CN104072590B - A kind of hitchens and Hansen antigen combination and its application - Google Patents

Abstract

The invention provides a kind of new meningococcal antigen combination and its application.Specifically, described antigen combination includes：By fHbp V1 anomalies albumen, fHbp V2 anomalies albumen and NHBA albumen.It is demonstrated experimentally that the vaccine prepared using antigen combination of the present invention there can be obvious cooperative effect, and show good wide spectrum meningococcemia ability.

Description

A kind of hitchens and Hansen antigen combination and its application

Technical field

The present invention relates to vaccines arts, more particularly to meningococcus recombinant protein vaccine component and combinations thereof.

Background technology

Meningitis seriously threatens the health of the mankind, and the annual death in the whole world is estimated to be 170,000, and Neisser Meningococcus is to cause one of three kinds of main pathogenic microbes of meningitis, is also uniquely to cause epidemic meningitis The pathogenic bacteria of (epidemic meningitis).The average attack rate of global epidemic meningitis is 1-10/10 ten thousand, case fatality rate 10% or so, more than 20% patient's meeting Leave permanent central lesion.

According to the difference of capsular polysaccharide chemical constitution, meningococcus can be divided into 13 sero-groups, main pathogenic flora It is A, B, C, Y and W135 groups, more than 95% case can be caused.Other such as 29E, X sero-groups can also cause a disease, but case load compared with It is few, occur small-scale X groups of epidemic meningitis prevalence in Africa recently, China is it has also been found that X groups of cases.In Europe, America and Oceania etc. Area, the meningitis as caused by B groups of bacterial strains is more than 1/3, in the country of application C meningococcal polysaccharide combined vaccines, by B groups Case caused by bacterial strain has exceeded 2/3, and even up to 90% (Lucidarme J wait .J Clin Microbiol.2009,47 (11):3577-3585.).In China, it is generally recognized that A groups and C groups are topmost pathogenic groups.But in recent years, from patient and In the meningococcal strain separated in Healthy People, the B groups of bacterial strains for principal causative group account for 1/3.

For A, C, W135 and Y groups, the polysaccharide vaccine that is made of capsular polysaccharide and capsular polysaccharide-protein conjugates and Polysaccharide conjugate vaccine can prevent.And B groups of polysaccharide structures have homology with tissue ingredient of human body tissue ingredient, it is impossible to vaccine is made.

At present, only several outer membrane vesicles (OMV) vaccines are used in some areas, and the main component of this vaccine is I classes Outer membrane protein PorA.The albumen is meningococcus Subtypes foundation, and with variability, therefore OMV vaccines are only capable of use In prevention and bacterial strains of the PorA with hypotype.

It is a series of to be located at bacterium surface, induce and kill with the development of genomics, protein science, reverse vaccinology etc. The vaccine candidate albumen of bacteria antibody, which is screened to identify, to be come, and is mainly included：I class 1 outer-membrane proteins PorA, Neisseria adhesin (NadA), H factor bindins (fHbp, other title GNA1870, LP2086, ORF2086, NMB1870, fHBP, with change Special-shaped V1, V2 and V3), heparin-binding protein (NHBA, other title GNA2132), Neisseria surface protein A (NspA) etc..

Because there is diversity and variability in meningococcus surface protein, often the combination of many antigens can be only achieved compared with Good, wider protecting effect, experimental evidence shows that the combination of many antigens can play complementary and synergy.In January, 2013, A kind of B group meningitis coccis vaccine of Novartis companies exploitation is ratified to list by European Union, and its composition is the GNA1870- of restructuring FHbp (anomaly V1) fusion protein, NadA-3, NHBA-GNA2131 fusion protein, and prepared from NZ98/254 bacterial strains OMV (main component is PorA1.4).However, interacting with the presence or absence of potency between various antigens in many antigen vaccines And it is potential risks in vaccine preparation process that whether can cause the increase of side effect.

Therefore, how diversity and variability based on meningococcus surface protein, select suitable albumen to turn into and grind B group meningitis coccis vaccine processed, so universal meningococcus vaccine challenge.Therefore this area has in the urgent need to exploitation one kind Effect and B group's vaccines with certain coverage rate.

The content of the invention

The invention provides a kind of unique combination-vaccine suitable for B group meningitis, it can be induced for a variety of meninxes The bactericidin of scorching coccus.

The first aspect of the present invention includes there is provided a kind of antigen combination, described antigen combination：

(factor H binding protein, variant1, fHbp the V1 anomalies of H factor bindins anomaly 1 Albumen), (factor H binding protein, variant2, fHbp the V2 anomaly eggs of H factor bindins anomaly 2 In vain) and heparin-binding protein (Neisserial Heparin Binding Antigen, NHBA albumen).

In another preference, described combination is also included fHbp V1 anomalies albumen, fHbp V2 anomaly albumen Or the amino acid sequence of NHBA albumen is respectively through derivative egg formed by the substitution, deletion or addition of one or several amino acid White combination, and the combination of described derived protein produces immune response activity with activation body to meningococcal B group Function.

In another preference, described fHbp V1 anomalies albumen, fHbp V2 anomalies albumen and NHBA albumen point Bao Kuo not wild type and saltant type.

In another preference, described fHbp V1 anomalies albumen (such as SEQ ID NO.:1-3) 6-113 bit aminos Homology >=95% of acid sequence.

In another preference, described fHbp V2 anomalies albumen (such as SEQ ID NO.:4-6) 6-145 bit aminos Homology >=95% of acid sequence.

In another preference, described NHBA albumen (such as SEQ ID NO.:7-9) 27-87 amino acids sequence Homology >=85%.

In another preference, in described antigen combination, the sequence such as SEQ ID NO. of fHbp V1 anomaly albumen: Shown in 1-3；And/or

The sequence such as SEQ ID NO. of the fHbp V2 anomaly albumen:Shown in 4-6；And/or

The sequence of the NHBA albumen such as SEQ ID NO.:Shown in 7-9.

