CN107349423A - A kind of hitchens and Hansen antigen combination and its application - Google Patents

A kind of hitchens and Hansen antigen combination and its application Download PDF

Info

Publication number
CN107349423A
CN107349423A CN201710443569.9A CN201710443569A CN107349423A CN 107349423 A CN107349423 A CN 107349423A CN 201710443569 A CN201710443569 A CN 201710443569A CN 107349423 A CN107349423 A CN 107349423A
Authority
CN
China
Prior art keywords
gly
fhbp
ala
albumen
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710443569.9A
Other languages
Chinese (zh)
Other versions
CN107349423B (en
Inventor
朱为
吴根鹏
袁萍
黄帼英
王晓
毕慧
荣家康
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Original Assignee
SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD filed Critical SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Priority to CN201710443569.9A priority Critical patent/CN107349423B/en
Publication of CN107349423A publication Critical patent/CN107349423A/en
Application granted granted Critical
Publication of CN107349423B publication Critical patent/CN107349423B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/22—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Neisseriaceae (F)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/095—Neisseria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention provides a kind of new meningococcal antigen combination and its application.Specifically, described antigen combination includes：By fHbp V1 anomalies albumen, fHbp V2 anomalies albumen and NHBA albumen.It is demonstrated experimentally that the vaccine prepared using antigen combination of the present invention there can be obvious cooperative effect, and show good wide spectrum meningococcemia ability.

