CD40L gene, meet the inclined to one side preferendum of insect cell codon, be adapted at expressing in the rhabdovirus system.The preparation method of the recombinant baculovirus of expressing this gene coded protein also is provided simultaneously.
This provides a kind of codon optimized pig CD40L gene clearly, comprises the sequence shown in the SEQ ID NO:3.Described codon optimized pig CD40L gene, its sequence is shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:5.
The invention provides the preparation method of the recombinant baculovirus of the pig CD40L albumen of expressing the said gene coding:
(1) described gene is linked to each other construction recombination plasmid with plasmid pFast Dual;
(2) described recombinant plasmid transformed is entered DH10Bac, obtain the restructuring DH10Bac of kantlex, tsiklomitsin, gentamicin resistance by blue hickie screening;
(3) described restructuring DH10Bac transfection Sf-9 cell is obtained recombinant baculovirus.
The pig CD40L albumen of described recombinant baculovirus expression the albumen that molecular weight is about 28kD occurs through the SDS-PAGE electrophoresis on the collection of illustrative plates; Western-blot tests demonstration: the specific band that appearance can be combined with the anti-pig CD40L of rabbit polyclonal antibody about 28kD.
The invention provides codon optimized pig CD40L gene, meet the inclined to one side preferendum of insect cell codon, be adapted at expressing in the rhabdovirus system, the pig CD40L molecular biological activity that gives expression to is high, immunne response ability that can enhancing body.
Description of drawings
Fig. 1 is the electrophorogram of RT-PCR product
Wherein, 1-RT-PCR product, the standard Marker of 2-molecular weight 2000bp
Fig. 2 is that the enzyme of carrier pMD-PCD40L is cut the evaluation electrophorogram
Wherein, the standard Marker of 1-molecular weight 2000bp, 2-PMD-
PThe enzyme of CD40L recombinant vectors is cut product;
Fig. 3 is that the enzyme of carrier pET-PCD40L is cut the evaluation electrophorogram
Wherein, the standard Marker of 1-molecular weight 2000bp, 2-pET-
PThe enzyme of CD40L is cut product;
Fig. 4 is the SDS-PAGE electrophorogram of expressing protein
Wherein, 1-protein standard Marker, 2～5-induction time are respectively 3,4,5, expressing protein during 6h, and 6-induces the ultrasonic rear supernatant of bacterium, and 7-induces the ultrasonic postprecipitation of bacterium, the recombinant protein of 8-purifying;
Fig. 5 is after different concns IPTG induces, the SDS-PAGE electrophorogram of expressing protein
Wherein, 1-protein standard Marker, 2～6-IPTG induced concentration be respectively 0.2,0.4,0.6,0.8,1.0mM;
Fig. 6 is the PCR product electrophorogram of sCD40L gene
Wherein, 1, the 2-PCR product, the standard Marker of 3-molecular weight 2000bp
Fig. 7 represents the evaluation electrophorogram of recombinant shuttle vector
Wherein, 1-negative control, 2-molecular weight are 15000 DNA standard Marker, 3-Bac-PCD40L recombinant vectors gene, 4-Bac-LZsCD40L recombinant vectors gene, 5-Bac-MLZsCD40L recombinant vectors gene; Fig. 8 represents that recombinant baculovirus PCR identifies electrophorogram
Wherein, 1-DNA standard Marker, 2-Bac-PCD40L recombinant baculovirus, the 3-Bac-LZsCD40L recombinant baculovirus of recombinating, 4-Bac-MLZsCD40L recombinant baculovirus, 5-empty carrier recombinant baculovirus; Fig. 9 recombinant baculovirus expression protein SDS-PAGE electrophorogram
Wherein, 1-protein standard Marker, 2-
PCD40L recombinant baculovirus expression albumen, 3-LZsCD40L restructuring recombinant baculovirus expression albumen, 4-MLZsCD40L recombinant baculovirus expression albumen, 5-are empty carrier recombinant baculovirus expression albumen;
Figure 10 represents that recombinant baculovirus expression albumen WesternBlot identifies
Wherein, 1-is that the protein standard is dyed Marker in advance, 2-MLZsCD40L recombinant baculovirus expression albumen, 3-LZsCD40L recombinant baculovirus expression albumen, 4-
PCD40L recombinant baculovirus expression albumen.