In another preference, the albumen in the antigen combination is all from Neisseria meningitidis (Neisseria meningitidis)。

Second aspect of the present invention is more in described polynucleotides combination there is provided a kind of combination of the polynucleotides of separation Nucleotides is separately encoded the antigen in antigen combination described in first aspect present invention.

In another preference, the polynucleotide sequence such as SEQ ID NO. in described polynucleotides combination:10-18 institutes Show, be separately encoded SEQ ID NO.:1-9 albumen.

Third aspect present invention contains the multinuclear described in second aspect of the present invention there is provided a kind of carrier, described carrier Polynucleotides in thuja acid combination.

In another preference, described carrier is expression vector.

In another preference, polynucleotides described in one or more second aspect of the present invention can be contained in described carrier Polynucleotides in combination.

Fourth aspect present invention is there is provided a kind of host cell, and described host cell contains third aspect present invention institute The carrier stated, or the chromosomal integration of described host cell have the polynucleotides described in second aspect of the present invention to combine.

Fifth aspect present invention is there is provided a kind of method for obtaining antigen combination described in first aspect present invention, and culture is originally Host cell described in invention fourth aspect, so as to obtain the antigen combination described in first aspect present invention.

Sixth aspect present invention is pre- for preparing there is provided a kind of purposes of antigen combination described in first aspect present invention The vaccine combination of anti-meningococcalmeningitis.

In another preference, described vaccine combination includes the antigen combination described in first aspect present invention, and Acceptable carrier in vaccinology.

In another preference, described antigen combination, which is also useful as carrier protein, to be used to prepare polysaccharide-protein knot Close vaccine.

In another preference, the polysaccharide can come from the scorching coccus of Neisseria meningitidis, haemophilus influenzae, pneumonia streptococcus Bacterium, Salmonella typhi, A group streptococcus, B group streptococcus；Polysaccharide may come from capsular polysaccharide, lipopolysaccharides, fat oligosaccharides.

Seventh aspect present invention includes first party of the present invention there is provided a kind of vaccine combination, described vaccine combination Antigen combination described in face, and acceptable carrier in vaccinology.

In another preference, acceptable carrier is helped completely including aluminium adjuvant, MF59, Freund in described vaccinology Agent, incomplete Freund's adjuvant, CpG adjuvants, BCG vaccine ribonucleic acid, Monophosphoryl lipid A.

In another preference, described vaccine combination can be also used for preparing combined vaccine.

In another preference, described combined vaccine also includes A groups, C groups, Y groups or W135 groups vaccines, Hib combination epidemic diseases Seedling, pneumococcal conjugated vaccine, pertussis diph-tet vaccine, typhoid Vi polysaccharide combined vaccine, paratyphoid polysaccharide combination epidemic disease Seedling, composition multivalent meningococcal vaccine and/or combined vaccine.

In another preference, described vaccine combination can also include NadA, NspA, FetA.

In another preference, described vaccine combination, fHbp V1 anomalies albumen, fHbp V2 anomalies albumen, Ratio between NHBA albumen is 1：(0.5-2)：(0.5-2), preferably 1:1:1 (based on the weight of active ingredient)

Eighth aspect present invention there is provided a kind of method for preparing vaccine combination described in seventh aspect present invention, including Step：Antigen combination described in first aspect present invention is mixed with acceptable carrier in vaccinology, so as to obtain the present invention Vaccine combination described in 7th aspect.

In another preference, the antigen in described antigen combination is obtained by genetic recombination or chemical synthesis.

Ninth aspect present invention is there is provided a kind of method of prevention meningococcalmeningitis, to required object Using vaccine combination of the present invention.

In another preference, it is described the need for object include mammal, it is preferred that for people, mouse, rat, rabbit.

It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment) It can be combined with each other between each technical characteristic of body description, so as to constitute new or preferred technical scheme.As space is limited, exist This no longer tires out one by one states.

Brief description of the drawings

Fig. 1 shows the pcr amplification product electrophoresis pattern of 3 kinds of GFPs such as fHbp-1, fHbp-2 and NHBA.

Fig. 2 shows the double digestion qualification figure of the recombinant plasmid of recombination expression fHbp-1, fHbp-2 and NHBA3 kind albumen Spectrum.

Fig. 3 shows restructuring fHbp-1, fHbp-2 and NHBA protein SDS-PAGE electrophoresis pattern of purifying.

Fig. 4 shows restructuring fHbp-1, fHbp-2 and NHBA albumen rabbit anteserum its specific antibody determination result.

Fig. 5 shows that the FACS result of the tests (purple that rabbit anteserum is combined with bacterium is immunized in restructuring fHbp-1, fHbp-2 and NHBA The region of color filling is negative control, and unfilled red/blue curve is immune serum testing result).

Fig. 6 show restructuring fHbp-1a/b, fHbp-2a/b, NHBA-a/b, and combinations thereof immune serum bacterium is killed Bacterium power result of the test.

Fig. 7 shows that rabbit anteserum is immunized in restructuring fHbp-1c, fHbp-2c, NHBA-c, fHbp-1c+fHbp-2c+NHBA-c Result in the experiment of suckling mouse passive immune protection.

Embodiment

The present inventor have unexpectedly discovered that, will come from meningococcal by in-depth study extensively first V1, V2 anomaly and NHBA albumen common combinations of fHbp albumen, the antigen of composition can effectively form anti-brain in vivo Meningococcus B groups it is immune, and this immune effect is in obvious cooperative effect.In addition, it is demonstrated experimentally that these three albumen are total to Can have a good bacterial strain covering power with the vaccine to be formed is applied in combination, and in view of meningococcus not possess group special Property, vaccine combination of the present invention can also cover in the meningococcus that A groups and C group are principal causative group to a certain extent, Therefore, vaccine combination of the present invention can be used as the meningococcemia vaccine of wide spectrum.On this basis, the present invention is completed.