Description

A kind of hitchens and Hansen antigen combination and its application
It is on June 24th, 2014, Application No. 201410290161.9, entitled " one kind the applying date that the application, which is, The divisional application of the application for a patent for invention of hitchens and Hansen antigen combination and its application ".
Technical field
The present invention relates to vaccines arts, more particularly to meningococcus recombinant protein vaccine component and combinations thereof.
Background technology
Meningitis seriously threatens the health of the mankind, and the annual death in the whole world is estimated to be 170,000, and Neisser Meningococcus is to cause one of three kinds of main pathogenic microbes of meningitis, and uniquely causes epidemic meningitis The pathogenic bacteria of (epidemic meningitis).The average attack rate of global epidemic meningitis is 1-10/10 ten thousand, case fatality rate 10% or so, more than 20% patient's meeting Leave permanent central lesion.
According to the difference of capsular polysaccharide chemical constitution, meningococcus can be divided into 13 sero-groups, main pathogenic flora It is A, B, C, Y and W135 group, more than 95% case can be caused.Such as 29E, X sero-group can also cause a disease for other, but case load compared with It is few, small-scale X group's epidemic meningitis prevalence occurs in Africa recently, China is it has also been found that X group's case.In Europe, America and Oceania etc. Area, the meningitis as caused by B group's bacterial strain are applying the country of C meningococcal polysaccharide combined vaccines, by B group more than 1/3 Case caused by bacterial strain has exceeded 2/3, even up to 90% (Lucidarme J, wait .J Clin Microbiol.2009, and 47 (11):3577-3585.).In China, it is generally recognized that A group and C group are most important pathogenic groups.But in recent years, from patient and In the meningococcal strain separated in Healthy People, B group accounts for 1/3 for the bacterial strain of principal causative group.
For A, C, W135 and Y group, made of capsular polysaccharide and capsular polysaccharide-protein conjugates polysaccharide vaccine and Polysaccharide conjugate vaccine can prevent.And B group's polysaccharide structures have homology with tissue ingredient of human body tissue ingredient, it is impossible to vaccine is made.
At present, only several outer membrane vesicles (OMV) vaccines use in some areas, and the main component of this vaccine is I classes Outer membrane protein PorA.The albumen is meningococcus Subtypes foundation, has variability, therefore OMV vaccines are only capable of using Bacterial strain in prevention with PorA with hypotype.
It is a series of to be located at bacterium surface, induce and kill with the development of genomics, protein science, reverse vaccinology etc. The vaccine candidate albumen of bacteria antibody, which is screened to identify, to be come, and is mainly included：I class 1 outer-membrane proteins PorA, Neisseria adhesin (NadA), H factor bindins (fHbp, other title GNA1870, LP2086, ORF2086, NMB1870, fHBP, have and become Special-shaped V1, V2 and V3), heparin-binding protein (NHBA, other title GNA2132), Neisseria surface protein A (NspA) etc..
Because diversity and variability be present in meningococcus surface protein, often the combination of more antigens can be only achieved compared with Good, wider protecting effect, experimental evidence show that the combination of more antigens can play complementary and synergy.In January, 2013, A kind of B group meningitis coccis vaccine of Novartis companies exploitation is ratified to list by European Union, and its composition is the GNA1870- of restructuring FHbp (anomaly V1) fusion protein, NadA-3, NHBA-GNA2131 fusion protein, and prepared from NZ98/254 bacterial strains OMV (main component PorA1.4).However, interacting with the presence or absence of potency between various antigens in more antigen vaccines And it is potential risks in vaccine preparation process that whether can cause the increase of side effect.
Therefore, diversity and variability based on meningococcus surface protein, how to select suitable albumen to turn into and grind B group meningitis coccis vaccine processed, or even the challenge of universal meningococcus vaccine.Therefore this area has there is an urgent need to develop one kind Effect and B group's vaccine with certain coverage rate.
The content of the invention
The invention provides a kind of unique combination-vaccine suitable for B group meningitis, it can be induced for a variety of meninxes The bactericidin of scorching coccus.
The first aspect of the present invention, there is provided a kind of antigen combination, described antigen combination include：
H factor bindins anomaly 1 (factor H binding protein, variant 1, fHbp V1 anomalies Albumen), (factor H binding protein, variant 2, fHbp the V2 anomaly eggs of H factor bindins anomaly 2 In vain) and heparin-binding protein (Neisserial Heparin Binding Antigen, NHBA albumen).
In another preference, described combination is also included fHbp V1 anomalies albumen, fHbp V2 anomaly albumen Or the derivative egg that the amino acid sequence of NHBA albumen is formed by substitution, deletion or the addition of one or several amino acid respectively White combination, and the combination of described derived protein produces immune response activity to meningococcal B group with activation body Function.
In another preference, described fHbp V1 anomalies albumen, fHbp V2 anomalies albumen and NHBA albumen point Bao Kuo not wild type and saltant type.
In another preference, described fHbp V1 anomalies albumen (such as SEQ ID NO.:1-3) 6-113 bit aminos Homology >=95% of acid sequence.
In another preference, described fHbp V2 anomalies albumen (such as SEQ ID NO.:4-6) 6-145 bit aminos Homology >=95% of acid sequence.
In another preference, described NHBA albumen (such as SEQ ID NO.:7-9) 27-87 amino acids sequence Homology >=85%.
In another preference, in described antigen combination, the sequence such as SEQ ID NO. of fHbp V1 anomaly albumen: Shown in 1-3；And/or
The sequence such as SEQ ID NO. of the fHbp V2 anomaly albumen:Shown in 4-6；And/or
The sequence of the NHBA albumen such as SEQ ID NO.:Shown in 7-9.
In another preference, the albumen in the antigen combination is all from Neisseria meningitidis (Neisseria meningitidis)。
Second aspect of the present invention, there is provided a kind of polynucleotides combination of separation, it is more in the combination of described polynucleotides Nucleotides is separately encoded the antigen in antigen combination described in first aspect present invention.
In another preference, the polynucleotide sequence such as SEQ ID NO. in the combination of described polynucleotides:10-18 institutes Show, be separately encoded SEQ ID NO.:1-9 albumen.
Third aspect present invention, there is provided a kind of carrier, described carrier contain the multinuclear described in second aspect of the present invention Polynucleotides in thuja acid combination.
In another preference, described carrier is expression vector.
In another preference, polynucleotides described in one or more second aspect of the present invention can be contained in described carrier Polynucleotides in combination.
Fourth aspect present invention, there is provided a kind of host cell, described host cell contain third aspect present invention institute The carrier stated, or the chromosomal integration of described host cell have the polynucleotides described in second aspect of the present invention to combine.
Fifth aspect present invention, there is provided a kind of method for obtaining antigen combination described in first aspect present invention, culture is originally Host cell described in invention fourth aspect, so as to obtain the antigen combination described in first aspect present invention.
Sixth aspect present invention, there is provided the purposes of antigen combination described in a kind of first aspect present invention, it is pre- for preparing The vaccine combination of anti-meningococcalmeningitis.
In another preference, described vaccine combination includes the antigen combination described in first aspect present invention, and Acceptable carrier in vaccinology.
In another preference, described antigen combination is also useful as carrier protein and is used to prepare polysaccharide-protein knot Close vaccine.
In another preference, the polysaccharide can come from Neisseria meningitidis inflammation coccus, haemophilus influenzae, pneumonia streptococcus Bacterium, Salmonella typhi, A group streptococcus, B group streptococcus；Polysaccharide may come from capsular polysaccharide, lipopolysaccharides, fat oligosaccharides.
Seventh aspect present invention, there is provided a kind of vaccine combination, described vaccine combination include first party of the present invention Antigen combination described in face, and acceptable carrier in vaccinology.
In another preference, acceptable carrier is helped completely including aluminium adjuvant, MF59, Freund in described vaccinology Agent, incomplete Freund's adjuvant, CpG adjuvants, BCG vaccine ribonucleic acid, Monophosphoryl lipid A.
In another preference, described vaccine combination can be also used for preparing combined vaccine.
In another preference, described combined vaccine also includes A group, C group, Y group or W135 group's vaccine, Hib combination epidemic diseases Seedling, pneumococcal conjugated vaccine, pertussis diph-tet vaccine, typhoid Vi polysaccharide combined vaccine, paratyphoid polysaccharide combination epidemic disease Seedling, form multivalent meningococcal vaccine and/or combined vaccine.
In another preference, described vaccine combination can also include NadA, NspA, FetA.
In another preference, described vaccine combination, fHbp V1 anomalies albumen, fHbp V2 anomalies albumen, Ratio between NHBA albumen is 1：(0.5-2)：(0.5-2), preferably 1:1:1 (based on the weight of active ingredient)
Eighth aspect present invention, there is provided a kind of method for preparing vaccine combination described in seventh aspect present invention, including Step：Antigen combination described in first aspect present invention is mixed with acceptable carrier in vaccinology, so as to obtain the present invention Vaccine combination described in 7th aspect.
In another preference, the antigen in described antigen combination is obtained by genetic recombination or chemical synthesis.
Ninth aspect present invention, there is provided a kind of method for preventing meningococcalmeningitis, to required object Using vaccine combination of the present invention.
In another preference, the object of described needs includes mammal, it is preferred that being people, mouse, rat, rabbit.
It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment) It can be combined with each other between each technical characteristic of body description, so as to form new or preferable technical scheme.As space is limited, exist This no longer tires out one by one states.
Brief description of the drawings
Fig. 1 shows the pcr amplification product electrophoresis pattern of 3 kinds of GFPs such as fHbp-1, fHbp-2 and NHBA.
Fig. 2 shows the double digestion qualification figure of the recombinant plasmid of recombination expression 3 kinds of albumen of fHbp-1, fHbp-2 and NHBA Spectrum.
Fig. 3 shows restructuring fHbp-1, fHbp-2 and NHBA protein SDS-PAGE electrophoresis pattern of purifying.
Fig. 4 shows restructuring fHbp-1, fHbp-2 and NHBA albumen rabbit anteserum its specific antibody determination result.
It is (purple that Fig. 5 shows that the FACS result of the tests that rabbit anteserum is combined with bacterium are immunized in restructuring fHbp-1, fHbp-2 and NHBA The region of color filling is negative control, and unfilled red/blue curve is immune serum testing result).
Fig. 6 show restructuring fHbp-1a/b, fHbp-2a/b, NHBA-a/b, and combinations thereof immune serum bacterium is killed Bacterium power result of the test.
Fig. 7 shows that rabbit anteserum is immunized in restructuring fHbp-1c, fHbp-2c, NHBA-c, fHbp-1c+fHbp-2c+NHBA-c Result in the experiment of suckling mouse passive immune protection.
Embodiment
The present inventor have unexpectedly discovered that, will come from meningococcal by in-depth study extensively first V1, V2 anomaly and NHBA albumen common combinations of fHbp albumen, the antigen of composition can effectively form anti-brain in vivo Meningococcus B group's is immune, and this immune effect is in obvious cooperative effect.In addition, it is demonstrated experimentally that these three albumen are total to Can have a good bacterial strain covering power with the vaccine to be formed is applied in combination, and in view of meningococcus not possess group special Property, vaccine combination of the present invention can also cover A group and C group to a certain extent as in the meningococcus of principal causative group, Therefore, vaccine combination of the present invention can be used as the meningococcemia vaccine of wide spectrum.On this basis, the present invention is completed.
FHbp albumen
FHbp is a kind of film surface lipoprotein, and many meningococcal bacterial strains all carry its gene, it has been found that do not carry The bacterial strain of the gene (Lucidarme J, waits .Clin.Vaccine Immunol.2011,18 (6):1002-1014.).According to The difference of amino acid sequence, the albumen can be divided into 3 kinds of anomalies (V1 anomalies, V2 anomalies and V3 anomalies), wherein V2 Anomaly has certain cross-protection with V3 anomalies, and their cross-protections between V1 anomalies are weak.
Anomaly 1, anomaly 2 and the gene of anomaly 3 are separately encoded 280 or so amino acid residues.Identical anomaly The amino acid identity of fHbp albumen is minimum can be of about 90%, and the amino acid identity between the fHbp albumen of Different Variation type can As little as 62%.
FHbp V1 anomaly albumen available for the present invention is not particularly limited, and can be any wild type or saltant type FHbpV1 anomaly albumen.Preferably, available in the fHbp albumen of antigen combination of the present invention or vaccine combination, fHbp V1 The sequence of anomaly may be selected from SEQ ID NO.:1-3, it may also comprise SEQ ID NO.:1-3 carries out one or several amino acid Addition, the amino acid sequence deleted or substituted, it is highly preferred that can be and wild type fHbp V1 anomalies albumen (such as SEQ ID NO.:1-3 sequences) 6-113 amino acids homologys be maintained at more than 90%, the sequence of preferably more than 95% albumen Row.
FHbp V2 anomaly albumen available for the present invention is not particularly limited, and can be any wild type or saltant type FHbpV2 anomaly albumen.Preferably, available in the fHbp albumen of antigen combination of the present invention or vaccine combination, fHbp V2 The sequence of anomaly may be selected from SEQ ID NO.:4-6, it may also comprise SEQ ID NO.:4-6 carries out one or several amino acid Addition, the amino acid sequence deleted or substituted, it is highly preferred that can be and wild type fHbp V2 anomalies albumen (such as SEQ ID NO.:4-6 sequences) 6-145 amino acids homologys be maintained at more than 90%, the sequence of preferably more than 95% albumen Row.