Embodiment
The clone of embodiment 1 pig CD40L goal gene and codon optimized
(1) clone of pig CD40L goal gene
The pig CD40L expression system that the present invention makes up, the CD40L that includes, is numbered AB040443 take the NCBI nucleic acid database carry out design of primers P1, P2 as the template of design of primers:
P1：actagtgcaccgccgcctggataa
P2：aagcttttacagcttcagcaggccgaagc
Separate the pig peripheral blood lymphocyte that secures good health, to contain interleukin-22 (IL-2), volumetric concentration behind the RPMI1640 nutrient solution cultivation 3d of 10% calf serum, extract total RNA behind the ConA stimulation cultivation 10h with final concentration 10ug/ml.By RT-PCR method amplification pig CD40L gene:
Take P2 as primer, take total RNA as template, obtain cDNA through reverse transcription reaction.Transcriptive process,reversed is as follows, in the centrifuge tube of following reagent adding without the RNA enzyme: total RNA template 4 μ L, dNTPs (2.5mM) 1 μ L, P2 primer 1 μ L, H
2O 7 μ L, cool off 2min on the ice chest with putting rapidly behind 65 ℃ of heating of above-mentioned centrifuge tube 5min, the centrifugal rear adding 5 * buffer 4 μ L of the slow speed of revolution, RNA enzyme inhibitors (20IU/ μ l) 1 μ L, 0.1M DDT 1 μ L, M-MLV ThermoScript II 1 μ L, making cumulative volume is 20 μ L.After the said components mixing, after 37 ℃ of temperature are bathed 50min, place 15min deactivation M-MLV ThermoScript II for 72 ℃, put immediately cooled on ice, so far just obtained cDNA, place-20 ℃ to save backup.
The acquisition of pig CD40L gene: the pcr amplification reaction system is as follows: cDNA (product of reverse transcription reaction) 5 μ L, MgCl
2(25mM) 3 μ L, dNTPs (2.5mM) 4 μ L, 10 * Ex PCR buffer, 5 μ L, Ex Taq enzyme 0.5 μ L, P11 μ L, P21 μ L use ddH
2O30.5 μ L adds to cumulative volume 50 μ L.With the laggard performing PCR amplification of above-mentioned reaction system mixing, the parameter of reaction is: 94 ℃ of denaturation 5min; The PCR circulation is: 94 ℃ of 1min, 51 ℃ of annealing 1min, 72 ℃ of 1min, totally 35 circulations; 72 ℃ are extended 10min.Total overall reaction is got 5 μ L PCR products after finishing, and detects the pcr amplification result with 1.0% agarose gel electrophoresis, and as shown in Figure 1, pig CD40L gene size is about 786bp.
The connection test kit of use TaKaRa company is connected the PCR product of purifying with the pMD18T carrier, concrete operations are according to the test kit specification sheets, reaction system is as follows: the PCR product 4.5 μ L of purifying, pMD18-T carrier 0.5 μ L, solution I 5.0 μ L, cumulative volume is 10.0 μ L.Instantaneous centrifugal mixing places 16 ℃ of connections spend the night (the ligation time is about 16h); Connect product and be directly used in conversion escherichia coli DH5a competent cell.Picking transforms single colony inoculation LB nutrient solution, and 37 ℃ are swayed overnight incubation.
By the plasmid in the escherichia coli DH5a after the above-mentioned conversion of alkaline lysis method of extracting on " molecular cloning experiment guide ", with restriction enzyme BamH I and Hind III double digestion, the endonuclease reaction system is 30ul, and concrete component is as follows: recombinant plasmid 5 μ L, dd H
2O 20 μ L, 10 * K Buffer, 3 μ L, BamH I 1 μ L, Hind III 1 μ L totally are 30 μ L.37 ℃ of endonuclease reaction 4h behind the instantaneous centrifugal mixing get 10 μ L enzymes and cut product and carry out 1% agarose gel electrophoresis and identify.Identify correct recombinant plasmid called after pMD-CD40L.Identify that correct positive bacterium colony send Beijing Liuhe Huada Genomics Technology Co., Ltd's order-checking, the gene order that records is shown in SEQ ID NO:1, and this sequence is pig CD40L gene order.