FHbp albumen

FHbp is a kind of film surface lipoprotein, and many meningococcal bacterial strains all carry its gene, it has been found that do not carry (Lucidarme J wait .Clin.Vaccine Immunol.2011,18 (6) to the bacterial strain of the gene:1002-1014.).According to The difference of amino acid sequence, the albumen can be divided into 3 kinds of anomalies (V1 anomalies, V2 anomalies and V3 anomalies), wherein V2 Anomaly has certain cross-protection with V3 anomalies, and their cross-protections between V1 anomalies are weak.

Anomaly 1, anomaly 2 and the gene of anomaly 3 are separately encoded 280 or so amino acid residues.Identical anomaly The amino acid identity of fHbp albumen is minimum can be of about 90%, and the amino acid identity between the fHbp albumen of Different Variation type can As little as 62%.

FHbp V1 anomaly albumen available for the present invention is not particularly limited, and can be any wild type or saltant type FHbpV1 anomaly albumen.Preferably, available in the fHbp albumen of antigen combination of the present invention or vaccine combination, fHbp V1 The sequence of anomaly may be selected from SEQ ID NO.:1-3, may also comprise SEQID NO.:1-3 carries out one or several amino acid Addition, the amino acid sequence deleted or replaced, it is highly preferred that can be and wild type fHbp V1 anomalies albumen (such as SEQ ID NO.:1-3 sequences) 6-113 amino acids homologys be maintained at more than 90%, the sequence of preferably more than 95% albumen Row.

FHbp V2 anomaly albumen available for the present invention is not particularly limited, and can be any wild type or saltant type FHbpV2 anomaly albumen.Preferably, available in the fHbp albumen of antigen combination of the present invention or vaccine combination, fHbp V2 The sequence of anomaly may be selected from SEQ ID NO.:4-6, may also comprise SEQ ID NO.:4-6 carries out one or several amino acid Addition, the amino acid sequence deleted or replaced, it is highly preferred that can be and wild type fHbp V2 anomalies albumen (such as SEQ ID NO.:4-6 sequences) 6-145 amino acids homologys be maintained at more than 90%, the sequence of preferably more than 95% albumen Row.

NHBA albumen

NHBA is a kind of distinctive lipoprotein of neisseria, is almost expressed on all bacterial strains, but NHBA histone aminos Acid sequence has certain variability, therefore can not often cover large-scale bacterial strain for NHBA single vaccine.

The total number of atnino acid of NHBA gene codes about 420-500, between different NHBA albumen, except single or multiple Outside the amino acid variation in site, also there is insertion or the missing of single amino acids or small peptide.The amino acid of different NHBA albumen Homology can as little as 60%.

NHBA available for the present invention is not particularly limited, and can be the NHBA anomaly eggs of any wild type or saltant type In vain.Because the homology of wild type NHBA albumen is relatively low, thus typically with SEQ ID NO.:NHBA albumen homologies shown in 7-9 Property be more than 60%, preferably greater than 70%, more preferably larger than 80% saltant type NHBA can also be used for the antigen combination of the present invention Or vaccine combination.It is highly preferred that can be and wild type NHBA albumen (such as SEQ ID NO.:7-9 sequences) 27-87 ammonia Base acid homology is maintained at more than 85%, the sequence of preferably more than 90% albumen.

Antigen combination

Invention also provides a kind of antigen combination containing polyprotein.Wherein, the albumen in described antigen combination Come from meningococcus.

As used herein, term " albumen of the present invention " refers to that albumen one or more in antigen combination of the present invention are total Claim.

As used herein, term " antigen " is to refer to stimulate body to produce (specificity) immune response, and can be with being immunized Response product antibodies and sensitized lymphocyte are combined in vitro, the material for occurring immunological effect (specific reaction).The base of antigen This characteristic has two kinds, and one is the ability for inducing immune response, that is, immunogenicity, two be occur with the product of immune response it is anti- Should, that is, antigenicity.

As used herein, term " combination of fHbp V1 anomalies albumen, fHbp V2 anomalies albumen and NHBA albumen ", " antigen combination ", " protein combination of the present invention ", " present invention combination " are used interchangeably, and are referred to albumen of the present invention or its derivative The antigen mixture of albumen three common combination formation.

As used herein, term " fHbpV1 anomalies ", " fHbp anomalies 1 ", " anomaly 1 " is used interchangeably, and is referred to It is the V1 anomalies of the fHbp albumen of meningococcal B group.Term " fHbpV2 anomalies ", " fHbp anomalies 2 ", " anomaly 2 " are used interchangeably, and refer to the V2 anomalies of the fHbp albumen of meningococcal B group.

In addition, the antigen combination can also be the combination of following Sequence composition：There is activation body to meningitis ball Bacterium B groups produces immune response activity, SEQ ID NO：The variant form of sequence shown in 1-9.These variant forms are included (but simultaneously It is not limited to)：The missing, insertion and/or substitution of 1-5 (usually 1-4, more preferably 1-3, most preferably 1-2) amino acid, And it (is usually within 5, within preferably 3-4, more to add or lack one or several in C-terminal and/or N-terminal Goodly within 1-2) amino acid.For example, in the art, when being replaced with similar nature or similar amino acid, leading to Chang Buhui changes the function of protein.Again such as, it is usual in C-terminal and/or N-terminal addition or missing one or several amino acid Also the 26S Proteasome Structure and Function of protein will not be changed.

Present invention additionally comprises the active fragment of described antigen combination, derivative and analog.As used herein, term " fragment ", " derivative ", " derived protein " and " analog " refers to that be kept substantially activation body produces to meningococcal B group The albumen of immune response activity.It is one or several conservative that the fragment of albumen of the present invention, derivative or the like can be that (i) has Or the substituted polypeptide of non-conservative amino acid residue (preferably conservative amino acid), or (ii) is in one or more amino There is the polypeptide of substituted radical in sour residue, or (iii) albumen of the present invention (such as extends polypeptide half-life period with another compound Compound, such as polyethylene glycol) the formed polypeptide of fusion, or (iv) additional amino acid sequence is blended in this peptide sequence Formed by polypeptide (derived protein formed by being merged with the sequence label such as targeting sequencing, secretion sequence or 6His).According to this The teaching of text, these fragments, derivative and analog can be wild type or saltant type, and these belong to this Scope known to skilled practitioner.