NHBA albumen
NHBA is a kind of distinctive lipoprotein of neisseria, is almost expressed on all bacterial strains, but NHBA histone aminos Acid sequence has certain variability, therefore can not often cover large-scale bacterial strain for NHBA single vaccine.
The total number of atnino acid of NHBA gene codes about 420-500, between different NHBA albumen, except single or multiple Outside the amino acid variation in site, insertion or the missing of single amino acids or small peptide also be present.The amino acid of different NHBA albumen Homology can as little as 60%.
NHBA available for the present invention is not particularly limited, and can be the NHBA anomaly eggs of any wild type or saltant type In vain.Because the homology of wild type NHBA albumen is relatively low, thus typically with SEQ ID NO.:NHBA albumen homologies shown in 7-9 Property be more than 60%, preferably greater than 70%, more preferably larger than 80% saltant type NHBA can also be used for the antigen combination of the present invention Or vaccine combination.It is highly preferred that can be and wild type NHBA albumen (such as SEQ ID NO.:7-9 sequences) 27-87 positions ammonia Base acid homology is maintained at more than 85%, the sequence of preferably more than 90% albumen.
Antigen combination
Invention also provides a kind of antigen combination containing polyprotein.Wherein, the albumen in described antigen combination Come from meningococcus.
As used herein, term " albumen of the present invention " refers to that albumen one or more in antigen combination of the present invention is total Claim.
As used herein, term " antigen " is to refer to stimulate body to produce (specificity) immune response, and can be with being immunized Response product antibodies and sensitized lymphocyte combine in vitro, and the material of immunological effect (specific reaction) occurs.The base of antigen This characteristic has two kinds, when the ability of induction immune response, that is, immunogenicity, second, occurring instead with the product of immune response Should, that is, antigenicity.
As used herein, term " combination of fHbp V1 anomalies albumen, fHbp V2 anomalies albumen and NHBA albumen ", " antigen combination ", " protein combination of the present invention ", " present invention combination " are used interchangeably, and are referred to albumen of the present invention or its derivative The antigen mixture that albumen three common combination is formed.
As used herein, term " fHbpV1 anomalies ", " fHbp anomalies 1 ", " anomaly 1 " is used interchangeably, and is referred to It is the V1 anomalies of the fHbp albumen of meningococcal B group.Term " fHbpV2 anomalies ", " fHbp anomalies 2 ", " anomaly 2 " are used interchangeably, and refer to the V2 anomalies of the fHbp albumen of meningococcal B group.
In addition, the antigen combination can also be the combination of following Sequence composition：There is activation body to meningitis ball Bacterium B group produces immune response activity, SEQ ID NO：The variant form of sequence shown in 1-9.These variant forms are included (but simultaneously It is not limited to)：The missing, insertion and/or substitution of 1-5 (being usually 1-4, more preferably 1-3, most preferably 1-2) amino acid, And it (is usually within 5, within preferably 3-4, more to add or lack one or several in C-terminal and/or N-terminal It is within 1-2 goodly) amino acid.For example, in the art, when being substituted with similar nature or similar amino acid, lead to Chang Buhui changes the function of protein.Again for example, it is usual in C-terminal and/or N-terminal addition or missing one or several amino acid Also the 26S Proteasome Structure and Function of protein will not be changed.
Present invention additionally comprises the active fragment of described antigen combination, derivative and analog.As used herein, term " fragment ", " derivative ", " derived protein " and " analog " refers to that be kept substantially activation body produces to meningococcal B group The albumen of immune response activity.It is one or several conservative that the fragment of albumen of the present invention, derivative or the like can be that (i) has Or the polypeptide that non-conservative amino acid residue (preferably conservative amino acid) is substituted, or (ii) in one or more amino There is the polypeptide of substituted radical in sour residue, or (iii) albumen of the present invention and another compound (for example extend polypeptide half-life period Compound, such as polyethylene glycol) the formed polypeptide of fusion, or (iv) additional amino acid sequence is blended in this peptide sequence And the polypeptide (derived protein for merging and being formed with sequence labels such as targeting sequencing, secretion sequence or 6His) formed.According to this The teaching of text, these fragments, derivative and analog can be wild type or saltant type, and these belong to this Scope known to skilled practitioner.
A kind of preferable reactive derivative refers to and SEQ ID NO.:1-9 amino acid sequence is compared respectively, there is at most 5, Preferably at most 3-4, more preferably at most 1-2 amino acid are similar or similar amino acid is replaced and is formed more by property Peptide.These conservative variation's polypeptides carry out amino acid substitution preferably based on table 1 and produced.
Table 1
Initial residue Representational substitution Preferable substitution
Ala(A) Val；Leu；Ile Val
Arg(R) Lys；Gln；Asn Lys
Asn(N) Gln；His；Lys；Arg Gln
Asp(D) Glu Glu
Cys(C) Ser Ser
Gln(Q) Asn Asn
Glu(E) Asp Asp
Gly(G) Pro；Ala Ala
His(H) Asn；Gln；Lys；Arg Arg
Ile(I) Leu；Val；Met；Ala；Phe Leu
Leu(L) Ile；Val；Met；Ala；Phe Ile
Lys(K) Arg；Gln；Asn Arg
Met(M) Leu；Phe；Ile Leu
Phe(F) Leu；Val；Ile；Ala；Tyr Leu
Pro(P) Ala Ala
Ser(S) Thr Thr
Thr(T) Ser Ser
Trp(W) Tyr；Phe Tyr
Tyr(Y) Trp；Phe；Thr；Ser Phe
Val(V) Ile；Leu；Met；Phe；Ala Leu
Invention also provides the analog of antigen combination of the present invention.These analogs and the difference of natural antigen combination of the present invention It can be difference on amino acid sequence or do not influence the difference on the modified forms of sequence, or have both at the same time.Class Also include the analog with the residue (such as D- amino acid) different from natural L-amino acids like thing, and there is non-naturally-occurring Or synthesis amino acid (such as β, gamma-amino acid) analog.It should be understood that the polypeptide of the present invention is not limited to above-mentioned enumerate Representational polypeptide.
Polynucleotides
In the present invention, term " polynucleotides ", " coded sequence " are used interchangeably, and refer both to encode albumen of the present invention DNA sequence dna, can be all artificial synthesized, is then stitched together, and forms the DNA sequence dna for encoding albumen of the present invention.Also may be used So that the polynucleotides for encoding albumen of the present invention are carried out into artificial combination respectively, for importing plasmid, and the sheet of restructuring is produced The combination of invention albumen.
As used herein, term " primer " refers to matching with template, in the presence of archaeal dna polymerase can using its as rise Point carries out the general name of the oligonucleotide acid of the synthesis DNA complementary with template.Primer can be natural RNA, DNA, can also It is any type of natural nucleotide.Primer can even is that non-natural nucleotides such as LNA or ZNA etc..
Primer " generally " (or " substantially ") and the special sequence of one on a chain in template are complementary.Primer is necessary It could start to extend with an abundant complementation of chain in template, but the sequence of primer need not be with the sequence complete complementary of template.Than Such as, it is still big at 5 ' ends of one 3 ' the end primer complementary with template plus the preceding paragraph and the not complementary sequence of template, such primer It is complementary with template in cause.As long as there is sufficiently long primer sufficiently to be combined with template, non-fully complementary primer can also be with Template forms primer-template complex, so as to be expanded.
After the DNA sequence dna of the new albumen of the coding present invention is obtained, suitable expression vector is connected into, then be transferred to conjunction Suitable host cell.Finally, the host cell after culture conversion, by isolating and purifying to obtain the albumen of the present invention.
As used herein, term " carrier " includes plasmid, clay, expression vector, cloning vector, viral vector etc..Represent The state of property includes (but being not limited to)：The carrier that can be expressed in eukaryotic such as CHO, COS series eukaryotic, can be The carrier expressed in saccharomyces cerevisiae or pichia yeast, the carrier that can be expressed in the insect cells such as silkworm and prokaryotic expression carry Body.
In the present invention, for example commercially available carrier of various carriers known in the art can be selected.Such as from commercially available load Body, the nucleotide sequence for encoding the new fusion protein of the present invention is then operably coupled to expression regulation sequence, egg can be formed White expression vector.
In the present invention, term " host cell " includes prokaryotic and eukaryotic.Conventional prokaryotic host cell Example includes Escherichia coli, hay bacillus etc..Conventional eukaryotic host cell includes yeast cells, and insect cell and lactation are moved Thing cell.It is preferred that the host cell is eukaryotic, more preferably it is bombyx mori cell.
After the host cell of conversion is obtained, the cell can be cultivated under conditions of expression fusion protein of the present invention is adapted to, So as to give expression to fusion protein.It can separate and purify by various separation methods using its physics, chemical and other characteristic The albumen of restructuring.These methods are well-known to those skilled in the art.The example of these methods includes but is not limited to：It is conventional Renaturation process, handle with protein precipitant (salting-out method), centrifugation, the broken bacterium of infiltration, ultrasonication, ultracentrifugation, molecular sieve Chromatograph (gel filtration), adsorption chromatography, ion-exchange chromatography, high performance liquid chroma- tography (HPLC) and other various liquid chromatography technologies And the combination of these methods.
Pharmaceutical composition and vaccine combination
Present invention also offers the pharmaceutical composition of prevention meningococcus (especially B group), described pharmaceutical composition Can be curative or preventative.A kind of preferable composition is preventative vaccine combination, especially contains and is directed to Meningococcus fHbp V1 anomalies albumen, fHbp V2 anomalies albumen, the vaccine combination of NHBA albumen.
These vaccines include immunising antigen or immunogene, immunogenic polypeptide, albumen or protein fragments or nucleic acid (such as Ribonucleic acid or DNA), generally combined with " pharmaceutically acceptable carrier ", these carriers do not induce including itself Produce any carrier for the antibody being harmful to the individual for receiving said composition.Suitable carrier is typically big, is metabolized slowly Macromolecular, such as protein, polysaccharide, PLA, polyglycolic acid, amino acid polymer, amino acid copolymer, lipid aggregates (such as Oil droplet or liposome) and inactive virion.These carriers are well known to those of ordinary skill in the art.In addition, These carriers can play immunostimulant (" adjuvant ").
The preferable adjuvant of enhancing composition effect includes but is not limited to：(1) aluminium salt (alum), such as aluminium hydroxide, phosphorus Sour aluminium, aluminum sulfate etc.；(2) ISA720 adjuvants；(3) freund adjuvant etc..
Vaccine combination (including antigen, pharmaceutically acceptable carrier and/or adjuvant), usually contains diluent, such as water, Salt solution, glycerine, ethanol etc..In addition, auxiliary substances, such as wetting agent or emulsifying agent, pH buffer substance may be present in this kind of fortune In carrier.In addition, the vaccine combination including immunogenic composition is containing anti-in pharmaceutically acceptable carriers Original, polypeptide, albumen, protein fragments or nucleic acid.
More specifically, the vaccine including immunogenic composition, the immunogenic polypeptide comprising immune effective dose, with And above-mentioned other required components." immune effective dose " refers to gives the amount of individual to treatment or pre- with single dose or a continuous agent part Anti- is effective.The dosage according to the health status and physiological status for treating individual, treat individual classification (such as inhuman spirit Long class etc.), the ability of individual immunity system synthesis antibody, required degree of protection, the preparation of vaccine, treating physician is to medical shape Depending on the assessment of condition and other correlative factors.It is expected that the dosage is by relatively wide scope, can by normal experiment come It is determined that.
A kind of vaccinology approach is DNA vaccination, i.e. the DNA vaccination containing the coded sequence for encoding antigen combination of the present invention.
Method of application
Generally, vaccine combination or immunogenic composition can be made to injectable agent, such as liquid solution or emulsion； It may also be fabricated which and be adapted to supplying solution or suspension, the solid form of liquid excipient before the injection.Said preparation is also emulsifiable or encapsulates In liposome, strengthen adjuvant effect under above-mentioned pharmaceutically acceptable carrier.
Conventional method is to give immunogenic composition from parenteral (subcutaneously or intramuscularly) approach by injection.It is adapted to other Other formulas of administering mode include oral, suppository and transdermal application etc..Therapeutic dose can be single dose regimen or multiple doses. Vaccine can be given together with reference to other immunomodulators.
Beneficial effect of the present invention：
Specific antigen combination can effectively activate body and B group meningitis coccis are exempted from vaccine combination of the present invention Epidemic disease response, so as to which B group be effectively immunized, and this kind combination has obvious cooperative effect.In addition, vaccine group of the present invention Compound goes out certain wide spectrum covering power to clinically different strains expresseds, therefore may be used as the meningococcus epidemic disease of wide spectrum Seedling.