(2) optimization of pig CD40L gene
Codon optimized pig CD40L gene: according to intestinal bacteria and insect cell codon usage bias, use Mac Vector 7.2 software analysis pig CD40L genes (SEQ ID NO:1), find out its sub-preference that accesses to your password codon site different from intestinal bacteria and insect cell codon usage bias.Under the prerequisite that does not change aminoacid sequence, select all higher codons of intestinal bacteria and insect cell frequency of utilization.Utilize TakaRa MutanBEST Kit to carry out repeatedly rite-directed mutagenesis operation, operation steps is carried out according to the test kit specification sheets, and the pig CD40L unnamed gene that obtains after codon optimized is pCD40L.
The PCD40L gene is connected with the pMD18-T carrier, changes in the escherichia coli DH5a, enzyme is cut the result as shown in Figure 2, and the dna sequence dna size is about 786bp, the sequence that records shown in SEQ ID NO:2, the vector plasmid called after pMD-pCD40L of acquisition.
Among the embodiment 1 used reagent respectively available from: ExTaq archaeal dna polymerase, dNTPs, T4DNA ligase enzyme, DNA Marker, DNA purification kit, restriction endonuclease BamH I and Hind III are available from the precious biotech firm in Dalian; Lymphocyte separation medium, saturation balance phenol (pH8.0) are available from Shanghai biotechnology company limited; Yeast extract, peptone are available from OXOID company; The RPMI1640 nutrient solution is available from the general biotech firm that flies; Trizol reagent is available from Invitrigen company; All the other reagent are import or domestic analytical pure.
The preparation of the anti-pig CD40L of embodiment 2 rabbits polyclonal antibody
(1) pig CD40L goal gene prokaryotic expression
1.pET-PCD40L the structure of expression vector
Extract in a small amount test kit with plasmid and extract respectively PMD-PCD40L vector plasmid, pET32a expression vector plasmid, with restriction enzyme BamH I, the Hind III is carried out respectively double digestion to PMD-PCD40L plasmid and empty pET32a (+) carrier, the endonuclease reaction system is 30ul, and concrete component is as follows: plasmid 5 μ L, ddH
2O 20 μ L, 10 * K Buffer, 3 μ L, BamH I 1 μ L, Hind III 1 μ L.Carry out agarose electrophoresis after enzyme is cut and separate the goal gene fragment.Glue reclaims test kit and reclaims respectively PCD40L purpose fragment, pET32a plasmid fragment, and the ligation of DNA T4 ligase enzyme makes up the pET-PCD40L recombinant vectors.Connect product and change the Host Strains e. coli bl21 over to: get and connect product 10ul transformed competence colibacillus BL21100ul, mixing content gently, ice bath 30min; 42 ℃ of heat-shocked 90s; Ice bath 3min at once adds 37 ℃ of vibrations of LB nutrient solution 45min of 800ul antibiotic-free, evenly is coated with bacterium liquid in the whole LB agar plate that contains penbritin with aseptic coated with glass device, is inverted cultivation 10-14h for 37 ℃.
2.pET-PCD40L the purification Identification of recombinant expression vector
White single colony inoculation after picking step 1 is cultivated in the 4mlLB liquid medium, 37 ℃ of vibration 14h.Plasmid extracts in a small amount test kit and extracts plasmid pET-PCD40L, carries out double digestion and identifies (it is the same that enzyme is cut system) and carry out agarose electrophoresis.Electrophorogram proves the success of pET-PCD40L expression vector establishment as shown in Figure 3.The bacterium called after CD40L/BL21 that obtains.
3. the abduction delivering of pig CD40L molecule
Fresh CD40L/BL21 bacterium liquid is inoculated in LB nutrient solution (containing penbritin 100ug/ml), shake bacterium to OD value approximately 0.6, the IPTG that adds final concentration and be 1m mol induces, after inducing 2,3,4,5,6h takes out respectively 1ml bacterium liquid testing goal protein expression level.The result as shown in Figure 4, the 6h expression amount is the highest after inducing.