The preferred reactive derivative of one class refers to and SEQ ID NO.:1-9 amino acid sequence is compared respectively, there is at most 5, Preferably at most 3-4, more preferably at most 1-2 amino acid is replaced by the similar or close amino acid of property and forms many Peptide.These conservative variation's polypeptides carry out amino acid substitution preferably based on table 1 and produced.

Table 1

Initial residue	Representational substitution	It is preferred that substitution
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

Invention also provides the analog of antigen combination of the present invention.These analogs and the difference of natural antigen combination of the present invention It can be difference on amino acid sequence or do not influence the difference on the modified forms of sequence, or have both at the same time.Class Also include the analog with the residue (such as D- amino acid) different from natural L-amino acids like thing, and with non-naturally-occurring Or synthesis amino acid (such as β, gamma-amino acid) analog.It should be understood that the polypeptide of the present invention is not limited to above-mentioned enumerate Representational polypeptide.

Polynucleotides

In the present invention, term " polynucleotides ", " coded sequence " are used interchangeably, and refer both to encode albumen of the present invention DNA sequence dna, can be all artificial synthesized, is then stitched together, and forms the DNA sequence dna of coding albumen of the present invention.Also may be used So that the polynucleotides for encoding albumen of the present invention are carried out into artificial combination respectively, for importing plasmid, and the sheet of restructuring is produced The combination of invention albumen.

As used herein, term " primer " refers to matching with template, in the presence of archaeal dna polymerase can using its as rise Point carries out the general name of the oligonucleotide acid of the synthesis DNA complementary with template.Primer can be natural RNA, DNA, can also It is any type of natural nucleotide.Primer can even is that non-natural nucleotides such as LNA or ZNA etc..

Primer " generally " (or " substantially ") and a special sequence complementation on a chain in template.Primer is necessary With an abundant complementation of chain in template could start extension, but primer sequence need not be with template sequence complete complementary.Than Such as, in 5 ' ends of one 3 ' the end primer complementary with template plus the preceding paragraph and the not complementary sequence of template, such primer is still big It is complementary with template in cause.As long as there is sufficiently long primer sufficiently to be combined with template, non-fully complementary primer can also be with Template formation primer-template complex, so as to be expanded.

After the DNA sequence dna of the new albumen of the coding present invention is obtained, suitable expression vector is connected into, then be transferred to conjunction Suitable host cell.Finally, the host cell after culture conversion, the albumen of the present invention is obtained by isolating and purifying.

As used herein, term " carrier " includes plasmid, clay, expression vector, cloning vector, viral vector etc..Represent Property state include (but being not limited to)：The carrier that can be expressed in eukaryotic such as CHO, COS series eukaryotic, can be The carrier expressed in saccharomyces cerevisiae or pichia yeast, the carrier that can be expressed in the insect cells such as silkworm and prokaryotic expression are carried Body.

In the present invention, it can select various carriers known in the art such as commercially available carrier.Such as, from commercially available load Body, is then operably coupled to expression regulation sequence by the nucleotide sequence for encoding the new fusion protein of the present invention, can form egg White expression vector.

In the present invention, term " host cell " includes prokaryotic and eukaryotic.Conventional prokaryotic host cell Example includes Escherichia coli, hay bacillus etc..Conventional eukaryotic host cell includes yeast cells, and insect cell and lactation are dynamic Thing cell.It is preferred that the host cell is eukaryotic, more preferably it is bombyx mori cell.

After the host cell of conversion is obtained, the cell can be cultivated under conditions of expression fusion protein of the present invention is adapted to, So as to give expression to fusion protein.It can separate and purify by various separation methods using its physics, chemistry and other characteristics The albumen of restructuring.These methods are well-known to those skilled in the art.The example of these methods includes but is not limited to：It is conventional Renaturation process, handle with protein precipitant (salting-out method), centrifugation, infiltration broken bacterium, ultrasonication, ultracentrifugation, molecular sieve Chromatograph (gel filtration), adsorption chromatography, ion-exchange chromatography, high performance liquid chroma- tography (HPLC) and other various liquid chromatography technologies And the combination of these methods.

Pharmaceutical composition and vaccine combination

Present invention also offers the pharmaceutical composition of prevention meningococcus (especially B groups), described pharmaceutical composition Can be curative or preventative.A kind of preferred composition is preventative vaccine combination, especially containing for Meningococcus fHbp V1 anomalies albumen, fHbp V2 anomalies albumen, the vaccine combination of NHBA albumen.

These vaccines include immunising antigen or immunogene, immunogenic polypeptide, albumen or protein fragments or nucleic acid (such as Ribonucleic acid or DNA), generally combined with " pharmaceutically acceptable carrier ", these carriers are not induced including itself Produce any carrier for the antibody being harmful to the individual for receiving said composition.Suitable carrier is typically big, is metabolized slowly Macromolecular, such as protein, polysaccharide, PLA, polyglycolic acid, amino acid polymer, amino acid copolymer, lipid aggregates are (such as Oil droplet or liposome) and inactive virion.These carriers are well known to those of ordinary skill in the art.In addition, These carriers can play immunostimulant (" adjuvant ").

The preferably adjuvant of enhancing composition effect includes but is not limited to：(1) aluminium salt (alum), such as aluminium hydroxide, phosphorus Sour aluminium, aluminum sulfate etc.；(2) ISA720 adjuvants；(3) freund adjuvant etc..

Vaccine combination (including antigen, pharmaceutically acceptable carrier and/or adjuvant), usually contains diluent, such as water, Salt solution, glycerine, ethanol etc..In addition, auxiliary substances, such as wetting agent or emulsifying agent, pH buffer substance may be present in this kind of fortune In carrier.In addition, can be containing anti-in pharmaceutically acceptable carriers including the vaccine combination including immunogenic composition Original, polypeptide, albumen, protein fragments or nucleic acid.