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention Rather than limitation the scope of the present invention.The experimental method of unreceipted actual conditions in the following example, generally according to conventional strip Part, such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition proposed by manufacturer.Unless otherwise indicated, it is no Then percentage and number are percentage by weight and parts by weight.
Embodiment 1 recombinantly expresses the structure of engineering bacteria
Genome is extracted from 3 plants of meningococcus clinical separation strain cultures, is expanded by PCR and speculated without coding respectively The first fHbp (being named as fHbp-1, i.e. anomaly 1), second of fHbp of signal peptide sequence (be named as fHbp-2, that is, become It is special-shaped 2) and NHBA genes.PCR amplification forward primers arrange in the following table with reverse primer, and forward primer and reverse primer draw respectively Enter Nde I and BamH I (fHbp) or Nhe I and BamH I (NHBA) restriction enzyme site, shown with underscore.Weight Group fHbp and NHBA albumen respectively in the form of His-tag is merged in expression in escherichia coli with plasmid pET-28a (Novagen) For expression vector.
FHbp-1 and fHbp-2 clone：Carried out with rTaq archaeal dna polymerases (TaKaRa companies) from bacterial genomes DNA PCR.PCR reaction conditions are：95℃5min；95 DEG C of 1min, 60 DEG C of 1min, 72 DEG C of 1min, 35 circulations；72 DEG C of extension 8min. Amplified production and expression vector pET-28a (Novagen companies) carry out double digestion with Nde I and BamH I, and digestion products are through 1% Agarose gel electrophoresis separates, and reclaims purpose fragment with DNA gel QIAquick Gel Extraction Kit, (Fermentas is public through T4DNA ligases Department) connection, transformed competence colibacillus bacillus coli DH 5 alpha, picking positive colony, the progress double digestion identification of extraction plasmid and sequencing identification. Will identification correct plasmid conversion e. coli bl21 (DE3).
NHBA clone：Enter performing PCR from bacterial genomes DNA with rTaq archaeal dna polymerases (TaKaRa companies).PCR reacts Condition is：95℃5min；95 DEG C of 1min, 58 DEG C of 1min, 72 DEG C of 2min, 35 circulations；72 DEG C of extension 8min.Amplified production and table Double digestion is carried out with Nhe I and BamH I up to carrier pET-28a (Novagen companies), digestion products are through 1% Ago-Gel electricity Swimming separation, purpose fragment is reclaimed with DNA gel QIAquick Gel Extraction Kit, is connected through T4DNA ligases (Fermentas companies), conversion Competence bacillus coli DH 5 alpha, picking positive colony, extraction plasmid carry out double digestion identification and sequencing identification.It will identify correct Plasmid conversion e. coli bl21 (DE3).
FHbp-1 and fHbp-2 and NHBA gene PCR amplified production electrophoresis patterns are shown in Fig. 2, and molecular weight of product size is respectively 760bp, 760bp, 1400bp or so.
Recombinant plasmid double digestion identification collection of illustrative plates is shown in Fig. 3, it is seen that molecular size range is respectively 760bp, 760bp, 1400bp left side Right endonuclease bamhi.
The fermented and cultured of embodiment 2
Recombinate fHbp-1 and fHbp-2 fermented and cultured.By recombinant plasmid transformed BL21 (DE3) competence, on picking flat board Monoclonal bacterium colony, be seeded in the LB fluid nutrient mediums that 5ml contains kanamycins, 37 DEG C of shaken cultivations are stayed overnight, second day turn In the triangular flask for connecing LB fluid nutrient mediums of the 250ml containing kanamycins, 37 DEG C of shaken cultivations to 600nm absorbance values A600It is worth and is 0.6, IPTG to final concentration of 0.6mmol/L is added, continues shaken cultivation 5 hours, 6000rpm is centrifuged 10 minutes, collects thalline.
Recombinate NHBA fermented and cultured.By recombinant plasmid transformed BL21 (DE3) competence, the monoclonal bacterium on picking flat board Fall, be seeded in the LB fluid nutrient mediums that 5ml contains kanamycins, 37 DEG C of shaken cultivations are stayed overnight, and switching 250ml is containing card within second day In the triangular flask of the LB fluid nutrient mediums of that mycin, 37 DEG C of shaken cultivations to 600nm absorbance values A600It is worth for 0.6, adds IPTG To final concentration of 0.1mmol/L, continue shaken cultivation 6 hours, 6000rpm is centrifuged 10 minutes, collects thalline.
The destination protein of embodiment 3 purifies
Thalline liquid is resuspended with nickel column balance buffering liquid to be placed in mixture of ice and water, ultrasonic wave breaks bacterium.After broken bacterium, centrifugation is received Obtain supernatant.Supernatant is through Ni2+Affinity column purifies to obtain crude product, and fHbp-1 and fHbp-2 is through gel permeation chromatography for restructuring It is further purified, restructuring NHBA is further purified through CM ion columns.Restructuring fHbp-1, fHbp-2 and NHBA albumen after purification SDS-PAGE spectrum is shown in Fig. 4.The albumen of purifying be stored in -20 DEG C it is standby.
The animal immune of embodiment 4
Restructuring fHbp-1, fHbp-2, NHBA, fHbp-1+fHbp-2+NHBA that purifying obtains are separately added into Freund assistant Agent, immunizing rabbit, injection dosage be the 200 every kind of albumen of μ g//only.It is immunized three times, is spaced two weeks.First dose is that Freund is helped completely Agent, second dose and the 3rd dose is incomplete Freund's adjuvant.Take a blood sample within two weeks after final immunization, separate serum, it is standby in -20 DEG C of preservations With.Set up non-immune group and vehicle control group simultaneously.
The Specific antibody titre of embodiment 5 determines
Specific IgG titers in immune serum are determined using indirect elisa method, i.e.,：With the restructuring fHbp-1 of purifying, FHbp-2, NHBA distinguish coated elisa plate；After board-washing and closing, the serum to be checked being serially diluted is added, it is small in 37 DEG C of reactions 1 When；Board-washing, the goat anti-rabbit igg enzyme labelled antibody (KPL companies) of horseradish peroxidase-labeled is added, 37 DEG C are reacted 30 minutes； Board-washing, terminating reaction after TMB colour developing 5-10 minutes is added, 450nm light is read on ELIASA (Molecule Device companies) Absorption value A450.Using non-immune group serum as negative control, with negative control sera A4502.1 times of average value are used as cut-off Value, judge that Yin/Yang is reacted.Positive reaction highest dilution is the antibody titer of measuring samples, calculates the several of each group sample What average titer (Geometry mean titer, GMT).
The antibody titre results that rabbit is immunized in restructuring fHbp-1, fHbp-2, NHBA see Fig. 5, and 3 kinds of recombinant proteins can induce rabbit Produce the specific antibody of high titre.
Embodiment 6FACS is tested
The meningococcus bacterium solution of fresh cultured is diluted to 1 × 10 with 10% calf serum-PBS9Individual/ml, by 1:50 Ratio adds restructuring fHbp-1, fHbp-2, NHBA and rabbit anteserum is immunized, and mixes and is incubated 1 hour after 4 DEG C；Thalline is collected by centrifugation, uses 1% calf serum-PBS is washed, and is resuspended；FITC mark donkey anti-rabbit IgG antibodies (Biolegend companies) are added, are mixed after 4 DEG C It is incubated 40 minutes, thalline is collected by centrifugation, ibid washs, thalline is resuspended with PBS, fluidic cell pipe is transferred to, in flow cytometer (BD Company) on detect.If negative serum (vehicle control group) and positive serum (rabbit anteserum is immunized in whole cell) control.
It is meningococcal to fHbp anomalies 1 and anomaly 2 to recombinate the immune rabbit anteserum of fHbp-1, fHbp-2, NHBA FACS result of the tests are shown in Fig. 6.It can be seen that there is positive reaction with the bacterial strain of fHbp anomalies 1 in restructuring fHbp-1 immune serums；Similarly, There is positive reaction with the bacterial strain of fHbp anomalies 2 in restructuring fHbp-2 immune serums；And recombinate fHbp-1 or fHbp-2 immune serums The bacterium bond strength different from fHbp anomalies is weaker or negative；NHBA protein immunization serums are recombinated to 2 bacterial strains The different positive reaction of bond strength is presented.As a result show, restructuring fHbp-1, fHbp-2 and NHBA can induce rabbit to produce specificity Antibody and the surface for being attached to bacterium, fHbp albumen have variation type specificity, and NHBA has preferable cross reaction.
The sterilizing power of embodiment 7 is tested
Other homologous proteins being prepared for respectively using embodiment 1-3 method in antigen combination, wherein first group of (group A) fHbp-1 (being designated as fHbp-1a), fHbp-2 (being designated as fHbp-2a) and NHBA (being designated as NHBA-a) amino acid sequence difference Corresponding SEQ ID NO.:1、SEQ ID NO.:4 and SEQ ID NO.:7；The fHbp-1 (being designated as fHbp-1b) of another group (group b), FHbp-2 (being designated as fHbp-2b) and NHBA (being designated as NHBA-b) amino acid sequence correspond to SEQ ID NO. respectively:2SEQ ID NO.:5SEQ ID NO.:8.Rabbit is immunized using the method for embodiment 4 and prepares immune serum.
With reference to national standard GB 16884-1997, meningococal meningitis diagnostic criteria and treatment principle, Appendix B-epidemic meningitis Serological diagnostic method, B3-sterilizing power test method, carry out the sterilizing power experiment of immune serum antibody.Will through 56 DEG C 30 minutes The serum to be checked of inactivation treatment, is serially diluted in 96 porocyte culture plates, per the μ l of hole 25, the isometric newborn rabbit complement of addition, The meningococcus bacterium solution of fresh cultured, mix and be incubated 1 hour after 37 DEG C；50 μ l TTC agar mediums are added, after mixing It is incubated overnight in 37 DEG C of cylinders of lighting up, observes result.Setting positive serum simultaneously, (rabbit anteserum is immunized in diagnostic serum or whole cell, to phase The sero-group bacterial strain answered has bactericidal action) control, complement control, bacterial growth control.Complement control and bacterial growth control Numerous red point-like petites should occur in each hole.Compared with complement control well, institute's test agent hole clump count reduce 70% and with On be judged to that sterilization is positive, to occur sterilizing highest titre of the positive serum highest dilution as bactericidin, calculate each group sample The geometric mean titer (GMT) of product.GMT≥1:8 be that sterilizing power is positive.
7.1 common meningococcal selections
This experimental selection clinically common 6 plants of typical meningococcus (including fHbp anomalies 1 and fHbp anomalies 2) fHbp and the NHBA immune amino used between fHbp and NHBA corresponding with this experiment in this 6 plants of bacterial strains expression are determined, and Acid sequence homology is as a result as follows：
Antigen Bacterial strain 1 Bacterial strain 2 Bacterial strain 3 Bacterial strain 4 Bacterial strain 5 Bacterial strain 6
fHbp-1 89% 69% 72% 96% 69% 68%
fHbp-2 67% 99% 91% 69% 99% 98%
NHBA 85% 86% 68% 99% 96% 69%
7.2 are tried 6 plants of meningococcal sterilizing powers using fHbp-1a/b, fHbp-2a/b, NHBA-a/b and combinations thereof Test
As a result Fig. 6 is seen：To the bacterial strain of fHbp anomalies 1 (bacterial strain 1 and bacterial strain 4), fHbp-1 (fHbp-1a and fHbp-1b), NHBA (NHBA-a and NHBA-b), fHbp-1+fHbp-2+NHBA (fHbp-1a+fHbp-2a+NHBA-a and fHbp-1b+fHbp- 2b+NHBA-b) group is the sterilizing power positive；FHbp-2 (fHbp-2b) groups are that sterilizing power is positive to bacterial strain 4.
To the bacterial strain of fHbp anomalies 2 (bacterial strain 2, bacterial strain 3, bacterial strain 5 and bacterial strain 6), fHbp-1 groups (fHbp-1a) are to bacterial strain 2 It is positive for sterilizing power；FHbp-2 groups (fHbp-2a and fHbp-2b) are the positive to bacterial strain 2 and bacterial strain 5；NHBA groups (NHBA-a and NHBA-b it is) positive to bacterial strain 2, bacterial strain 3 and bacterial strain 5；FHbp-1+fHbp-2+NHBA (fHbp-1a+fHbp-2a+NHBA-a with And fHbp-1b+fHbp-2b+NHBA-b) group be to 4 bacterial strains sterilizing power the positive.
As can be seen here, independent fHbp-1, fHbp-2 or NHBA immune group can not be completely covered to 6 bacterial strains, but is combined Together, 6 bacterial strains are shown with the sterilizing power positive, in addition to bacterial strain 5, GMT is suitable with independent immune group or higher than individually exempting from Epidemic disease group, it is shown that good complementation and synergy.
Conclusion：FHbp-1, fHbp-2, the NHBA different to two kinds and combinations thereof fHbp-1+fHbp-2+NHBA, add Freund Adjuvant immunity rabbit anteserum is shown to 6 plants of meningococcal sterilizing power result of the tests (see Fig. 6)：To bacterial strain 1, bacterial strain 2, bacterial strain 4, Bacterial strain 5, fHbp-1 and fHbp-2 albumen show variation type specificity, and independent fHbp groups have good to identical anomaly bacterial strain Bactericidal action, GMT >=1:8.To bacterial strain 3 and bacterial strain 6, the sterilizing power GMT of fHbp-1 or fHbp-2 inductions is equal<1:8, individually Immune can not be formed to the two bacterial strains is protected；But after adding NHBA, even if the individually GMT of NHBA groups<1:8 (such as the institute of bacterial strain 6 Show), 3 kinds of antigen combinations together (i.e. fHbp-1+fHbp-2+NHBA groups) GMT >=1:8 be that sterilizing power is positive.FHbp is usual With variation type specificity, but may also immune protective deficiency to some identical anomaly bacterial strains；Independent fHbp-1, fHbp-2 Or NHBA immune groups can not be completely covered to 6 bacterial strains, but combine, 6 bacterial strains are shown with the sterilizing power positive.
Therefore, when albumen of the present invention is combined, good complementation and synergy can be shown.In addition, experiment is found Although homology and the power of sterilizing power have certain degree of association, three is combined the bacterium that can cover various Different Variation types Strain, there is the bactericidal effect of the positive.
The animal passive immune protection of embodiment 8 is tested
It is that fHbp-1 (is designated as fHbp- respectively using the 3rd group of antigen combination albumen (group c) of conventional method Prepare restructuring 1c(SEQ ID NO.:3)), fHbp-2 albumen (is designated as fHbp-2c (SEQ ID NO.:6)), and NHBA albumen (is designated as NHBA-c(SEQ ID NO.:9), and immune rabbit prepares immune serum.