Fresh CD40L/BL21 bacterium liquid is inoculated in the LB nutrient solution shakes bacterium to OD value approximately 0.6, add respectively the IPTG that final concentration is 0.1mM, 0.2mM, 0.4mM, 0.6mM, 0.8mM, 1.0mM, induce rear 6h results bacterium liquid testing goal protein expression level.The result as shown in Figure 5, different IP TG induced concentration expression amount is more or less the same, therefore select the IPTG of 0.1mM to induce.
Fresh CD40L/BL21 bacterium liquid is inoculated in the LB nutrient solution of 500ml, after cell concentration reaches OD value 0.6, the IPTG abduction delivering 6h results bacterium liquid take final concentration as 0.1mM.12,000rpm low-temperature centrifugation results thalline, resuspended with Binding buffer, ultrasonication behind the multigelation 3 times.High speed centrifugation, results supernatant liquor and precipitation take a morsel respectively and are SDS-PAGE, the result: without target protein, be to have target protein to exist in the inclusion body and precipitate in the supernatant liquor behind the cell ultrasonic degradation, see Fig. 4.Be dissolved in the 8M urea after the washing of precipitate three times.Obtain target protein through the affinity chromatography purifying, see Fig. 4.
(2) immunity obtains the anti-pig CD40L of rabbit polyclonal antibody
Selecting body weight is two of the rabbit of 2.5-3.0kg, and adopting the target protein that step () purifying obtains in the present embodiment is immunogen, press at every turn the target protein of 200mg purifying/, immunizing rabbit.Immunity vestibule venous blood collection is got negative serum.
Fundamental immunity: asepsis injector sucks the complete Freund's adjuvant of 4mL (containing the 400mg target protein) immunogen and equivalent volumes (4ml) in the 10ml centrifuge tube, and suction process makes it to form thickness emulsion.4 ℃ of emulsions that spend the night are not stratified namely to meet immune requirement.Rabbit foot pad section subcutaneous inoculation.200mg immunogen after 4 weeks/only (volume ratio of target protein and incomplete Freund's adjuvant is 1: 1) emulsion carries out booster immunization, again immunity of Isodose after 6 weeks.Heart blood sampling after last two weeks of immunity, preparation rabbit anti-pig CD40L serum (being positive serum) wherein contains the anti-pig CD40L of rabbit polyclonal antibody.Produce the anti-pig CD40L of high-level rabbit polyclonal antibody by indirect ELISA method proof rabbit, antibody horizontal reaches more than 1: 10000, is shown in Table 1.
Table 1 indirect elisa method detects rabbit immune serum antibody titer result
Agents useful for same source among the embodiment 2: T4DNA ligase enzyme, DNA 2000Marker, DNA purification kit, restriction endonuclease BamH I and Hind III are available from the precious biotech firm in Dalian; Yeast extract, peptone are available from OXOID company; TEMED (TEMED) is available from Promega company; Tris balance phenol (pH8.0) is available from Shanghai biotechnology company limited; His Bind Purification Kit is available from Novagen company; DAB colouring reagents box is available from Nanjing Sheng Xing biotech firm; Enzyme mark goat-anti rabbit two is anti-available from Wuhan Boster Biological Technology Co., Ltd.; Molecular weight of albumen Marker, IPTG are available from the auspicious biotech firm of wound; Freund's complete adjuvant, Freund's incomplete adjuvant are available from Sigma company; All the other reagent are import or domestic analytical pure.
The structure of embodiment 3 eukaryon expression shuttle vectors
The gene order that order-checking is correct is analyzed with the DNASTAR biological software, determine intracellular region, cross-film district and the extracellular region of pig PCD40L gene, the position that defines soluble CD 40 L (sCD40L) gene order of biological action is 139 to 786 gene orders.And primers according to this.By Primer Premier 5.0 biosoftwares design primer, the upstream and downstream primer adds respectively Spe I, Hind III restriction enzyme site, and primer sequence is seen P3 (SEQ ID NO:8) and P4 (SEQ ID NO:9).