More specifically, the vaccine including immunogenic composition, the immunogenic polypeptide comprising immune effective dose, with And above-mentioned other required components." immune effective dose " refers to gives the amount of individual to treatment or pre- with single dose or a continuous agent part Anti- is effective.The consumption is according to treating the health status and physiological status of individual, treat individual classification (such as inhuman spirit Long class etc.), the ability of individual immunity system synthesis antibody, required degree of protection, the preparation of vaccine, treating physician is to medical shape Depending on the assessment of condition and other correlative factors.It is expected that the consumption is by relatively wide scope, can by normal experiment come It is determined that.

A kind of vaccinology approach is DNA vaccination, i.e. the DNA vaccination containing the coded sequence for encoding antigen combination of the present invention.

Method of application

Generally, injectable agent, such as liquid solution or emulsion can be made in vaccine combination or immunogenic composition； It may also be fabricated which and be adapted to supplying solution or suspension, the solid form of liquid excipient before the injection.Said preparation is also emulsifiable or encapsulates In liposome, adjuvant effect is strengthened under above-mentioned pharmaceutically acceptable carrier.

Conventional method is to give immunogenic composition from parenteral (subcutaneously or intramuscularly) approach by injection.It is adapted to other Other formulas of administering mode include oral, suppository and transdermal application etc..Therapeutic dose can be single dose regimen or multiple doses. Vaccine can together be given with reference to other immunomodulators.

Beneficial effect of the present invention：

Specific antigen combination can effectively activate body and B group meningitis coccis are exempted from vaccine combination of the present invention Epidemic disease response, so that B groups are effectively immunized, and this kind combination has obvious cooperative effect.In addition, vaccine group of the present invention Compound goes out certain wide spectrum covering power to clinically different strains expresseds, therefore may be used as the meningococcus epidemic disease of wide spectrum Seedling.

With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention Rather than limitation the scope of the present invention.The experimental method of unreceipted actual conditions in the following example, generally according to conventional strip Part, such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) described in condition, or according to the condition proposed by manufacturer.Unless otherwise indicated, it is no Then percentage and number are percentage by weight and parts by weight.

Embodiment 1 recombinantly expresses the structure of engineering bacteria

Genome is extracted from 3 plants of meningococcus clinical separation strain cultures, is expanded and is speculated without coding respectively by PCR The first fHbp (being named as fHbp-1, i.e. anomaly 1), second of fHbp of signal peptide sequence (be named as fHbp-2, that is, become It is special-shaped 2) and NHBA genes.PCR amplification forward primers are arranged in the following table with reverse primer, and forward primer and reverse primer draw respectively Enter Nde I and BamH I (fHbp) or Nhe I and BamH I (NHBA) restriction enzyme site, shown with underscore.Weight Group fHbp and NHBA albumen respectively in the form of His-tag is merged in expression in escherichia coli with plasmid pET-28a (Novagen) For expression vector.

FHbp-1 and fHbp-2 clone：Carried out with rTaq archaeal dna polymerases (TaKaRa companies) from bacterial genomes DNA PCR.PCR reaction conditions are：95℃5min；95 DEG C of 1min, 60 DEG C of 1min, 72 DEG C of 1min, 35 circulations；72 DEG C of extension 8min. Amplified production and expression vector pET-28a (Novagen companies) carry out double digestion with Nde I and BamH I, and digestion products are through 1% Agarose gel electrophoresis is separated, and purpose fragment is reclaimed with DNA gel QIAquick Gel Extraction Kit, and through T4DNA ligases, (Fermentas is public Department) connection, transformed competence colibacillus bacillus coli DH 5 alpha, picking positive colony, the progress double digestion identification of extraction plasmid and sequencing identification. Will identification correct plasmid conversion e. coli bl21 (DE3).

NHBA clone：Enter performing PCR from bacterial genomes DNA with rTaq archaeal dna polymerases (TaKaRa companies).PCR reacts Condition is：95℃5min；95 DEG C of 1min, 58 DEG C of 1min, 72 DEG C of 2min, 35 circulations；72 DEG C of extension 8min.Amplified production and table Double digestion is carried out with Nhe I and BamH I up to carrier pET-28a (Novagen companies), digestion products are through 1% Ago-Gel electricity Swimming separation, purpose fragment is reclaimed with DNA gel QIAquick Gel Extraction Kit, is connected through T4DNA ligases (Fermentas companies), conversion Competence bacillus coli DH 5 alpha, picking positive colony extracts plasmid and carries out double digestion identification and sequencing identification.It will identify correct Plasmid conversion e. coli bl21 (DE3).

FHbp-1 and fHbp-2 and NHBA gene PCR amplified production electrophoresis patterns are shown in Fig. 2, and molecular weight of product size is respectively 760bp, 760bp, 1400bp or so.

Recombinant plasmid double digestion identification collection of illustrative plates is shown in Fig. 3, it is seen that molecular size range is respectively 760bp, 760bp, 1400bp left Right endonuclease bamhi.

The fermented and cultured of embodiment 2

Recombinate fHbp-1 and fHbp-2 fermented and cultured.By recombinant plasmid transformed BL21 (DE3) competence, on picking flat board Monoclonal bacterium colony, be seeded in the LB fluid nutrient mediums that 5ml contains kanamycins, 37 DEG C of shaken cultivations are stayed overnight, second day turn In the triangular flask for connecing LB fluid nutrient mediums of the 250ml containing kanamycins, 37 DEG C of shaken cultivations to 600nm absorbance values A₆₀₀It is worth and is 0.6, IPTG to final concentration of 0.6mmol/L is added, continues shaken cultivation 5 hours, 6000rpm is centrifuged 10 minutes, thalline is collected.