Take 7 age in days suckling mouses (NIH mouse), be injected intraperitoneally through 56 DEG C 30 minutes inactivation restructuring fHbp-1c, fHbp-2c, Rabbit anteserum is immunized in NHBA-c, fHbp-1c+fHbp-2c+NHBA-c, and after 2-3 hours, the meninx of 100 μ l fresh cultureds is injected intraperitoneally Scorching coccus bacterium solution (contains bacterial population 105It is individual)；After 3 hours, painstaking effort are adopted, apply the synthetic medium of 10% sheep blood half, are lit up in 37 DEG C in cylinder It is incubated overnight, observes result, calculates per the bacterial population (CFU/ml) in ml blood.Every group of 2-3 suckling mouse, while set positive control (whole cell immune serum) and negative control (negative serum).Experiment to the bacterial strain of fHbp anomalies 1 and the bacterial strain of fHbp anomalies 2 As a result Fig. 7 is seen.
As a result：To the bacterial strain of fHbp anomalies 1, positive controls bacterial population (CFU) is significantly lower than negative control group, and recombinates FHbp-1c and NHBA-c groups show protective effect more more preferable than positive controls, and the former detects number by Bacteria in Blood< 10CFU/ml, there are 2 Detection of pathogenic bacteria numbers in 3 rabbits of the latter<10CFU/ml；Restructuring fHbp-2c groups have no protective effect.To fHbp The bacterial strain of anomaly 2, positive controls bacterial population<10CFU/ml, hence it is evident that less than negative control group, recombinate fHbp-2c and NHBA-c Group Detection of pathogenic bacteria number is equal<10CFU/ml, it is shown that good protective effect；Restructuring fHbp-1c groups have no protective effect.
As a result show, immune serum caused by the variant form of restructuring fHbp albumen has protection to identical anomaly bacterial strain Effect, immune serum produced by recombinating the variant form of NHBA albumen has certain cross-protection, and fHbp-1+fHbp-2 + NHBA combinations reach best protection effect.
As can be seen here, the variant form of fHbp albumen and NHBA albumen can also play same protecting effect.
The fHbp gene magnifications of the clinical separation strain of embodiment 9 and sequencing
Following primer is designed, fHbp genes, PCR reaction conditions are expanded from the nucleic acid of N. meningitidis culture extraction It is：95℃5min；95 DEG C of 1min, 56 DEG C of 1min, 72 DEG C of 1min, 30 circulations；72 DEG C of extension 10min.Through 1% Ago-Gel Amplified production is separated by electrophoresis, is sequenced after purified.In Neisseria sequence typing website http://pubmlst.org/ Neisseria/, the sequence of measure is analyzed, as a result found, from 50 clinical strains of somewhere separation, can expanded To fHbp genes, wherein 13 plants belong to anomaly 1,26% is accounted for；36 plants belong to anomaly 2, account for 72%；1 plant belongs to anomaly 3, Account for 2%.
Forward primer：CGGCTAGCATGACTAGGAGCAAACCTGT(SEQ ID NO.:25)
Reverse primer：CGGGATTCGAACGGTAAATTATCGTGTT(SEQ ID NO.:26)
Discuss
In sterilizing power experiment, the antibody of fHbp inductions is relatively low to the possible titre of some identical anomaly bacterial strains, Huo Zhecheng Feminine gender, it is possible the reason at least：The fHbp amounts of bacterial strain expression are relatively low, are not enough to trigger bactericidal reaction；Or the bacterial strain table There is the variation in sequence in the fHbp in the fHbp and vaccine that reach, cause cross reaction deficiency or do not have.
Because it is found that some bacterial strains do not express fHbp, therefore supplement that other immunogenicities are strong, cross-protection is wide Antigen forms vaccine, and carries out optimum organization, can just obtain more preferably bacterial strain coverage rate.
Although NHBA can be detected in clinical separation strains all so far, the gene order between different strains and Variant amino acid sequence is larger, is not difficult in theory, it is expected that due to NHBA variation, the more low reason of expression quantity, independent NHBA eggs The protective effect deficiency that the immune response induced in vain provides.
All it is incorporated as referring in this application in all documents that the present invention refers to, it is independent just as each document It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can To be made various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited Enclose.
Sequence table
<110>Shanghai Institute of Biological Products Co., Ltd.
<120>A kind of hitchens and Hansen antigen combination and its application
<130> P2017-0280
<160> 26
<170> PatentIn version 3.5
<210> 1
<211> 255
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 1
Cys Ser Ser Gly Gly Gly Gly Val Ala Ala Asp Ile Gly Ala Val Leu
1 5 10 15
Ala Asp Ala Leu Thr Ala Pro Leu Asp His Lys Asp Lys Ser Leu Gln
20 25 30
Ser Leu Thr Leu Asp Gln Ser Val Arg Lys Asn Glu Lys Leu Lys Leu
35 40 45
Ala Ala Arg Gly Ala Glu Lys Thr Tyr Gly Asn Asp Asp Ser Leu Asn
50 55 60
Thr Gly Lys Leu Lys Asn Asp Lys Val Ser Arg Phe Asp Phe Ile Arg
65 70 75 80
Gln Ile Glu Val Asp Gly Gln Leu Ile Thr Leu Glu Ser Gly Glu Phe
85 90 95
Gln Val Tyr Lys Gln Ser His Ser Ala Leu Thr Ala Leu Gln Thr Glu
100 105 110
Gln Val Gln Asp Ser Glu His Ser Gly Lys Met Val Ala Lys Arg Gln
115 120 125
Phe Arg Ile Gly Asp Ile Ala Gly Glu His Thr Ser Phe Asp Lys Leu
130 135 140
Pro Glu Gly Gly Arg Ala Thr Tyr Arg Gly Thr Ala Phe Gly Ser Asp
145 150 155 160
Asp Ala Ser Gly Lys Leu Thr Tyr Thr Ile Asp Phe Ala Ala Lys Gln
165 170 175
Gly His Gly Lys Ile Glu His Leu Lys Ser Pro Glu Leu Asn Val Asp
180 185 190
Leu Ala Ala Ser Asp Ile Lys Pro Asp Lys Lys Arg His Ala Val Ile
195 200 205
Ser Gly Ser Val Leu Tyr Asn Gln Ala Glu Lys Gly Ser Tyr Ser Leu
210 215 220
Gly Ile Phe Gly Gly Gln Ala Gln Glu Val Ala Gly Ser Ala Glu Val
225 230 235 240
Glu Thr Ala Asn Gly Ile Arg His Ile Gly Leu Ala Ala Lys Gln
245 250 255
<210> 2
<211> 255
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 2
Cys Ser Ser Gly Gly Gly Gly Val Ala Ala Asp Ile Gly Ala Gly Leu
1 5 10 15
Ala Asp Val Leu Thr Ala Pro Leu Asp His Lys Asp Lys Gly Leu Gln
20 25 30
Ser Leu Thr Leu Asp Gln Ser Val Arg Lys Asn Glu Lys Leu Lys Leu
35 40 45
Ala Ala Gln Gly Ala Glu Lys Thr Tyr Gly Asn Gly Asp Ser Leu Asn
50 55 60
Thr Gly Lys Leu Lys Asn Asp Lys Val Ser Arg Phe Asp Phe Ile Arg
65 70 75 80
Gln Ile Glu Val Asp Gly Gln Leu Ile Thr Leu Glu Ser Gly Glu Phe
85 90 95
Gln Val Tyr Lys Gln Ser His Ser Ala Leu Thr Ala Leu Gln Thr Glu
100 105 110
Gln Glu Gln Asp Leu Glu His Ser Arg Lys Met Val Ala Lys Arg Arg
115 120 125
Phe Lys Ile Gly Asp Ile Ala Gly Glu His Thr Ser Phe Asp Lys Leu
130 135 140
Pro Lys Asp Val Met Ala Thr Tyr Arg Gly Thr Ala Phe Gly Ser Asp
145 150 155 160
Asp Ala Gly Gly Lys Leu Thr Tyr Thr Ile Asp Phe Ala Ala Lys Gln
165 170 175
Gly His Gly Lys Ile Glu His Leu Lys Ser Pro Glu Leu Asn Val Asp
180 185 190
Leu Ala Val Ala Tyr Ile Lys Pro Asp Glu Lys His His Ala Val Ile
195 200 205
Ser Gly Ser Val Leu Tyr Asn Gln Asp Glu Lys Gly Ser Tyr Ser Leu
210 215 220
Gly Ile Phe Gly Glu Lys Ala Gln Glu Val Ala Gly Ser Ala Glu Val
225 230 235 240
Lys Thr Ala Asn Gly Ile His His Ile Gly Leu Ala Ala Lys Gln
245 250 255
<210> 3
<211> 255
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 3
Cys Ser Ser Gly Gly Gly Gly Val Ala Ala Asp Ile Gly Ala Gly Leu
1 5 10 15
Ala Asp Ala Leu Thr Ala Pro Leu Asp His Lys Asp Lys Gly Leu Arg
20 25 30
Ser Leu Thr Leu Asp Gln Ser Val Arg Lys Asn Glu Lys Leu Lys Leu
35 40 45
Ala Ala Gln Gly Ala Glu Lys Thr Tyr Gly Asn Gly Asp Ser Leu Asn
50 55 60
Thr Gly Lys Leu Lys Asn Asp Lys Val Ser Arg Phe Asp Phe Ile Arg
65 70 75 80
Gln Ile Glu Val Asp Gly Gln Leu Ile Thr Leu Glu Ser Gly Glu Phe
85 90 95
Gln Val Tyr Lys Gln Ser His Ser Ala Leu Thr Ala Phe Gln Thr Glu
100 105 110
Gln Ile Gln Asp Ser Glu His Ser Gly Lys Met Val Ala Lys Arg Arg
115 120 125
Phe Arg Ile Gly Asp Ile Ala Gly Glu His Thr Ser Phe Asp Lys Leu
130 135 140
Pro Glu Gly Gly Arg Ala Thr Tyr Arg Gly Thr Ala Phe Ser Ser Asp
145 150 155 160
Asp Ala Gly Gly Lys Leu Thr Tyr Thr Ile Asp Phe Ala Ala Lys Gln
165 170 175
Gly Tyr Gly Lys Ile Glu His Leu Lys Ser Pro Glu Leu Asn Val Asp
180 185 190
Leu Val Ser Ala Asp Ile Lys Pro Asp Glu Lys Arg His Ala Val Ile
195 200 205
Ser Gly Ser Val Leu Tyr Asn Gln Asp Glu Lys Gly Ser Tyr Ser Leu
210 215 220
Gly Ile Phe Gly Gly Lys Ala Gln Glu Val Ala Gly Ser Ala Glu Val
225 230 235 240
Lys Thr Val Asn Gly Ile Arg His Ile Gly Leu Ala Ala Lys Gln
245 250 255
<210> 4
<211> 254
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 4
Cys Ser Ser Gly Gly Gly Gly Val Ala Ala Asp Ile Gly Ala Gly Leu
1 5 10 15
Ala Asp Ala Leu Thr Ala Pro Leu Asp His Lys Asp Lys Ser Leu Gln
20 25 30
Ser Leu Thr Leu Asp Gln Ser Val Arg Lys Asn Glu Lys Leu Lys Leu
35 40 45
Ala Ala Gln Gly Ala Glu Lys Thr Tyr Gly Asn Gly Asp Ser Leu Asn
50 55 60
Thr Gly Lys Leu Lys Asn Asp Lys Val Ser Arg Phe Asp Phe Ile Arg
65 70 75 80
Gln Ile Glu Val Asp Gly Gln Leu Ile Thr Leu Glu Ser Gly Glu Phe
85 90 95
Gln Ile Tyr Lys Gln Asp His Ser Ala Val Val Ala Leu Gln Ile Glu
100 105 110
Lys Ile Asn Asn Pro Asp Lys Ile Asp Ser Leu Ile Asn Gln Arg Ser
115 120 125
Phe Leu Val Ser Gly Leu Gly Gly Glu His Thr Ala Phe Asn Gln Leu
130 135 140
Pro Ser Gly Lys Ala Glu Tyr His Gly Lys Ala Phe Ser Ser Asp Asp
145 150 155 160
Pro Asn Gly Arg Leu His Tyr Ser Ile Asp Phe Thr Lys Lys Gln Gly
165 170 175
Tyr Gly Arg Ile Glu His Leu Lys Thr Pro Glu Gln Asn Val Glu Leu
180 185 190
Ala Ser Ala Glu Leu Lys Ala Asp Glu Lys Ser His Ala Val Ile Leu
195 200 205
Gly Asp Thr Arg Tyr Gly Gly Glu Glu Lys Gly Thr Tyr His Leu Ala
210 215 220
Leu Phe Gly Asp Arg Ala Gln Glu Ile Ala Gly Ser Ala Thr Val Lys
225 230 235 240
Ile Arg Glu Lys Val His Glu Ile Gly Ile Ala Gly Lys Gln
245 250
<210> 5
<211> 254
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 5
Cys Ser Ser Gly Gly Gly Gly Val Ala Ala Asp Ile Gly Ala Gly Leu
1 5 10 15
Ala Asp Ala Leu Thr Ala Pro Leu Asp His Lys Asp Lys Gly Leu Gln
20 25 30
Ser Leu Thr Leu Asp Gln Ser Val Arg Lys Asn Glu Lys Leu Lys Leu
35 40 45
Ala Ala Gln Gly Ala Glu Lys Thr Tyr Gly Asn Gly Asp Ser Leu Asn
50 55 60
Thr Gly Lys Leu Lys Asn Asp Lys Val Ser Arg Phe Asp Phe Ile Arg
65 70 75 80
Gln Ile Glu Val Asp Gly Gln Leu Ile Thr Leu Glu Ser Gly Glu Phe
85 90 95
Gln Ile Tyr Lys Gln Asp His Ser Ala Val Val Ala Leu Gln Ile Glu
100 105 110
Lys Ile Asn Asn Pro Asp Lys Ile Asp Ser Leu Ile Asn Gln Arg Ser
115 120 125
Phe Leu Val Ser Gly Leu Gly Gly Glu His Thr Ala Phe Asn Gln Leu
130 135 140
Pro Ser Gly Lys Ala Glu Tyr His Gly Lys Ala Phe Ser Ser Asp Asp
145 150 155 160
Pro Asn Gly Arg Leu His Tyr Ser Ile Asp Phe Thr Lys Lys Gln Gly
165 170 175
Tyr Gly Arg Ile Glu His Leu Lys Thr Pro Glu Gln Asn Val Glu Leu
180 185 190
Ala Ser Ala Glu Leu Lys Ala Asp Glu Lys Ser His Ala Val Ile Leu
195 200 205
Gly Asp Thr Arg Tyr Gly Gly Glu Glu Lys Gly Thr Tyr His Leu Ala
210 215 220
Leu Phe Gly Asp Arg Ala Gln Glu Ile Ala Gly Ser Ala Thr Val Lys
225 230 235 240
Ile Arg Glu Lys Val His Glu Ile Gly Ile Ala Gly Lys Gln
245 250
<210> 6
<211> 254
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 6
Cys Ser Ser Gly Gly Gly Gly Val Ala Ala Asp Ile Gly Ala Gly Leu
1 5 10 15
Ala Asp Ala Leu Thr Ala Pro Leu Asp His Lys Asp Lys Ser Leu Gln
20 25 30
Ser Leu Thr Leu Asp Gln Ser Val Arg Lys Asn Glu Lys Leu Lys Leu
35 40 45
Ala Ala Gln Gly Ala Glu Lys Thr Tyr Gly Asn Gly Asp Ser Leu Asn
50 55 60
Thr Gly Lys Leu Lys Asn Asp Lys Val Ser Arg Phe Asp Phe Ile Arg
65 70 75 80
Gln Ile Glu Val Asp Gly Gln Leu Ile Thr Leu Glu Ser Gly Glu Phe
85 90 95
Gln Ile Tyr Lys Gln Asp His Ser Ala Val Val Ala Leu Gln Ile Glu
100 105 110
Lys Ile Asn Asn Pro Asp Lys Ile Asp Ser Leu Ile Asn Gln Arg Ser
115 120 125
Phe Leu Val Ser Gly Leu Gly Gly Glu His Thr Ala Phe Asn Gln Leu
130 135 140
Pro Asp Gly Lys Ala Glu Tyr His Gly Lys Ala Phe Ser Ser Asp Asp
145 150 155 160
Ala Gly Gly Lys Leu Thr Tyr Thr Ile Asp Phe Ala Ala Lys Gln Gly
165 170 175
His Gly Lys Ile Glu His Leu Lys Thr Pro Glu Gln Asn Val Glu Leu
180 185 190
Ala Ala Ala Glu Leu Lys Ala Asp Glu Lys Ser His Ala Val Ile Leu
195 200 205
Gly Asp Thr Arg Tyr Gly Ser Glu Glu Lys Gly Thr Tyr His Leu Ala
210 215 220
Leu Phe Gly Asp Arg Ala Gln Glu Ile Ala Gly Ser Ala Thr Val Lys
225 230 235 240
Ile Gly Glu Lys Val His Glu Ile Gly Ile Ala Gly Lys Gln
245 250
<210> 7
<211> 467
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 7
Cys Gly Gly Gly Gly Gly Gly Ser Pro Asp Val Lys Ser Ala Asp Thr
1 5 10 15
Pro Ser Lys Pro Ala Ala Pro Val Val Ala Glu Lys Glu Thr Glu Val
20 25 30
Lys Glu Asp Ala Pro Gln Ala Gly Ser Gln Gly Gln Asp Val Pro Ser
35 40 45
Lys Gln Gly Ser Gln Asp Met Ala Ala Val Ser Ala Glu Asn Thr Gly
50 55 60
Asn Gly Gly Ser Ala Thr Thr Asp Lys Pro Lys Asn Glu Asp Glu Gly
65 70 75 80
Pro Gln Asn Asp Met Pro Gln Asn Ala Ala Asp Thr Asp Ser Leu Thr
85 90 95
Pro Asn His Thr Pro Ala Pro Asn Met Pro Thr Gly Asp Met Gly Asn
100 105 110
Gln Ala Pro Asp Ser Gly Glu Ser Ala Gln Pro Ala Asn Gln Pro Asp
115 120 125
Met Ala Asn Ala Ala Asp Gly Ile Gln Gly Asp Asp Pro Ser Val Gly
130 135 140
Glu Asn Ala Gly Asn Thr Ala Asp Gln Ala Glu Asn Gln Ala Glu Asn
145 150 155 160
Asn Gln Val Gly Gly Ser Gln Asn Pro Ala Pro Ser Ser Asn Pro Asn
165 170 175
Ala Thr Asn Gly Gly Asn Phe Gly Arg Val Asp Leu Ala Asn Gly Val
180 185 190
Leu Ile Asp Gly Pro Ser Gln Asn Ile Thr Leu Thr His Cys Lys Ser
195 200 205
Asp Ser Cys Asn Gly Asp Asn Leu Leu Ser Glu Glu Ala Pro Ser Lys
210 215 220
Ser Glu Phe Glu Gln Leu Ser Asp Glu Asp Lys Ile Lys Lys Tyr Lys
225 230 235 240
Lys Asp Gly Glu Lys Phe Thr Gly Leu Val Ala Asp Arg Leu Gln Met
245 250 255
Lys Gly Thr Asn Gln Tyr Ile Ile Phe Tyr Lys Pro Lys Thr Thr Ser
260 265 270
Ser Ala Arg Phe Arg Arg Ser Ala Arg Ser Arg Arg Ser Leu Pro Ala
275 280 285
Glu Met Pro Leu Ile Pro Val Asn Gln Ala Asp Thr Leu Ile Val Asp
290 295 300
Gly Glu Ala Val Ser Leu Thr Gly His Ser Gly Asn Ile Phe Ala Pro
305 310 315 320
Glu Gly Asn Tyr Arg Tyr Leu Thr Tyr Gly Ala Glu Lys Leu Ser Gly
325 330 335
Gly Ser Tyr Ala Leu Ser Val Gln Gly Glu Pro Ala Lys Gly Glu Met
340 345 350
Leu Ala Gly Thr Ala Val Tyr Asn Gly Glu Val Leu His Phe His Met
355 360 365
Glu Asn Gly Arg Pro Ser Pro Ser Gly Gly Arg Phe Ala Ala Lys Val
370 375 380
Asp Phe Gly Ser Lys Ser Val Asp Gly Ile Ile Asp Ser Gly Asp Asp
385 390 395 400
Leu His Met Gly Thr Gln Lys Phe Lys Ala Val Ile Asp Gly Asn Gly
405 410 415
Phe Lys Gly Thr Trp Thr Glu Asn Gly Gly Gly Asp Val Ser Gly Arg
420 425 430
Phe Tyr Gly Pro Ala Gly Glu Glu Val Ala Gly Lys Tyr Ser Tyr Arg
435 440 445
Pro Thr Asp Ala Glu Lys Gly Gly Phe Gly Val Phe Ala Gly Lys Lys
450 455 460
Glu Gln Asp
465
<210> 8
<211> 410
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 8
Cys Gly Gly Gly Gly Gly Gly Ser Pro Asp Val Lys Ser Ala Asp Thr
1 5 10 15
Pro Ser Lys Pro Ala Ala Pro Val Val Ala Glu Lys Glu Thr Glu Val
20 25 30
Lys Glu Asp Ala Pro Gln Ala Gly Ser Gln Gly Gln Asp Val Pro Ser
35 40 45
Lys Gln Gly Ser Gln Asp Met Ala Ala Val Ser Ala Glu Asn Thr Gly
50 55 60
Asn Gly Gly Ser Ala Thr Thr Asp Lys Pro Lys Asn Glu Asp Glu Gly
65 70 75 80
Pro Gln Asn Asp Met Pro Gln Asn Ser Ala Glu Ser Ala Asn Gln Thr
85 90 95
Gly Asn Asn Gln Pro Ala Asp Ser Ser Asp Ser Ala Pro Ala Ser Asn
100 105 110
Pro Ala Pro Ala Asn Gly Gly Ser Asn Phe Gly Arg Val Asp Leu Ala