Upstream primer P3:5 '-ACTAGTCACCGCCGCCTGGATAA
Downstream primer P4:5 '-AAGCTTTTACAGCTTCAGCAGGCCGAAGC
Take plasmid pMD-PCD40L as template, pcr amplification sCD40L gene.Concrete component is: template pMD-CD40L 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (2.5mM) 4 μ L, 10 * Ex Buffer, 5 μ L, ExTaq enzyme 0.5 μ L, P31 μ L, P41 μ L, ddH
2O 34.5 μ L, cumulative volume are 50 μ L.With the laggard performing PCR amplification of above-mentioned reaction system mixing, the loop parameter of reaction is: 94 ℃ of denaturation 5min, and the PCR circulation is 94 ℃ of 45s, 54 ℃ of annealing 45s, 72 ℃ of 45s, after 35 circulations, 72 ℃ are extended 10min.After total overall reaction finishes, get 5 μ L PCR products and carry out 1% agarose gel electrophoresis detection PCR product.As shown in Figure 6, the target DNA sequence size is about 649bp.
Identify the recombinant plasmid called after pMD-sCD40L of correct (PCR product electrophorogram such as Fig. 6).Send Beijing Liuhe Huada Genomics Technology Co., Ltd's order-checking with the positive recombinant bacterium that filters out, the sequence that records is shown in SEQ ID NO:3.
Synthetic melittin signal peptide (M) and leucine zipper (LZ), gene order is seen SEQ ID NO:4, parallel-series obtains recombinant plasmid pUC57-MLZ in plasmid pUC57.Gene order 5 ' the end of synthetic contains BamH I restriction enzyme site, and 3 ' end contains Spe I restriction enzyme site.Between melittin signal peptide and leucine zipper, add EcoR I restriction enzyme site.Recombinant plasmid pUC57-MLZ is synthetic by Jin Site science and technology (Nanjing) company limited.
Plasmid pFast Dual, pMD-PCD40L use respectively BamH I and Hind III double digestion, carry out agarose electrophoresis after enzyme is cut.Reclaim test kit with glue respectively and reclaim pFast Dual plasmid fragment, PCD40L purpose fragment, then with the DNAT4 ligase enzyme two fragments are coupled together, connect product and change competence intestinal bacteria DH10Bac over to, construction recombination plasmid pFast Dual-PCD40L.Endonuclease reaction, glue removal process and ligation concrete steps are with embodiment 1.Insert the gene fragment PCD40L after optimizing in the vector plasmid pFast Dual ring-shaped sequence between BamH I, Hind III restriction enzyme site, i.e. SEQ ID NO:2.
Plasmid pFast Dual, pMD-sCD40L use respectively Spe I, Hind III double digestion, carry out agarose electrophoresis after enzyme is cut, and glue reclaims test kit and reclaims respectively pFastDual plasmid fragment, sCD40L gene fragment, and the DNAT4 ligase enzyme connects.Connect product transformed competence colibacillus DH10Bac, make up plasmid pFast Dual-sCD40L.Endonuclease reaction, glue removal process and ligation concrete steps are with embodiment 1.
Plasmid pFast Dual-sCD40L, pUC57-MLZ use respectively EcoR I, Spe I double digestion, carry out agarose electrophoresis after enzyme is cut, and glue reclaims test kit and reclaims respectively pFast Dual-sCD40L carrier segments, LZ gene fragment, and the DNAT4 ligase enzyme connects.Connect product transformed competence colibacillus DH10Bac, construction recombination plasmid pFast Dual-LZsCD40L.Endonuclease reaction, glue removal process and ligation concrete steps are with embodiment 1.Insert leucine zipper contained sCD40L gene (LZsCD40L, i.e. SEQ ID NO:4) in the vector plasmid pFastDual ring-shaped sequence between EcoR I, Hind III restriction enzyme site.
Plasmid pFast Dual-sCD40L, pUC57-Mlz use respectively BamH I, Spe I double digestion, carry out agarose electrophoresis after enzyme is cut, and glue reclaims test kit and reclaims respectively Mlz gene fragment, pFast Dual-sCD40L carrier segments, and the DNAT4 ligase enzyme connects.Connect product transformed competence colibacillus DH10Bac, construction recombination plasmid pFast Dual-MlzsCD40L.Endonuclease reaction, glue removal process and ligation concrete steps are with embodiment 1.Insert the sCD40L gene (MLZsCD40L, i.e. SEQ ID NO:5) that contains melittin signal peptide and leucine zipper in the vector plasmid pFastDual ring-shaped sequence between BamH I, Hind III restriction enzyme site.