Recombinate NHBA fermented and cultured.By recombinant plasmid transformed BL21 (DE3) competence, the monoclonal bacterium on picking flat board Fall, be seeded in the LB fluid nutrient mediums that 5ml contains kanamycins, 37 DEG C of shaken cultivations are stayed overnight, switching 250ml is containing card within second day In the triangular flask of the LB fluid nutrient mediums of that mycin, 37 DEG C of shaken cultivations to 600nm absorbance values A₆₀₀It is worth for 0.6, addition IPTG To final concentration of 0.1mmol/L, continue shaken cultivation 6 hours, 6000rpm is centrifuged 10 minutes, collect thalline.

The destination protein of embodiment 3 is purified

Thalline liquid is resuspended with nickel column balance buffering liquid to be placed in mixture of ice and water, ultrasonic wave breaks bacterium.After broken bacterium, centrifugation is received Obtain supernatant.Supernatant is through Ni²⁺Affinity column purifying obtains crude product, and fHbp-1 and fHbp-2 is through gel permeation chromatography for restructuring It is further purified, restructuring NHBA is further purified through CM ion columns.Restructuring fHbp-1, fHbp-2 and NHBA albumen after purification SDS-PAGE spectrum is shown in Fig. 4.The albumen of purifying be stored in -20 DEG C it is standby.

The animal immune of embodiment 4

Restructuring fHbp-1, fHbp-2, NHBA, fHbp-1+fHbp-2+NHBA that purifying is obtained are separately added into Freund assistant Agent, immunizing rabbit, injection dosage be the 200 every kind of albumen of μ g//only.It is immune three times, it is spaced two weeks.First dose is that Freund is helped completely Agent, second dose and the 3rd dose is incomplete Freund's adjuvant.Final immunization blood sampling two weeks after, separates serum, standby in -20 DEG C of preservations With.Set up non-immune group and vehicle control group simultaneously.

The Specific antibody titre of embodiment 5 is determined

Specific IgG titers in immune serum are determined using indirect elisa method, i.e.,：With the restructuring fHbp-1 of purifying, FHbp-2, NHBA distinguish coated elisa plate；After board-washing and closing, the serum to be checked being serially diluted is added, it is small in 37 DEG C of reactions 1 When；Board-washing, adds the goat anti-rabbit igg enzyme labelled antibody (KPL companies) of horseradish peroxidase-labeled, and 37 DEG C are reacted 30 minutes； Board-washing, adds terminating reaction after TMB develops the color 5-10 minutes, 450nm light is read on ELIASA (Molecule Device companies) Absorption value A₄₅₀.Using non-immune group serum as negative control, with negative control sera A₄₅₀2.1 times of average value are used as cut-off Value, judges that Yin/Yang is reacted.Positive reaction highest dilution is the antibody titer of measuring samples, calculates the several of each group sample What average titer (Geometry mean titer, GMT).

The antibody titre results that rabbit is immunized in restructuring fHbp-1, fHbp-2, NHBA see Fig. 5, and 3 kinds of recombinant proteins can induce rabbit Produce the specific antibody of high titre.

The FACS of embodiment 6 is tested

The meningococcus bacterium solution of fresh cultured is diluted to 1 × 10 with 10% calf serum-PBS⁹Individual/ml, by 1:50 Ratio adds restructuring fHbp-1, fHbp-2, NHBA and rabbit anteserum is immunized, and mixes and is incubated 1 hour after 4 DEG C；Thalline is collected by centrifugation, uses 1% calf serum-PBS is washed, and is resuspended；FITC mark donkey anti-rabbit IgG antibodies (Biolegend companies) are added, are mixed after 4 DEG C It is incubated 40 minutes, thalline is collected by centrifugation, ibid washs, thalline is resuspended with PBS, fluidic cell pipe is transferred to, in flow cytometer (BD Company) on detect.If negative serum (vehicle control group) and positive serum (rabbit anteserum is immunized in whole cell) control.

Recombinate the immune rabbit anteserum of fHbp-1, fHbp-2, NHBA meningococcal to fHbp anomalies 1 and anomaly 2 FACS result of the tests are shown in Fig. 6.It can be seen that there is positive reaction with the bacterial strain of fHbp anomalies 1 in restructuring fHbp-1 immune serums；Similarly, There is positive reaction with the bacterial strain of fHbp anomalies 2 in restructuring fHbp-2 immune serums；And recombinate fHbp-1 or fHbp-2 immune serums The bacterium bond strength different from fHbp anomalies is weaker or negative；NHBA protein immunization serums are recombinated to 2 bacterial strains The different positive reaction of bond strength is presented.As a result show, restructuring fHbp-1, fHbp-2 and NHBA can induce rabbit to produce specificity Antibody and the surface for being attached to bacterium, fHbp albumen have variation type specificity, and NHBA has preferable cross reaction.

The sterilizing power of embodiment 7 is tested

Other homologous proteins in antigen combination are prepared for respectively using embodiment 1-3 method, wherein first group of (group A) fHbp-1 (being designated as fHbp-1a), fHbp-2 (being designated as fHbp-2a) and NHBA (being designated as NHBA-a) amino acid sequence difference Correspondence SEQ ID NO.:1、SEQ ID NO.:4 and SEQ ID NO.:7；The fHbp-1 (being designated as fHbp-1b) of another group (group b), FHbp-2 (being designated as fHbp-2b) and NHBA (being designated as NHBA-b) amino acid sequence correspond to SEQ ID NO. respectively:2SEQ ID NO.:5SEQ ID NO.:8.Rabbit is immunized using the method for embodiment 4 and prepares immune serum.