115 120 125
Asn Gly Val Leu Ile Asp Gly Pro Ser Gln Asn Ile Thr Leu Thr His
130 135 140
Cys Lys Gly Asp Ser Cys Asn Gly Asp Asn Leu Leu Asp Glu Glu Ala
145 150 155 160
Pro Ser Lys Ser Glu Phe Glu Asn Leu Asn Glu Ser Glu Arg Ile Glu
165 170 175
Lys Tyr Lys Lys Asp Gly Lys Ser Asp Lys Phe Thr Asn Leu Val Ala
180 185 190
Thr Ala Val Gln Ala Asn Gly Thr Asn Lys Tyr Val Ile Ile Tyr Lys
195 200 205
Asp Lys Ser Ala Ser Ser Ser Ser Ala Arg Phe Arg Arg Ser Ala Arg
210 215 220
Ser Arg Arg Ser Leu Pro Ala Glu Met Pro Leu Ile Pro Val Asn Gln
225 230 235 240
Ala Asp Thr Leu Ile Val Asp Gly Glu Ala Val Ser Leu Thr Gly His
245 250 255
Ser Gly Asn Ile Phe Ala Pro Glu Gly Asn Tyr Arg Tyr Leu Thr Tyr
260 265 270
Gly Ala Glu Lys Leu Pro Gly Gly Ser Tyr Ala Leu Arg Val Gln Gly
275 280 285
Glu Pro Ala Lys Gly Glu Met Leu Ala Gly Thr Ala Val Tyr Asn Gly
290 295 300
Glu Val Leu His Phe His Thr Glu Asn Gly Arg Pro Tyr Pro Thr Arg
305 310 315 320
Gly Arg Phe Ala Ala Lys Val Asp Phe Gly Ser Lys Ser Val Asp Gly
325 330 335
Ile Ile Asp Ser Gly Asp Asp Leu His Met Gly Thr Gln Lys Phe Lys
340 345 350
Ala Ala Ile Asp Gly Asn Gly Phe Lys Gly Thr Trp Thr Glu Asn Gly
355 360 365
Gly Gly Asp Val Ser Gly Arg Phe Tyr Gly Pro Ala Gly Glu Glu Val
370 375 380
Ala Gly Lys Tyr Ser Tyr Arg Pro Thr Asp Ala Glu Lys Gly Gly Phe
385 390 395 400
Gly Val Phe Ala Gly Lys Lys Glu Gln Asp
405 410
<210> 9
<211> 462
<212> PRT
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 9
Cys Gly Gly Gly Gly Gly Gly Ser Pro Asp Val Lys Ser Ala Asp Thr
1 5 10 15
Pro Ser Lys Pro Ala Ala Pro Val Val Ala Glu Lys Glu Thr Glu Ala
20 25 30
Lys Glu Asp Ala Pro Gln Ala Gly Ser Gln Gly Gln Asp Val Pro Ser
35 40 45
Thr Gln Gly Ser Gln Asp Met Ala Ala Val Ser Ala Glu Asn Thr Gly
50 55 60
Asn Gly Gly Ala Ala Thr Ala Asp Asn Pro Lys Asn Glu Asp Glu Val
65 70 75 80
Ala Gln Asn Asp Met Pro Gln Asn Ala Ala Gly Thr Asp Ser Ser Thr
85 90 95
Pro Asn His Thr Pro Asp Pro Asn Met Leu Ala Gly Asn Met Glu Asn
100 105 110
Gln Ala Thr Asp Ala Gly Glu Ser Ser Gln Pro Ala Asn Gln Pro Asp
115 120 125
Met Ala Asn Ala Ala Asp Gly Met Gln Gly Asp Asp Pro Ser Ala Gly
130 135 140
Arg Gln Asn Ala Gly Asn Thr Ala Ala Gln Gly Ala Asn Gln Ala Gly
145 150 155 160
Asn Asn Gln Ala Ala Gly Ser Ser Asp Pro Ile Pro Ala Ser Asn Pro
165 170 175
Ala Thr Thr Asn Ser Gly Gly Asp Phe Gly Arg Val Asp Leu Ala Asn
180 185 190
Gly Ile Lys Leu Asp Gly Gly Ser Glu Asn Val Thr Leu Thr His Cys
195 200 205
Lys Asp Lys Val Cys Gly Ser Asn Phe Leu Asp Glu Glu Ala Pro Ser
210 215 220
Lys Ser Glu Phe Glu Lys Leu Ser Asp Ala Glu Lys Ile Asn Lys Tyr
225 230 235 240
Lys Lys Asn Gly Gly Lys Phe Thr Gly Leu Val Ala Thr Arg Val Glu
245 250 255
Asn Asn Gly Leu Asn Gln Tyr Thr Ile Ile Tyr Gln Ala Gln Pro Thr
260 265 270
Arg Ser Ala Arg Ser Arg Arg Ser Leu Pro Ala Glu Met Pro Leu Ile
275 280 285
Pro Val Asn Gln Ala Asp Thr Leu Ile Val Asp Gly Glu Ala Val Ser
290 295 300
Leu Thr Gly His Ser Gly Asn Ile Phe Ala Pro Glu Gly Asn Tyr Arg
305 310 315 320
Tyr Leu Thr Tyr Gly Ala Glu Lys Leu Pro Gly Gly Ser Tyr Ala Leu
325 330 335
Ser Val Gln Gly Lys Pro Ala Lys Gly Glu Met Leu Ala Gly Ala Ala
340 345 350
Val Tyr Asn Gly Glu Val Leu His Phe His Thr Glu Asn Gly Arg Pro
355 360 365
Tyr Pro Thr Arg Gly Arg Phe Ala Ala Lys Val Asp Phe Gly Ser Lys
370 375 380
Ser Val Asp Gly Ile Ile Asp Ser Gly Asp Asp Leu His Met Gly Thr
385 390 395 400
Gln Lys Phe Lys Ala Ala Ile Asp Gly Asn Gly Phe Lys Gly Thr Trp
405 410 415
Thr Glu Asn Gly Gly Gly Asp Val Ser Gly Lys Phe Tyr Gly Pro Ala
420 425 430
Gly Glu Glu Val Ala Gly Lys Tyr Ser Tyr Arg Pro Thr Asp Ala Glu
435 440 445
Lys Gly Gly Phe Gly Val Phe Ala Gly Lys Lys Glu Gln Asp
450 455 460
<210> 10
<211> 765
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 10
tgcagcagcg gaggcggcgg tgtcgccgcc gacatcggcg cggtgcttgc cgatgcacta 60
accgcaccgc tcgaccataa agacaaaagt ttgcagtctt tgacgctgga tcagtccgtc 120
aggaaaaacg agaaactgaa gctggcggca caaggtgcgg aaaaaactta tggaaacggc 180
gacagcctca atacgggcaa attgaagaac gacaaggtca gccgcttcga ctttatccgt 240
caaatcgaag tggacgggca gctcattacc ttggagagcg gagagttcca agtgtacaaa 300
caaagccatt ccgccttaac cgcccttcag accgagcaag tacaagattc ggagcattca 360
gggaagatgg ttgcgaaacg ccagttcaga atcggcgata tagcgggtga acatacatct 420
tttgacaagc ttcccgaagg cggcagggcg acatatcgcg ggacggcatt cggttcagac 480
gatgccagtg gaaaactgac ctacaccata gatttcgccg ccaagcaggg acacggcaaa 540
atcgaacatt tgaaatcgcc agaactcaat gttgacctgg ccgcctccga tatcaagccg 600
gataaaaaac gccatgccgt catcagcggt tccgtccttt acaaccaagc cgagaaaggc 660
agttactctc taggcatctt tggcgggcaa gcccaggaag ttgccggcag cgcagaagtg 720
gaaaccgcaa acggcatacg ccatatcggt cttgccgcca agcag 765
<210> 11
<211> 765
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 11
tgcagcagcg gagggggcgg tgtcgccgcc gacatcggtg cggggcttgc cgatgtgcta 60
accgcgccgc tcgaccataa agacaaaggt ttgcagtctt tgacgctgga ccagtccgtc 120
aggaaaaacg agaaactgaa gctggcggca caaggtgcgg aaaaaactta tggaaacggc 180
gacagcctta atacgggcaa attgaagaac gacaaggtca gccgtttcga ctttatccgt 240
caaatcgaag tggacgggca gctcattacc ttggagagcg gagagttcca agtgtacaaa 300
caaagccatt ccgccttaac cgcccttcag accgagcaag aacaagatct agagcattcc 360
aggaagatgg ttgcgaaacg ccggttcaaa atcggcgaca tagcgggcga acatacatct 420
tttgacaagc ttcccaaaga cgtcatggcg acatatcgcg ggacggcgtt cggttcagac 480
gatgccggcg gaaaactgac ctatactata gattttgctg ccaaacaggg acacggcaaa 540
atcgaacatt tgaaatcgcc ggaactcaat gtcgatctgg ccgtcgccta tatcaagccg 600
gatgaaaaac accatgccgt catcagcggt tccgttcttt acaaccaaga cgagaaaggc 660
agttactccc tcggtatctt tggcgaaaaa gcccaggaag ttgccggcag cgcggaagtg 720
aaaaccgcaa acggcataca ccatatcggc cttgccgcga agcaa 765
<210> 12
<211> 765
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 12
tgcagcagcg gagggggcgg tgtcgccgcc gacatcggtg cggggcttgc cgatgcgcta 60
accgcgccgc tcgaccataa agacaaaggt ttgcggtctt tgacgctgga ccagtccgtc 120
aggaaaaacg agaaactgaa gctggcggca caaggtgcgg aaaaaactta tggaaacggc 180
gacagcctca atacgggcaa attgaagaac gacaaggtca gccgtttcga cttcatccgc 240
caaatcgaag tggatgggca gctcattacc ttggagagcg gagagttcca agtgtacaaa 300
caaagccatt ccgccttaac cgcctttcag accgagcaaa tacaagattc ggagcattcc 360
gggaagatgg ttgcgaaacg ccggttcaga atcggcgaca tagcgggcga acatacatct 420
tttgacaagc ttcccgaagg cggcagggcg acatatcgcg ggacggcgtt cagttcagac 480
gatgccggcg gaaaactgac ctacaccata gatttcgccg ccaagcaggg atacggcaaa 540
atcgaacatt tgaaatcgcc ggaactcaat gtcgacctgg tttctgccga tatcaagccg 600
gatgaaaaac gccatgccgt catcagcggc tccgtccttt acaaccaaga cgagaaaggc 660
agttactccc tcggtatctt tggcggaaaa gcccaggaag ttgccggcag cgcggaagtg 720
aaaaccgtaa acggcatacg ccatatcggc cttgccgcca agcaa 765
<210> 13
<211> 762
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 13
tgcagcagcg gaggcggcgg tgtcgccgcc gacatcggcg cggggcttgc cgatgcacta 60
accgcaccgc tcgaccataa agacaaaagt ttgcagtctt tgacgctgga tcagtccgtc 120
aggaaaaacg agaaactgaa gctggcggca caaggtgcgg aaaaaactta tggaaacggc 180
gacagcctca atacgggcaa attgaagaac gacaaggtca gccgcttcga ctttatccgt 240
caaatcgaag tggacgggca gctcattacc ttggagagcg gagagttcca aatatacaaa 300
caggaccact ccgccgtcgt tgccctacag attgaaaaaa tcaacaaccc cgacaaaatc 360
gacagcctga taaaccaacg ctccttcctt gtcagcggtt tgggtggaga acataccgcc 420
ttcaaccaac tgcccagcgg caaagccgag tatcacggca aagcattcag ctccgacgac 480
ccgaacggca ggctgcacta ctccattgat tttaccaaaa aacagggtta cggcagaatc 540
gaacacctga aaacgcccga gcagaatgtc gagcttgcct ccgccgaact caaagcagat 600
gaaaaatcac acgccgtcat tttgggcgac acgcgctacg gcggcgaaga gaaaggcact 660
taccacctcg cccttttcgg cgaccgcgcc caagaaatcg ccggctcggc aaccgtgaag 720
ataagggaaa aggttcacga aatcggcatc gccggcaaac ag 762
<210> 14
<211> 762
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 14
tgcagcagcg gaggcggcgg tgttgccgcc gacatcggcg cggggcttgc cgatgcacta 60
accgcaccgc tcgaccataa agacaaaggt ttgcagtctt tgacgctgga ccagtccgtc 120
aggaaaaacg agaaactgaa gctggcggca caaggtgcgg aaaaaactta tggaaacggc 180
gacagcctca atacgggcaa attgaagaac gacaaggtca gccgcttcga ctttatccgt 240
caaatcgaag tggacgggca gctcattacc ttggagagcg gagagttcca aatatacaaa 300
caggaccact ccgccgtcgt tgccctacag attgaaaaaa tcaacaaccc cgacaaaatc 360
gacagcctga taaaccaacg ctccttcctt gtcagcggtt tgggtggaga acataccgcc 420
ttcaaccaac tgcccagcgg caaagccgag tatcacggca aagcattcag ctccgacgac 480
ccgaacggca ggctgcacta ctccattgat tttaccaaaa aacagggtta cggcagaatc 540
gaacacctga aaacgcccga gcagaatgtc gagcttgcct ccgccgaact caaagcagat 600
gaaaaatcac acgccgtcat tttgggcgac acgcgctacg gcggcgaaga aaaaggcact 660
taccacctcg cccttttcgg cgaccgcgcc caagaaatcg ccggctcggc aaccgtgaag 720
ataagggaaa aggttcacga aatcggcatc gccggcaaac ag 762
<210> 15
<211> 762
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 15
tgcagcagcg gaggcggcgg tgtcgccgcc gacatcggcg cggggcttgc cgatgcacta 60
accgcaccgc tcgaccataa agacaaaagt ttgcagtctt tgacgctgga tcagtccgtc 120
aggaaaaacg agaaactgaa gctggcggca caaggtgcgg aaaaaactta tggaaacggc 180
gacagcctca atacgggcaa attgaagaac gacaaggtca gccgcttcga ctttatccgt 240
caaatcgaag tggacgggca gctcattacc ttggagagcg gagagttcca aatatacaaa 300
caggaccact ccgccgtcgt tgccctacag attgaaaaaa tcaacaaccc cgacaaaatc 360
gacagcctga taaaccaacg ctccttcctt gtcagcggtt tgggcggaga acataccgcc 420
ttcaaccaac tgcctgacgg caaagccgag tatcacggca aagcattcag ctccgacgat 480
gctggcggaa aactgaccta taccatagat ttcgccgcca aacagggaca cggcaaaatc 540
gaacacctga aaacacccga gcaaaatgtc gagcttgccg ccgccgaact caaagcagat 600
gaaaaatcac acgccgtcat tttgggcgac acgcgctacg gcagcgaaga aaaaggcact 660
taccacctcg cccttttcgg cgaccgcgcc caagaaatcg ccggctcggc aaccgtgaag 720
ataggggaaa aggttcacga aatcggcatc gccggcaaac ag 762
<210> 16
<211> 1401
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 16
tgcgggggcg gcggtggcgg atcgcccgat gttaaatcgg cggacacgcc gtcaaaaccg 60
gccgctcctg ttgttgctga aaaagagaca gaggtaaaag aagatgcgcc acaggcaggt 120
tctcaaggac aggacgtgcc atccaaacaa ggcagtcaag atatggcggc agtttcggca 180
gaaaatacag gcaatggcgg ttcggcaaca acggacaaac ccaaaaatga agacgaggga 240
ccgcaaaatg atatgccgca aaatgccgcc gatacagata gtttgacacc gaatcacacc 300
ccggcaccga atatgccaac cggagatatg ggaaaccaag caccggattc cggggaatcg 360
gcacaaccgg caaaccaacc ggatatggca aatgcggcgg acggaataca gggggacgat 420
ccgtcggtag gggaaaatgc cggcaatacg gcagatcaag ctgaaaatca agccgaaaac 480
aatcaagtcg gcggctctca aaatcctgcc ccttcaagca atcctaatgc cacgaatggt 540
ggcaattttg gaagggttga tttggctaac ggtgttttaa ttgacggacc gtcgcaaaat 600
ataacgttga cccattgtaa aagcgattct tgtaatggtg ataatctatt aagcgaagaa 660
gcaccgtcaa aatcagaatt tgaacaatta agtgatgaag acaaaattaa gaaatataaa 720
aaagatggag aaaagtttac cggtttggtt gctgataggt tacagatgaa aggaaccaat 780
caatatatta ttttttacaa acctaaaacc acttcatctg cgcgattcag gcgttctgca 840
cggtcgaggc ggtcgcttcc ggccgagatg ccgctgattc ccgtcaatca ggcggatacg 900
ctgattgtcg atggggaagc ggtcagcctg acggggcatt ccggcaatat cttcgcgccc 960
gaagggaatt accggtatct gacttacggg gcggaaaaat tgtccggcgg atcgtatgcc 1020
ctcagtgtgc aaggcgaacc ggcaaaaggc gaaatgcttg cgggcacggc cgtgtacaac 1080
ggcgaagtgc tgcatttcca tatggaaaac ggccgtccgt ccccgtccgg aggcaggttt 1140
gccgcaaaag tcgatttcgg cagcaaatct gtggacggca ttatcgacag cggcgatgat 1200
ttgcatatgg gtacgcaaaa attcaaagcc gttatcgatg gaaacggctt taaggggact 1260
tggacggaga atggcggcgg ggatgtttcc ggaaggtttt acggcccggc cggcgaagaa 1320
gtggcgggaa aatacagcta tcgcccgaca gatgcggaaa agggcggatt cggcgtgttt 1380
gccggcaaaa aagagcagga t 1401
<210> 17
<211> 1230
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 17
tgcgggggcg gcggtggcgg atcgcccgat gttaaatcgg cggacacgcc gtcaaaaccg 60
gccgctcctg ttgttgctga aaaagagaca gaggtaaaag aagatgcgcc acaggcaggt 120
tctcaaggac aggacgtgcc atccaaacaa ggcagtcaag atatggcggc agtttcggca 180
gaaaatacag gcaatggcgg ttcggcaaca acggacaaac ccaaaaatga agacgaggga 240
ccgcaaaatg atatgccgca aaattccgcc gaatccgcaa atcaaacagg gaacaaccaa 300
cccgccgatt cttcagattc cgcccccgcg tcaaaccctg cacctgcgaa tggcggtagc 360
aattttggaa gggttgattt ggctaatggc gttttgattg atgggccgtc gcaaaatata 420
acgttgaccc actgtaaagg cgattcttgt aatggtgata atttattgga tgaagaagca 480
ccgtcaaaat cagaatttga aaatttaaat gagtctgaac gaattgagaa atataagaaa 540
gatgggaaaa gcgataaatt tactaatttg gttgcgacag cagttcaagc taatggaact 600
aacaaatatg tcatcattta taaagacaag tccgcttcat cttcatctgc gcgattcagg 660
cgttctgcac ggtcgaggag gtcgcttcct gccgagatgc cgctaatccc cgtcaatcag 720
gcggatacgc tgattgtcga tggggaagcg gtcagcctga cggggcattc cggcaatatc 780
ttcgcgcccg aagggaatta ccggtatctg acttacgggg cggaaaaatt gcccggcgga 840
tcgtatgccc tccgtgtgca aggcgaaccg gcaaaaggcg aaatgcttgc tggcacggcc 900
gtgtacaacg gcgaagtgct gcattttcat acggaaaacg gccgtccgta cccgactaga 960
ggcaggtttg ccgcaaaagt cgatttcggg agcaaatctg tggacggcat tatcgacagc 1020
ggcgatgatt tgcatatggg tacgcaaaaa ttcaaagccg ccatcgatgg aaacggcttt 1080
aaggggactt ggacggaaaa tggcggcggg gatgtttccg gaaggtttta cggcccggcc 1140
ggcgaggaag tggcgggaaa atacagctat cgcccgacag atgcggaaaa gggcggattc 1200
ggcgtgtttg ccggcaaaaa agagcaggat 1230
<210> 18
<211> 1386
<212> DNA
<213>Neisseria meningitidis (Neisseria meningitidis)
<400> 18
tgcgggggcg gcggtggcgg atcgcccgat gtcaagtcgg cggacacccc gtcaaaaccg 60
gccgctcctg ttgttgctga aaaagagaca gaggcaaaag aagatgcgcc acaggcaggt 120
tctcaaggac aggacgtgcc atccacacaa ggcagccaag atatggcggc agtttcggca 180
gaaaatacag gcaatggcgg tgcggcaaca gcggataatc ccaaaaatga agacgaggtg 240
gcacaaaatg atatgccgca aaatgccgcc ggtacagata gttcgacacc gaatcacacc 300
ccggatccga atatgcttgc cggaaatatg gaaaatcaag caacggatgc cggggaatcg 360
tctcagccgg caaaccaacc ggatatggca aatgcggcgg acggaatgca gggggacgat 420
ccgtcggcag gcaggcaaaa tgccggcaat acggctgccc aaggtgcaaa tcaagccgga 480
aacaatcaag ccgccggttc ttcagatccc atccccgcgt caaaccctgc cactacgaat 540
agcggcggcg attttggaag ggttgatttg gctaatggca tcaagcttga cggcggttcg 600
gaaaatgtaa cgttaaccca ttgtaaagac aaagtatgcg gtagcaattt cttagatgaa 660
gaagcaccgt caaaatcaga atttgaaaaa ttaagtgatg cggaaaaaat taataaatat 720
aaaaaaaatg gaggaaagtt tactggtttg gttgctacaa gagttgaaaa taacggattg 780
aatcaatata ccattattta tcaagctcaa cccactcgtt ctgcacggtc gaggaggtcg 840
cttcctgccg agatgccgct aatccccgtc aatcaggcgg atacgctgat tgtcgatggg 900
gaggcggtca gcctgacggg gcattccggc aatatcttcg cgcccgaagg aaattaccgg 960
tatctgactt acggggcgga aaaattgccc ggcggatcgt atgccctcag tgtgcaaggc 1020
aaaccggcaa aaggtgaaat gcttgcgggc gcggccgtgt acaacggcga agtgctgcat 1080
ttccatacgg aaaacggccg tccgtacccg accaggggca ggtttgccgc aaaagtcgat 1140
ttcggcagca aatctgtgga cggcattatc gacagcggcg atgatttgca tatgggtacg 1200
caaaaattca aagccgccat cgatggaaac ggctttaagg ggacttggac ggaaaatggc 1260
ggcggggatg tttccggaaa gttttacggc ccggccggcg aggaagtggc gggaaaatac 1320
agctatcgcc caacagatgc ggaaaagggc ggattcggcg tgtttgccgg caaaaaagag 1380
caggat 1386
<210> 19
<211> 28
<212> DNA
<213>Artificial sequence
<400> 19
gggtttcata tgtgcagcag cggaggcg 28
<210> 20
<211> 32
<212> DNA
<213>Artificial sequence
<400> 20
cgggatcctt actgcttggc ggcaagaccg at 32
<210> 21
<211> 30
<212> DNA
<213>Artificial sequence
<400> 21
gggtttcata tgtgcagcag cggaggcggc 30
<210> 22
<211> 32
<212> DNA
<213>Artificial sequence
<400> 22
cgggatccct actgtttgcc ggcgatgccg at 32
<210> 23
<211> 32
<212> DNA
<213>Artificial sequence
<400> 23
gcgctagctg tgggggcggc ggtggcggat cg 32
<210> 24
<211> 31
<212> DNA
<213>Artificial sequence
<400> 24
gcggatcctt aatcctgctc ttttttgccg g 31
<210> 25
<211> 28
<212> DNA
<213>Artificial sequence
<400> 25
cggctagcat gactaggagc aaacctgt 28
<210> 26
<211> 28
<212> DNA
<213>Artificial sequence
<400> 26
cgggattcga acggtaaatt atcgtgtt 28