The standby competence intestinal bacteria DH10Bac of CaCl2 legal system.With recombinant plasmid pFast Dual-MLZsCD40L, pFast Dual-LZsCD40L, pFast Dual-PCD40L is transformed into respectively DH10Bac, by containing kantlex/tsiklomitsin/gentamicin/X-Gal/IPTG/LB solid medium screening (blue hickie screening), picking hickie bacterium colony is incubated overnight in the LB nutrient solution that contains kantlex/tsiklomitsin/gentamicin, repeatedly rule behind the purifying three generations, obtain respectively DH10Bac-MLZsCD40L, DH10Bac-LZsCD40L and DH10Bac-PCD40L, extract shuttle vectors restructuring Bacmid DNA:Bac-MLZsCD40L, Bac-LZsCD40L, DH10Bac-PCD40L, extraction step is with reference to the BAC/PAC DNA Isolation Kit specification sheets of OMEGA company.By the M13/PUC universal primer rBacmid that extracts being carried out PCR identifies.
M13/PUC (on): GTTTTCCCAGTCACGAC
M13/PUC (descending): CAGGAAACAGCTATGAC
The reaction system that PCR identifies: restructuring Bacmid DNA 1 μ L, 10 * Ex Taq Buffer, 5 μ L, dNTPs (25mM) 4 μ L, Mg
2+(25mM) 3 μ L, M13/PUC (on) 1 μ L, M13/PUC (descending) 1 μ L, Ex Taq 1 μ L, ddH
2O 34 μ L, total reaction system 50 μ L; Reaction conditions: 94 ℃ of denaturation 4min; 94 ℃ of sex change 45s, 55 ℃ of annealing 45s, 72 ℃ are extended 5min, 30 circulations; Keep 10min for 72 ℃.Set up when PCR identifies take negative control (with the Bacmid DNA of empty carrier pfast Dual gene recombination as template).Electrophorogram as shown in Figure 7, swimming lane 1 negative contrast is about 2500bp; Swimming lane 2 is that DNA standard Marker swimming lane 3 is Bac-CD40L recombinant vectors gene, is about 2700bp; Swimming lane 4 is Bac-LZsCD40L recombinant vectors gene 2750bp; Swimming lane 5 is Bac-MLZsCD40L recombinant vectors gene, is about 2800bp.Electrophoresis result proves and successfully makes up recombinant vectors.
Agents useful for same source: DNA Marker DL 2000,15000 among the embodiment 3, λ-Hand III isopropyl-β-D-thiogalactoside(IPTG) (IPTG), 5-bromo-4-chloro-3-indoles galactoside (X-gal), the T4DNA ligase enzyme, the ExTaq archaeal dna polymerase, DNA glue reclaims test kit, restriction endonuclease, the little extraction reagent kit of plasmid is available from Dalian TaKaRa company; Albumen Marker is available from the auspicious biotech firm of wound; All the other reagent are import or domestic analytical pure.
Preparation, the evaluation of embodiment 4 recombinant baculovirus
Respectively with the DH10Bac of sky, the DH10Bac-pFast that contains empty carrier, DH10Bac-MLZsCD40L, the DH 10Bac-LZsCD40L, the DH 10Bac-PCD40L transfection Sf-9 cell that contain recombinant vectors obtain P1 for recombinant baculovirus, amplicon virus obtains recombinant baculovirus Bac-MLZsCD40L, Bac-LZsCD40L, Bac-PCD40L to P3 generation.Extract the recombinant baculovirus DNA performing PCR of going forward side by side and identify, extraction step is with reference to the BAC/PAC DNA Isolation Kit specification sheets of OMEGA company.Electrophorogram as shown in Figure 8, swimming lane 1 is DNA standard Marker; Swimming lane 2,3,4 is respectively Bac-PCD40L, Bac-LZsCD40L, Bac-MLZsCD40 recombinant baculovirus Genomic PCR result; Swimming lane 5 is the empty carrier recombinant baculovirus.PCR result confirms that the recombinant shuttle plasmid carrier successfully is cloned in the Baculovirus Gene group.