With reference to national standard GB16884-1997, meningococal meningitis diagnostic criteria and treatment principle, Appendix B-epidemic meningitis Serological diagnostic method, B3-sterilizing power test method carries out the sterilizing power experiment of immune serum antibody.Will through 56 DEG C 30 minutes The serum to be checked of inactivation treatment, is serially diluted in 96 porocyte culture plates, per the μ l of hole 25, the isometric newborn rabbit complement of addition, The meningococcus bacterium solution of fresh cultured, mixes and is incubated 1 hour after 37 DEG C；50 μ l TTC agar mediums are added, after mixing It is incubated overnight in 37 DEG C of cylinders of lighting up, observes result.Setting positive serum simultaneously, (rabbit anteserum is immunized in diagnostic serum or whole cell, to phase The sero-group bacterial strain answered has bactericidal action) control, complement control, bacterial growth control.Complement control and bacterial growth control Numerous red point-like petites should occur in each hole.Compared with complement control well, institute's test agent hole clump count reduce 70% and with On be judged to that sterilization is positive, to there is highest titre of the positive serum highest dilution of sterilization as bactericidin, calculate each group sample The geometric mean titer (GMT) of product.GMT≥1:8 be that sterilizing power is positive.

7.1 common meningococcal selections

This experimental selection clinically common 6 plants of typical meningococcus (including fHbp anomalies 1 and fHbp anomalies 2), and the amino between the fHbp and NHBA immune use fHbps and NHBA corresponding with this experiment of this 6 plants of bacterial strains expression is determined Acid sequence homology is as a result as follows：

Antigen

Bacterial strain 1

Bacterial strain 2

Bacterial strain 3

Bacterial strain 4

Bacterial strain 5

Bacterial strain 6

fHbp-1	89%	69%	72%	96%	69%	68%
							fHbp-2	67%	99%	91%	69%	99%	98%
NHBA	85%	86%	68%	99%	96%	69%

7.2 are tried 6 plants of meningococcal sterilizing powers using fHbp-1a/b, fHbp-2a/b, NHBA-a/b and combinations thereof Test

As a result Fig. 6 is seen：To the bacterial strain of fHbp anomalies 1 (bacterial strain 1 and bacterial strain 4), fHbp-1 (fHbp-1a and fHbp-1b), NHBA (NHBA-a and NHBA-b), fHbp-1+fHbp-2+NHBA (fHbp-1a+fHbp-2a+NHBA-a and fHbp-1b+fHbp- 2b+NHBA-b) group is that sterilizing power is positive；FHbp-2 (fHbp-2b) groups are that sterilizing power is positive to bacterial strain 4.

To the bacterial strain of fHbp anomalies 2 (bacterial strain 2, bacterial strain 3, bacterial strain 5 and bacterial strain 6), fHbp-1 groups (fHbp-1a) are to bacterial strain 2 It is positive for sterilizing power；FHbp-2 groups (fHbp-2a and fHbp-2b) are the positive to bacterial strain 2 and bacterial strain 5；NHBA groups (NHBA-a and NHBA-b it is) positive to bacterial strain 2, bacterial strain 3 and bacterial strain 5；FHbp-1+fHbp-2+NHBA (fHbp-1a+fHbp-2a+NHBA-a with And fHbp-1b+fHbp-2b+NHBA-b) group is that sterilizing power is positive to 4 bacterial strains.

As can be seen here, independent fHbp-1, fHbp-2 or NHBA immune group can not be completely covered to 6 bacterial strains, but combination Together, 6 bacterial strains are shown with sterilizing power is positive, in addition to bacterial strain 5, GMT is suitable with independent immune group or higher than individually exempting from Epidemic disease group, it is shown that good complementation and synergy.

Conclusion：FHbp-1, fHbp-2, the NHBA different to two kinds and combinations thereof fHbp-1+fHbp-2+NHBA, plus Freund Adjuvant immunity rabbit anteserum is shown to 6 plants of meningococcal sterilizing power result of the tests (see Fig. 6)：To bacterial strain 1, bacterial strain 2, bacterial strain 4, Bacterial strain 5, fHbp-1 and fHbp-2 albumen shows variation type specificity, and independent fHbp groups have good to identical anomaly bacterial strain Bactericidal action, GMT >=1:8.To bacterial strain 3 and bacterial strain 6, the sterilizing power GMT of fHbp-1 or fHbp-2 inductions is equal<1:8, individually It is immune the formation of the two bacterial strains to be protected；But add after NHBA, even if the individually GMT of NHBA groups<1:8 (such as the institute of bacterial strain 6 Show), 3 kinds of antigen combinations together (i.e. fHbp-1+fHbp-2+NHBA groups) GMT >=1:8 be that sterilizing power is positive.FHbp is usual With variation type specificity, but may also immune protective deficiency to some identical anomaly bacterial strains；Independent fHbp-1, fHbp-2 Or NHBA immune groups can not be completely covered to 6 bacterial strains, but combine, 6 bacterial strains are shown with sterilizing power is positive.

Therefore, when albumen of the present invention is combined, good complementary and synergy can be shown.In addition, experiment is found Although homology and the power of sterilizing power have certain degree of association, three's combination can cover the bacterium of various Different Variation types Strain, the bactericidal effect for having the positive.

The animal passive immune protection of embodiment 8 is tested

It is that fHbp-1 (is designated as fHbp- respectively using the 3rd group of antigen combination albumen (group c) of conventional method Prepare restructuring 1c(SEQ ID NO.:3)), fHbp-2 albumen (is designated as fHbp-2c (SEQ ID NO.:), and NHBA albumen (is designated as 6) NHBA-c(SEQ ID NO.:, and immune rabbit prepares immune serum 9).

Take 7 age in days suckling mouses (NIH mouse), be injected intraperitoneally the restructuring fHbp-1c through 56 DEG C of inactivations in 30 minutes, fHbp-2c, Rabbit anteserum is immunized in NHBA-c, fHbp-1c+fHbp-2c+NHBA-c, after 2-3 hours, and the meninx of 100 μ l fresh cultureds is injected intraperitoneally Scorching coccus bacterium solution (contains bacterial population 10⁵It is individual)；After 3 hours, painstaking effort are adopted, the synthetic medium of 10% sheep blood half is applied, lit up in 37 DEG C in cylinder It is incubated overnight, observes result, calculates per the bacterial population (CFU/ml) in ml blood.Every group of 2-3 suckling mouse, while setting positive control (whole cell immune serum) and negative control (negative serum).Experiment to the bacterial strain of fHbp anomalies 1 and the bacterial strain of fHbp anomalies 2 As a result Fig. 7 is seen.

As a result：To the bacterial strain of fHbp anomalies 1, positive controls bacterial population (CFU) is significantly lower than negative control group, and recombinates FHbp-1c and NHBA-c groups show protective effect more more preferable than positive controls, and the former detects number by Bacteria in Blood< There are 2 Detection of pathogenic bacteria numbers in 10CFU/ml, 3 rabbits of the latter<10CFU/ml；Restructuring fHbp-2c groups have no protective effect.To fHbp The bacterial strain of anomaly 2, positive controls bacterial population<10CFU/ml, hence it is evident that less than negative control group, recombinates fHbp-2c and NHBA-c Group Detection of pathogenic bacteria number is equal<10CFU/ml, it is shown that good protective effect；Restructuring fHbp-1c groups have no protective effect.

As a result show, the immune serum produced by recombinating the variant form of fHbp albumen has protection to identical anomaly bacterial strain Effect, immune serum produced by recombinating the variant form of NHBA albumen has certain cross-protection, and fHbp-1+fHbp-2 + NHBA combinations reach best protection effect.

As can be seen here, the variant form of fHbp albumen and NHBA albumen can also play same protecting effect.

The fHbp gene magnifications of the clinical separation strain of embodiment 9 and sequencing

Following primer is designed, fHbp genes, PCR reaction conditions are expanded in the nucleic acid extracted from N. meningitidis culture It is：95℃5min；95 DEG C of 1min, 56 DEG C of 1min, 72 DEG C of 1min, 30 circulations；72 DEG C of extension 10min.Through 1% Ago-Gel Amplified production, purified rear sequencing is separated by electrophoresis.In Neisseria sequence typing website http://pubmlst.org/ Neisseria/, the sequence to measure is analyzed, and is as a result found, in 50 clinical strains separated from somewhere, can be expanded To fHbp genes, wherein 13 plants belong to anomaly 1,26% is accounted for；36 plants belong to anomaly 2, account for 72%；1 plant belongs to anomaly 3, Account for 2%.

Forward primer：CGGCTAGCATGACTAGGAGCAAACCTGT(SEQ ID NO.:25)

Reverse primer：CGGGATTCGAACGGTAAATTATCGTGTT(SEQ ID NO.:26)

Discuss

In sterilizing power experiment, the antibody of fHbp inductions is relatively low to the possible titre of some identical anomaly bacterial strains, Huo Zhecheng Feminine gender, the reason for possible at least：The fHbp amounts of bacterial strain expression are relatively low, are not enough to trigger bactericidal reaction；Or the bacterial strain table There is the variation in sequence in the fHbp in the fHbp and vaccine that reach, cause cross reaction not enough or do not have.

Because it is found that some bacterial strains do not express fHbp, therefore the other immunogenicities of supplement are strong, cross-protection is wide Antigen constitutes vaccine, and carries out optimum organization, can just obtain more preferably bacterial strain coverage rate.

Although NHBA can be detected in clinical separation strains all so far, the gene order between different strains and Variant amino acid sequence is larger, is not difficult in theory, it is expected that variation, the more low reason of expression quantity due to NHBA, independent NHBA eggs The protective effect that the immune response induced in vain is provided is not enough.

All documents referred in the present invention are all incorporated as reference in this application, independent just as each document It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can To be made various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited Enclose.

Claims (8)

1. a kind of antigen combination, it is characterised in that described antigen combination is by (the factor H of H factor bindins anomaly 1 Binding protein, variant 1, fHbp V1 anomalies albumen), (the factor H of H factor bindins anomaly 2 Binding protein, variant 2, fHbp V2 anomalies albumen) and heparin-binding protein (Neisserial Heparin Binding Antigen, NHBA albumen) constitute, also, how the albumen in the antigen combination is all from meningitis Plucked instrument coccus (Neisseria meningitidis)；

Wherein, described antigen combination is as shown in the fHbp V1 anomalies albumen shown in SEQ ID NO.1, SEQ ID NO.4 FHbp V2 anomalies albumen and the NHBA albumen composition shown in SEQ ID NO.7；Or

Described antigen combination is as the fHbp V1 anomalies albumen shown in SEQ ID NO.2, the fHbp shown in SEQ ID NO.5 V2 anomalies albumen and the NHBA albumen composition shown in SEQ ID NO.8；Or

Described antigen combination is as the fHbp V1 anomalies albumen shown in SEQ ID NO.3, the fHbp shown in SEQ ID NO.6 V2 anomalies albumen and the NHBA albumen composition shown in SEQ ID NO.9.

2. the polynucleotides combination of a kind of separation, it is characterised in that the polynucleotides in described polynucleotides combination are compiled respectively Antigen in antigen combination described in code claim 1.

3. a kind of carrier, it is characterised in that described carrier contains many nucleosides in the polynucleotides combination described in claim 2 Acid.

4. a kind of host cell, it is characterised in that described host cell contains the carrier described in claim 3, or described The polynucleotides combination that the chromosomal integration of host cell is had the right described in requirement 2.

5. a kind of method for obtaining antigen combination described in claim 1, it is characterised in that the host described in culture claim 4 Cell, so as to obtain the antigen combination described in claim 1.

6. the purposes of antigen combination described in claim 1, it is characterised in that for preparing prevention meningococcalmeningitis Vaccine combination.

7. a kind of vaccine combination, it is characterised in that described vaccine combination includes the antigen combination described in claim 1, With acceptable carrier in vaccinology.

8. a kind of method for preparing vaccine combination described in claim 7, it is characterised in that including step：By claim 1 institute The antigen combination stated is mixed with acceptable carrier in vaccinology, so as to obtain the vaccine combination described in claim 7.