Claims (10)

1. a kind of vaccine combination, it is characterised in that described vaccine combination includes：
A kind of antigen combination described in antigen combination includes：
(factor H binding protein, variant 1, fHbp the V1 anomaly eggs of H factor bindins anomaly 1 In vain), (factor H binding protein, variant 2, fHbp the V2 anomaly eggs of H factor bindins anomaly 2 In vain) and heparin-binding protein (Neisserial Heparin Binding Antigen, NHBA albumen)；
With, acceptable carrier in vaccinology, wherein, acceptable carrier includes aluminium adjuvant, MF59, not in described vaccinology Family name's Freund's complete adjuvant, incomplete Freund's adjuvant, CpG adjuvants, BCG vaccine ribonucleic acid or Monophosphoryl lipid A.
2. vaccine combination as claimed in claim 1, it is characterised in that in described antigen combination, fHbp V1 anomaly eggs White sequence such as SEQ ID NO.:Shown in 1-3；And/or
The sequence such as SEQ ID NO. of the fHbp V2 anomaly albumen:Shown in 4-6；And/or
The sequence of the NHBA albumen such as SEQ ID NO.:Shown in 7-9.
3. vaccine combination as claimed in claim 1, it is characterised in that the albumen in the antigen combination is all from meningitis Neisser's coccus (Neisseria meningitidis).
4. vaccine combination as claimed in claim 1, it is characterised in that described antigen combination is as shown in SEQ ID NO.1 FHbp V1 anomalies albumen, shown in fHbp V2 anomalies albumen and SEQ ID NO.7 shown in SEQ ID NO.4 NHBA albumen forms.
5. vaccine combination as claimed in claim 1, it is characterised in that described antigen combination is as shown in SEQ ID NO.2 FHbp V1 anomalies albumen, shown in fHbp V2 anomalies albumen and SEQ ID NO.8 shown in SEQ ID NO.5 NHBA albumen forms.
6. vaccine combination as claimed in claim 1, it is characterised in that described antigen combination is as shown in SEQ ID NO.3 FHbp V1 anomalies albumen, shown in fHbp V2 anomalies albumen and SEQ ID NO.9 shown in SEQ ID NO.6 NHBA albumen forms.
7. vaccine combination as claimed in claim 1, it is characterised in that described vaccine combination can be also used for preparing connection Close vaccine.
8. vaccine combination as claimed in claim 1, it is characterised in that described combined vaccine also includes A group, C group, Y group Or W135 group's vaccine, Hib combined vaccines, pneumococcal conjugated vaccine, pertussis diph-tet vaccine, typhoid Vi polysaccharide combine Vaccine, paratyphoid polysaccharide conjugate vaccine, form multivalent meningococcal vaccine and/or combined vaccine.
9. vaccine combination as claimed in claim 1, it is characterised in that described vaccine combination can also include NadA, NspA、FetA。
10. vaccine combination as claimed in claim 1, it is characterised in that described vaccine combination, fHbp V1 anomalies Ratio between albumen, fHbp V2 anomalies albumen, NHBA albumen is 1：(0.5-2)：(0.5-2), preferably 1:1:1 (by having Imitate the weight meter of composition).
CN201710443569.9A 2014-06-24 2014-06-24 Meningococcal antigen combination and application thereof Active CN107349423B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710443569.9A CN107349423B (en) 2014-06-24 2014-06-24 Meningococcal antigen combination and application thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201410290161.9A CN104072590B (en) 2014-06-24 2014-06-24 A kind of hitchens and Hansen antigen combination and its application
CN201710443569.9A CN107349423B (en) 2014-06-24 2014-06-24 Meningococcal antigen combination and application thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201410290161.9A Division CN104072590B (en) 2014-06-24 2014-06-24 A kind of hitchens and Hansen antigen combination and its application