The Sf-9 Growth of Cells adds P3 for recombinant baculovirus during to logarithmic phase, cultivates 72h for 27 ℃, and collecting cell when the virus infection pathology is obvious adopts SDS-PAGE to detect after the PBS washing three times to identify recombinant protein.SDS-PAGE result can find out that about 28kD recombinant baculovirus has target protein to express as shown in Figure 9.Carry out the Western-blot test by the anti-pig CD40L of embodiment 2 made rabbits polyclonal antibody, the result single specificity band occurs as shown in figure 10 about 28kD, illustrate that the pig CD40L recombinant protein of baculovirus expression has specificity.
Used lipofectamine Lipofectamine among the embodiment 4
TM2000 available from Invitrogen company; The goat anti-rabbit igg of horseradish peroxidase-labeled is available from Sigma company.
Claims (7)
1. a codon optimized pig CD40L gene is characterized in that its sequence is shown in SEQ ID NO:2.
2. a codon optimized pig CD40L gene is characterized in that its sequence is shown in SEQ ID NO:4.
3. a codon optimized pig CD40L gene is characterized in that its sequence is shown in SEQ ID NO:5.
4. the preparation method of the recombinant baculovirus of a pig CD40L albumen of expressing the described genes encoding of claim 1:
(1) described gene is linked to each other construction recombination plasmid with plasmid pFast Dual;
(2) described recombinant plasmid transformed is entered DH10Bac, obtain the restructuring DH10Bac of kantlex, tsiklomitsin, gentamicin resistance by blue hickie screening;
(3) described restructuring DH10Bac transfection sf-9 cell is obtained recombinant baculovirus.
5. the preparation method of the recombinant baculovirus of a pig CD40L albumen of expressing the described genes encoding of claim 2:
(1) described gene is linked to each other construction recombination plasmid with plasmid pFast Dual;
(2) described recombinant plasmid transformed is entered DH10Bac, obtain the restructuring DH10Bac of kantlex, tsiklomitsin, gentamicin resistance by blue hickie screening
(3) described restructuring DH10Bac transfection sf-9 cell is obtained recombinant baculovirus.
6. the preparation method of the recombinant baculovirus of a pig CD40L albumen of expressing the described genes encoding of claim 3:
(1) described gene is linked to each other construction recombination plasmid with plasmid pFast Dual;
(2) described recombinant plasmid transformed is entered DH10Bac, obtain the restructuring DH10Bac of kantlex, tsiklomitsin, gentamicin resistance by blue hickie screening;
(3) described restructuring DH10Bac transfection sf-9 cell is obtained recombinant baculovirus.
7. according to claim 4 or the preparation method of 5 or 6 described recombinant baculovirus, it is characterized in that the pig CD40L albumen of described recombinant baculovirus expression through the SDS-PAGE electrophoresis, the albumen that molecular weight is about 28kD occurs on the collection of illustrative plates; Through the Western-blot test, show: the specific band that appearance can be combined with the anti-pig CD40L of rabbit polyclonal antibody about 28kD.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110029283 CN102154306B (en) | 2011-01-27 | 2011-01-27 | Codon-optimized swine CD40L gene and preparation method for recombinant rhabdovirus for expressing protein coded by same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110029283 CN102154306B (en) | 2011-01-27 | 2011-01-27 | Codon-optimized swine CD40L gene and preparation method for recombinant rhabdovirus for expressing protein coded by same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102154306A CN102154306A (en) | 2011-08-17 |
| CN102154306B true CN102154306B (en) | 2013-04-10 |
Family
ID=44435978
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110029283 Active CN102154306B (en) | 2011-01-27 | 2011-01-27 | Codon-optimized swine CD40L gene and preparation method for recombinant rhabdovirus for expressing protein coded by same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102154306B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004099B (en) * | 2014-06-13 | 2016-08-24 | 山西农业大学 | Pig CD40Ldimer fusion protein and encoding gene thereof |
| WO2016153995A1 (en) * | 2015-03-20 | 2016-09-29 | The Trustees Of The University Of Pennsylvania | Vaccines with cd40 ligand as an adjuvant |
| CN117964764A (en) * | 2018-12-20 | 2024-05-03 | 中山大学附属第三医院 | High-affinity soluble pig CD40L antibody and preparation method thereof |
-
2011
- 2011-01-27 CN CN 201110029283 patent/CN102154306B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Fischer K P et al.Identification and characterization of functional CD154 In the Pekin duck.《Developmental and Comparative Immunology》.2007,第31卷(第1期),全文. * |
| 沈维娜等.CD40、CD40L和sCD40在B细胞恶性血液肿瘤中的作用.《上海交通大学学报医学版》.2009,(第10期),全文. * |
| 赵振国等.人可溶性CD40L cDNA的克隆及表达.《第四军医大学学报》.2006,第27卷(第7期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102154306A (en) | 2011-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Guan et al. | Enhancement of protective immunity in European eel (Anguilla anguilla) against Aeromonas hydrophila and Aeromonas sobria by a recombinant Aeromonas outer membrane protein | |
| CN101451145B (en) | Tuberculosis gene vaccine based on T cell epitope as well as preparation method and use thereof | |
| CN108324936A (en) | A kind of grass carp reovirus VP35 protein subunit vaccines and its preparation method and application | |
| CN104877019A (en) | Protein of acinetobacter baumannii hypothetical protein A1S_1523 as well as preparation method and application of protein | |
| CN102154306B (en) | Codon-optimized swine CD40L gene and preparation method for recombinant rhabdovirus for expressing protein coded by same | |
| CN107236039A (en) | Recombinate Wzt albumen rabbit anteserum polyclonal antibodies and preparation method thereof | |
| CN101920009B (en) | Vaccine for preventing and curing tumor | |
| CN102993308B (en) | Methicillin-resistant staphylococcus aureus (MRSA) vaccine recombinant protein antigen HI2 and preparation method and application thereof | |
| CN103694321A (en) | Staphylococcus aureus mSEB mutant and preparation method and application thereof | |
| Singh et al. | Molecular characterization and computational analysis of the major outer membrane protein (ompH) gene of Pasteurella multocida P52 | |
| CN103614387B (en) | The carrying Cap gene of porcine circovirus type 2 gene optimized and recombinant plasmid and application | |
| CN104861050A (en) | Acinetobacter baumannii zinc dependent oligopeptide A1S-1610 recombinant protein and preparation method and application thereof | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN106117365A (en) | Anti-streptococcus suis is sick and has the active fusion protein of autoimmune and preparation thereof and application | |
| CN103319575A (en) | Haemophilus parasuis (Hps) immunoprotecive antigen CdtB | |
| CN103127498A (en) | Recombination antigen composition, vaccine and carrier and method for preparing antigen composition | |
| CN108359682B (en) | Edwardsiella tarda outer membrane protein PagC with immune protection effect | |
| CN104072590B (en) | A kind of hitchens and Hansen antigen combination and its application | |
| CN103012578B (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
| CN102406929A (en) | Co-expressed molecular adjuvant enhanced divalent foot and mouth disease protein engineering vaccine | |
| CN102240399A (en) | Application of siniperca chuatsi ISKNV (Infectious Spleen and Kidney Necrosis Virus) ORF093 protein | |
| CN102847168B (en) | The design of a kind of nucleic acid vaccine PV-Fn preventing bovine mastitis and structure thereof | |
| CN103215274A (en) | Epinephelus coioides interferon IFNgamma2 and preparation method and application thereof | |
| CN103509815A (en) | Preparation method of recombinant panda IL-2 immune adjuvant | |
| CN111850003A (en) | Recombinant expression pasteurella multocida thiamine periplasm binding protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180409 Address after: Nanjing City, Jiangsu province 210014 Zhongling Street No. 50 Patentee after: Jiangsu Academy of Agricultural Sciences Address before: Xiaolingwei Nanjing City, Jiangsu province 210014 Zhongling Street No. 50 Patentee before: National Center for Veterinary Biologicals Engineering Research |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201027 Address after: Zhong Ling Jie Nanjing Xuanwu District of Jiangsu Province, No. 50 210014 Patentee after: Jiangsu Agricultural Science and Technology Transfer Center Co.,Ltd. Address before: Nanjing City, Jiangsu province 210014 Zhongling Street No. 50 Patentee before: JIANGSU ACADEMY OF AGRICULTURAL SCIENCES |
|
| TR01 | Transfer of patent right |