Publications (2)

Publication Number Publication Date
CN107349423A true CN107349423A (en) 2017-11-17
CN107349423B CN107349423B (en) 2021-03-19

Family

ID=51594228

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201410290161.9A Active CN104072590B (en) 2014-06-24 2014-06-24 A kind of hitchens and Hansen antigen combination and its application
CN201710443569.9A Active CN107349423B (en) 2014-06-24 2014-06-24 Meningococcal antigen combination and application thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201410290161.9A Active CN104072590B (en) 2014-06-24 2014-06-24 A kind of hitchens and Hansen antigen combination and its application

Country Status (1)

Country Link
CN (2) CN104072590B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110859954A (en) * 2019-11-08 2020-03-06 苏州微超生物科技有限公司 Composition containing group B meningococcus fHBP antigen and preparation method and application thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106715464B (en) 2014-07-23 2021-03-16 奥克兰儿童医院及研究中心 Factor H binding protein variants and methods of use thereof
CN104888209B (en) * 2015-05-13 2017-10-20 北京民海生物科技有限公司 A kind of B groups of epidemic meningitises coccus recombinant protein vaccine and preparation method thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013186753A1 (en) * 2012-06-14 2013-12-19 Novartis Ag Vaccines for serogroup x meningococcus

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013186753A1 (en) * 2012-06-14 2013-12-19 Novartis Ag Vaccines for serogroup x meningococcus

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
CASTINEIRAS,T.T.M.P. ET AL.: "heparin binding antigen [Neisseria meningitidis]. ACCESSION AHH9", 《GENBANK》 *
LUCIDARME,J.: "factor H-binding protein [Neisseria meningitidis]. ACCESSION ACT66705", 《GENBANK》 *
LUCIDARME,J.: "factor H-binding protein, partial [Neisseria meningitidis]. ACCESSION ADB89976", 《GENBANK》 *
LUCIDARME,J.: "Gna2132 [Neisseria meningitidis]. ACCESSION AFF59567", 《GENBANK》 *
MURPHY,E. ET AL.: "factor H binding protein variant B52_001, partial [Neisseria meningitidis].ACCESSION ACI46777", 《GENBANK》 *
REFSEQ.: "factor H binding protein [Neisseria meningitidis]. ACCESSION WP_002226719", 《GENBANK》 *
REFSEQ.: "lipoprotein [Neisseria meningitidis]. ACCESSION WP_011798776", 《GENBANK》 *
REFSEQ.: "membrane protein [Neisseria meningitidis]. ACCESSION WP_002233268", 《GENBANK》 *
SERRUTO DAVIDE ET AL.: "The new multicomponent vaccine against meningococcal serogroup B, 4CMenB: immunological, functional and structural characterization of the antigens", 《VACCINE》 *
ZLOTNICK,G.W. ET AL.: "Sequence 176 from patent US 7785608. ACCESSION ADS31551", 《GENBANK》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110859954A (en) * 2019-11-08 2020-03-06 苏州微超生物科技有限公司 Composition containing group B meningococcus fHBP antigen and preparation method and application thereof
CN110859954B (en) * 2019-11-08 2023-10-13 苏州聚微生物科技有限公司 Composition containing B-group meningococcal fHBP antigen, and preparation method and application thereof

Also Published As

Publication number Publication date
CN104072590A (en) 2014-10-01
CN104072590B (en) 2017-08-25
CN107349423B (en) 2021-03-19

Similar Documents

Publication Publication Date Title
CN103118701B (en) OSPA chimeras and its purposes in vaccine
EP2248822B1 (en) Meningococcus adhesins
US11208439B2 (en) Mutant fragments of OspA and methods and uses relating thereto
ES2322213T3 (en) NAP PROTEIN OF HELICOBACTER PYLORI.
CN107056901A (en) Diplococcus meningitidis composition and its method
CN101955545B (en) Multi-target recombination gene and application of protein thereof in preventing and treating infection of helicobacter pylori
CN101495636B (en) DNA vaccine for koi herpes virus (KHV) disease
CN102276730B (en) Preparation method for staphylococcus aureus Iron-regulated surface determinant B immunodominant fragment (IsdBid)-target of RNAIII activating protein (TRAP) fusion protein and application thereof
CN102037135A (en) Compositions and methods of enhancing immune responses to flagellated bacterium
CN116802307A (en) African Swine Fever (ASF) virus vaccine
CN112979826B (en) Encephalitis B virus nanoparticle vaccine and preparation method and application thereof
CN109456393A (en) Application of the Streptococcus pneumoniae protein in anti-streptococcus pneumoniae infection
CN104072590B (en) A kind of hitchens and Hansen antigen combination and its application
CN108126190A (en) The preparation and application of mycobacteriophage lyases Lysin-Guo1
CN107823638B (en) Group B meningococcus recombinant chimeric protein vaccine and preparation method thereof
CN1748791B (en) Haemorrhagic E, coli 0157:H7 vaccine for human and livestock prevention and preparing method
Lo et al. Characterization of two lipoproteins in Pasteurella multocida
CN103127498A (en) Recombination antigen composition, vaccine and carrier and method for preparing antigen composition
CN101177684B (en) Sheep brucella M5 strain ribosome protein L7/L12 gene, encoding protein and uses thereof
CN108503696A (en) A kind of zika virus subunit vaccine of yeast cell to express
CN107970444A (en) Composite adjuvant and the vaccine containing the composite adjuvant
CN104508120A (en) Recombinant mycobacterium encoding heparin-binding hemagglutinin (hbha) fusion protein and uses thereof
TW201236693A (en) Method of inducing antibody in birds by the OmpA of Riemerella anatipestifer and the Riemerella anatipestifer vaccine
CN110041437A (en) A kind of nontoxicity tetanus toxin and clostridium novyi alpha toxin recombination fusion protein
CN115819625B (en) Escherichia coli tetravalent antigen fusion polypeptide

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant