CN103060290A

CN103060290A - Alkaline xylanase, its coding gene and application

Info

Publication number: CN103060290A
Application number: CN2011103171215A
Authority: CN
Inventors: 马延和; 柏文琴; 薛燕芬
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2011-10-18
Filing date: 2011-10-18
Publication date: 2013-04-24
Anticipated expiration: 2031-10-18
Also published as: CN103060290B

Abstract

The invention discloses an alkaline xylanase, its coding gene and application. The protein is the protein shown in (a) or (b) as the following: (a) a protein composed of the amino acid sequence shown by sequence 2 in a sequence table; and (b) an (a)-derived protein that is formed by subjecting an amino acid residual sequence of sequence 2 in the sequence table to substitution and/or deletion and/or adding by one or several amino acid residues and has an endoglucanase function. The experimental results of the invention show that the xylanase Bcxyl11A involved in the invention has very high enzymatic specific activity, and is a bacterium-originated xylanase with the highest specific activity at present. With good thermal stability, the xylanase is in favor of industrial production, and has strong stress resistance and stability under a high salinity condition. Therefore, the xylanase Bcxyl11A has good application prospects in pulp bleaching, biological degumming and detergent production.

Description

A kind of alkalescent xylanase and encoding gene thereof and application

Technical field

The present invention relates to biological technical field, relate in particular to a kind of alkalescent xylanase and encoding gene thereof and application.

Background technology

Xylan is a kind of poly five-carbon sugar, and main component is the D-wood sugar, is the important component part of plant hemicellulose, and it accounts for 1/3 of plant carbohydrates total amount, is the regeneration biological resource that content second enriches after Mierocrystalline cellulose at occurring in nature.The complex structure of xylan, main chain is connected into through β-Isosorbide-5-Nitrae-glycosidic link by β-D-xylopyranose residue, and the xylan of different sources has different side substitution groups.(endo-β-Isosorbide-5-Nitrae-D-xylanase) [EC 3.2.1.8] is called for short zytase to inscribe-β-Isosorbide-5-Nitrae-D-zytase, is responsible for the degraded of xylan backbone skeleton, is the enzyme of most critical in the xylanolytic enzyme system.Aminoacid sequence according to the glycoside hydrolase catalysis region forms and hydrophobicity analysis, glycoside hydrolases can be divided into different families, and the zytase of finding at present mainly belongs to F/10 and G/11 family.

Zytase has important potential using value, is widely used in the industries such as food, feed, pulping and paper-making, biological degumming.Zytase has huge application potential, but be applied in different fields the character of zytase is had different requirements.In general, optimum temperature has determined the application of enzymes field, and can thermostability then suitability for industrialized production have much relations with enzyme.Need the condition of high temperature and alkalescence such as papermaking, the paper pulp substrate needs thermophilic alkali enzyme could effectively carry out bio-bleaching.Alkalescent xylanase also is applied in biological degumming and the washing composition production.Add zytase before the feed granulation and mainly under 70～95 ℃, carry out, so the zytase of Heat stability is good may be used on the production of animal-feed.In addition, feeding enzyme must be about 40 ℃ in temperature, and pH is about the activity that has height under 4.8 the condition, to adapt to the environment of animal digestive tract.Starch adhesive group is usually in the condition modulated that is lower than 35 ℃, and therefore, enzyme is lived and very high had a liking for cold zytase and be used at present in low temperature or the middle temperature course of processing particularly grocery trade under the condition of low temperature or middle temperature.

Owing to needing enzyme of different nature in the different industrial production, therefore, studying the new zytase with advantageous property and be significant.

Summary of the invention

An object of the present invention is to provide a kind of albumen.

Albumen provided by the invention, but synthetic are following (a) or (b) or protein (c):

(a) protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 2;

(b) protein of holding the aminoacid sequence shown in the 28-366 to form by sequence 2 from N;

(c) with the amino acid residue sequence of sequence in the sequence table 2 through replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and have the zytase function by (a) or (b) derivative protein.

Wherein sequence 2 is comprised of 366 amino acid in the sequence table, and molecular weight is 37kDa approximately.

The encoding gene of described albumen (zytase) specifically can be following 1)-3) in arbitrary described dna molecular:

1) dna molecular shown in the sequence in the sequence table 1;

2) can be with 1 under stringent condition) dna molecular with the described albumen of zytase function of the dna sequence dna hybridization that limits and coding;

3) with 1) dna sequence dna that limits has the dna molecular that homology more than 90% and coding have the described albumen of zytase function.

Sequence 1 in the sequence table is by 1101 based compositions, and its open reading frame (ORF) is from 5 ' terminal 1-1101 bit base, and encoding amino acid sequence is the albumen of sequence 2 in the sequence table.

Above-mentioned stringent condition can be 0.1 * SSPE (or in the solution of 0.1 * SSC), 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

The recombinant vectors, expression cassette, transgenic cell line and the recombinant bacterium that contain above-mentioned protein coding gene also belong to protection scope of the present invention.

The recombinant vectors pET28a-Bcxyl11A that the encoding gene of the described albumen of insertion obtains between the BamH I that described recombinant vectors is specially at pET28a and Xho I site.

Described recombinant bacterium specifically can be in e. coli bl21 (DE3), BL21-Gold (DE3), BL21-Gold (DE3) pLysS or BL21-CodonPlus (DE3)-RIPL and to import the recombinant bacterium that the recombinant vectors that contains above-mentioned Xylanase coding gene obtains.

The primer pair of above-mentioned endo-xylanase encoding gene total length or its arbitrary fragment of increasing also belongs to protection scope of the present invention; the nucleotides sequence of a primer of described primer pair is classified the sequence 3 in the sequence table as, and the nucleotides sequence of another primer in the described primer pair is classified the sequence 4 in the sequence table as.

Second purpose of the present invention provides a kind of method for preparing zytase.

The method for preparing zytase provided by the present invention is the described recombinant bacterium of fermentation culture, namely obtains zytase.

Described culture temperature is 37 ℃, and the time of described cultivation is 6h.

Of the present invention experimental results show that, the present invention is separated to basophilic bacterium Bacillus cellulosilyticus SN5 from tin alliance alkali lake, by making up the bacterium genomic library, obtain Xylanase coding gene, and it is changed in the e. coli bl21 (DE3), experimental result shows, zytase of the present invention has higher optimal reactive temperature, good thermostability and alkaline stability, stability and resistance are higher in high salt, have higher ratio vigor, are the highest zytases of ratio vigor of present bacterial origin, therefore, this zytase is at association with pulp bleaching, has preferably application prospect in biological degumming and the washing composition production.

Description of drawings

Fig. 1 is the SDS-PAGE electrophorogram of recombined xylanase Bcxyl11A

Fig. 2 is the optimal reactive temperature of recombined xylanase Bcxyl11A

Fig. 3 is the optimal reaction pH of recombined xylanase Bcxyl11A

Fig. 4 is the thermostability of recombined xylanase Bcxyl11A

Fig. 5 is the pH stability of recombined xylanase Bcxyl11A

Fig. 6 is that NaCl is on the enzymic activity impact of recombined xylanase Bcxyl11A

Fig. 7 is that recombined xylanase Bcxyl11A is to the tolerance of NaCl

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

The acquisition of embodiment 1, zytase and encoding gene thereof

1, the discovery of zytase and encoding gene thereof

To be Institute of Micro-biology of the Chinese Academy of Sciences 2010 separate in China's Simen, Inner Mongolia alkali lake the alkali lake basophilic bacterium SN5 of tin alliance obtains, its 16s rRNA gene order comparison result shows that the similarity with Bacillus cellulosilyticus DSM2522 is 98%, is initially identified as Bacillus cellulosilyticus.

Extract the genomic dna of alkali lake basophilic bacterium Bacillus cellulosilyticus SN5, after partially digested with restriction enzyme Sau3A I, cut the fragment of glue recovery 3-9kb, be connected with the pUC118 carrier that cuts phosphorylation through BamH I enzyme, transformed competence colibacillus cell E.coli DH5 α, be coated on the LB flat board and (contain 100 μ g/ml Amp, 0.5M IPTG and 0.2%RBB-xylan (Remazol Brilliant Blue R-D-Xylan, sigma company product, catalog number (Cat.No.): M5019), pH8.0) on, 37 ℃ of overnight incubation obtain approximately 1.5 ten thousand clone's, wherein around 3 clone's transparent circle appears, positive clone's.

Insert Fragment to the contained plasmid of positive colony checks order, and obtains the ORF with 1101 Nucleotide, and 366 amino acid of encoding exist one potential to contain 27 amino acid whose signal peptides.The aminoacid sequence of this ORF coding of homology comparison discovery and the endo-1 from Bacillus sp.YA-335, the aminoacid sequence of 4-beta-xylanase has 67% similarity, belongs to glycosyl hydrolase 11 family members, with its called after Bcxyl11A.

2, the acquisition of zytase and encoding gene thereof

Take the genomic dna of Bacillus cellulosilyticus SN5 as template, the primer is as follows: forward primer 5 ' GCATGGATCCCAAATCACTGGAAATGAAATCG 3 ' (sequence 3, comprise BamH I enzyme and cut the protection bases G CAT of identification point GGATCC and restriction endonuclease); Reverse primer 5 ' GCTACTCGAGGTGAATTTCTAAGTAGTCGATATAAG3 ' (sequence 4, comprise Xho I enzyme and cut the protection bases G CTA of recognition site CTCGAG and restriction endonuclease) carry out pcr amplification, the pcr amplification condition is as follows: 95 ℃ of denaturation 5min of elder generation, then 95 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 90s, totally 35 circulations; Last 72 ℃ are extended 7min, obtain the PCR product of 1037bp.

With above-mentioned PCR reaction product cycle-pure kit purifying, with BamH I and Xho I double digestion, enzyme is cut product and is connected with 4 ℃ of T4 ligase enzymes with the pET28a carrier of cutting through same enzyme (available from Promega company) and spends the night, connect product and transform the bacillus coli DH 5 alpha competent cell, obtain recombinant bacterium.Extract the plasmid sequence verification of recombinant bacterium, the result shows, PCR product in this plasmid has in the sequence table sequence 1 from 5 ' terminal 82-1098 position Nucleotide, be Bcxyl11A with the unnamed gene of its PCR product, the albumen called after Bcxyl11A of this genes encoding, the aminoacid sequence of this albumen is that the sequence 2 in the sequence table is held the 28-366 amino acids from N, sequence 1 in the sequence table is inserted between the BamH I and Xho I site of pET28a called after pET28a-Bcxyl11A from 5 ' terminal 82-1098 position.

Also but artificial synthesized sequence 1, adopts above-mentioned method to obtain equally pET28a-Bcxyl11A.

Embodiment 2, utilize recombinant bacterium fermentative production zytase

1, contains the acquisition of the recombinant bacterium of Xylanase coding gene

Recombinant plasmid pET28a-Bcxyl11A is transformed in expressive host BL21 (DE3) competence, obtain recombinant bacterium BL21 (DE3)/pET28a-Bcxyl11A, extracting plasmid checks order, plasmid is pET28a-Bcxyl11A, illustrates that structure obtains containing the recombinant bacterium BL21 (DE3) of this plasmid/pET28a-Bcxyl11A.

Adopting uses the same method changes empty carrier pET28a among the BL21 (DE3) over to, obtain recombinant bacterium BL21 (DE3)/pET28a, extract plasmid and carry out the PCR evaluation, forward primer is 5 ' GCATGGATCCCAAATCACTGGAAATGAAATCG 3 ' (sequence 3); Reverse primer is 5 ' GCTACTCGAGGTGAATTTCTAAGTAGTCGATATAAG3 ' (sequence 4), and the result does not obtain the purpose fragment, illustrates to make up to obtain turning empty carrier recombinant bacterium BL21 (DE3)/pET28a.

2, the purifying of zytase and determination of activity

1) purifying of zytase

A, cultivation

Single colony inoculation to the kantlex final concentration of the recombinant bacterium BL21 (DE3) that above-mentioned steps 1 is obtained/pET28a-Bcxyl11A is in the 5ml LB liquid nutrient medium of 50 μ g/ml, cultivates 12h for 37 ℃.Nutrient solution is forwarded in the fresh LB liquid nutrient medium of 200ml according to 1% inoculum size, and 37 ℃ are cultured to OD600 and reach 0.6, and the IPTG that adds final concentration again and be 1mM in substratum continues inducing culture 6h.The centrifugal 10min of nutrient solution 6000g is collected thalline.

B, extraction

With thalline be resuspended in 10ml binding buffer liquid (20mM Tris-HCl, 500mM NaCl, the 10mM imidazoles, pH7.9) in, ultrasonication thalline (16v, 20min), 4 ℃, the centrifugal 10min of 15,000g collects supernatant liquor, is the Bcxyl11A crude extract.

C, purifying

Crude extract is crossed His Bind Column (production of Novagen company) purifying: wash pillar with 5ml binding buffer liquid before the loading; Treat that binding buffer drops to chromatographic medium surface, the careful crude enzyme liquid for preparing that adds; 1 * binding buffer with 10 times of bed volumes washes, and removes unconjugated foreign protein; 1 * wash buffer of 5 times of bed volumes washes, and removes in conjunction with weak foreign protein; 1 * elute buffer of 5 times of bed volumes washes.Approximately 5ml discards initial 0.2ml and last 1.8ml, the 3ml (albumen mainly concentrates on this zone) in the middle of collecting.

To collect liquid and carry out desalination in AKTA FPLC system, the desalination condition is: damping fluid: 20mM Tris-HCl, pH8.0; Flow velocity: 3ml/min collects protein peak.

Sample solution behind employing centrifugal concentrating pipe (production of the Milipore company) concentrating and desalinating is to 1ml, be loaded to Superdex 75 10/300GL posts (GE company product) and carry out sieve chromatography, level pad is that 20mMTris-HCl (contains 0.15M NaCl, pH8.0), flow velocity 0.3ml/min, collect the sample of each protein peak, SDS-PAGE identifies the sample of each elution peak, keeps the sample (the wash-out column volume is that 11.34ml begins to occur this product) that contains Bcxyl11A.Take recombinant bacterium BL21 (DE3)/pET28a and BL21 (DE3) as contrast.

The result as shown in Figure 1,1: molecular weight Marker; 2:BL21 (DE3)/pET28a lysate supernatant; 3: crude enzyme liquid; 4: cross the ni-sepharose purification result; 5: molecular sieve purification result, can find out: swimming lane 3-5 has size to be the about albumen of 45kD, and than theoretical value (because N end and the C of recombinant protein holds the one section His label that contains on the carrier) bigger than normal, purified product is Bcxyl11A.

Recombinant bacterium BL21 (DE3)/pET28a and BL21 (DE3) are contrast, do not obtain size and are that the target protein of 45kD, its eluted product are respectively contrast purified product 1 and contrast purified product 2.

2) determination of activity of zytase

To above-mentioned steps 1) purified product, contrast purified product 1 and the contrast purified product 2 that obtain carry out respectively the enzyme biopsy and survey.1 enzyme unit alive (U) is defined as: under the certain condition, it is a unit that per minute produces the needed enzyme amount of 1 μ mol wood sugar.

The reaction system of enzyme activity determination is as follows: it is 50mM that 1g birch xylan (xylan from birchwood, sigma, X0502) is dissolved in 100ml concentration, in the Tris-HCl damping fluid of pH8.0, obtains the xylan substrate solution; Get the above-mentioned xylan substrate solution of 480tl, being respectively the above-mentioned steps 1 of 0.001mg/ml with 20tl concentration) purified product, contrast purified product 1 and the contrast purified product 2 that obtain mix, behind 50 ℃ of reaction 10min, add equal-volume DNS reagent, and then boil the 5min colour developing.After the instant cooling, get 200 μ l, the light absorption value at test 540nm place.

Three repetition are established in experiment, and results averaged, result show, above-mentioned steps 1) the enzyme average specific vigor of purified product Bcxyl11A of acquisition is 2528u/mg (mg is the dry weight of enzyme), is the highest zytase of ratio vigor of present bacterial origin.

And the average specific vigor of contrast purified product 1 and contrast purified product 2 enzymes is 0, further proves step 1) the purified product Bcxyl11A that obtains is zytase.

3, zymologic property characterizes

Following experiment is triplicate, results averaged.

The mensuration of A, the suitableeest enzymatic reaction temperature

Get 480 μ l above-mentioned steps 2 2) the xylan substrate solution, add 20 μ l concentration and be 0.001mg/ml above-mentioned steps 2 1) the zytase Bcxyl11A that obtains, mix rear respectively under 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃ and 70 ℃, according to above-mentioned steps 2 2) the enzyme activity determination method measure the enzyme of zytase Bcxyl11A under differing temps and live, to determine the suitableeest enzymatic reaction temperature.

The result can find out that optimum temperuture is 50 ℃ as shown in Figure 2, and the activity of enzyme 50 ℃ the time is set as 100%, and between 35-55 ℃, relative reactivity reaches more than 50%.

The mensuration of B, the suitableeest enzymatic reaction pH value

Birch xylan is dissolved in respectively in the following damping fluid of 50mM: Na ₂HPO ₄/ citric acid (pH 4.0-6.0), sodium phosphate (pH 6.0-7.5), Tris/HCl (pH 7.5-8.8) and glycine/NaOH (pH 8.8-10.4)) in, the xylan substrate solution of different pH values prepared.Get the xylan substrate solution of the above-mentioned different pH values of 480 μ l, add 20 μ l concentration and be 0.001mg/ml above-mentioned steps 2 1) the purified product zytase Bcxyl11A that obtains, mix rear under 50 ℃, according to above-mentioned steps 2 2) the enzyme activity determination method measure the enzyme of zytase Bcxyl11A under condition of different pH and live, to determine the pH value of the suitableeest enzymatic reaction.

Shown in result such as Fig. 3 (be the result of 4 kinds of damping fluids among the figure, overlapping value is arranged between the different damping fluids, convert), can find out: optimum pH is 8.0, the activity of enzyme when the pH8.0 is set as 100%, and between pH6.0-8.8, relative reactivity can reach more than 50%.

The mensuration of C, thermostability

With above-mentioned steps 2 1) to be diluted to final concentration with Tris/HCl damping fluid (50mM, pH8.8) be 0.001mg/ml for the zytase Bcxyl11A that obtains, above-mentioned enzyme liquid is incubated respectively 30min, 60min, 90min and 120min under 50 ℃, 60 ℃, 70 ℃, 80 ℃, then according to above-mentioned steps 2 2) the enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl11A, to measure the thermostability of above-mentioned zytase Bcxyl11A.

The result can find out as shown in Figure 4, and 50 ℃ of lower residual enzyme activities all are higher than other temperature, and the treatment time is longer, and the residual enzyme activity is less; At 50 ℃, 60 ℃, 70 ℃, the 80 ℃ lower 2h that process, remnant enzyme activity reaches respectively 80.7%, 53.7%, 31.6% and 18.5% of initial enzymic activity, illustrates that Bcxyl11A has good thermostability.

D, pH stability

With above-mentioned steps 2 1) the zytase Bcxyl11A that obtains is with the different damping fluid [Na of 50mM ₂HPO ₄/ citric acid (pH 4.0-6.0), sodium phosphate (pH 6.0-7.5), Tris/HCl (pH 7.5-8.8) and glycine/NaOH (pH 8.8-10.4)] to be diluted to final concentration be 0.001mg/ml, place 4 ℃ to deposit 24h, then according to above-mentioned steps 2 2) the enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl11A, to measure the pH stability of above-mentioned zytase Bcxyl11A.

The result can find out as shown in Figure 5, and Bcxyl11A is the most stable when pH8.8, and is stable in alkaline range, preserves 24h in the pH8-11 scope, and remnant enzyme activity reaches more than 70%.

E, the salt ion resistance is tested

With above-mentioned steps 2 1) the zytase Bcxyl11A that obtains is respectively at the Tris/HCl damping fluid (50mM of the 1%birchwood xylan substrate that contains the NaCl of different concns (0-4M), pH8.0) in the solution, according to above-mentioned steps 2 2) the enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl11A, to measure above-mentioned zytase Bcxyl11A to the resistance of high salt.

The result can find out as shown in Figure 6, is 49% of initial enzyme activity at the residual enzyme activity of Tris/HCl damping fluid (50mM, the pH8.0) solution of the 1%birchwood xylan substrate that contains 4M NaCl; Illustrate that Bcxyl11A has certain resistance to NaCl.

F, to the test of the tolerance of salt ion

With above-mentioned steps 2 1) the zytase Bcxyl11A that obtains places the Tris/HCl damping fluid (50mM of the NaCl (0-4M) of different concns, pH8.8) in, take a sample behind 4 ℃ of placement 24h, according to above-mentioned steps 2 2) the enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl11A, to investigate the tolerance of above-mentioned zytase Bcxyl11A under high salt condition.

The result can find out as shown in Figure 7, and the residual enzyme activity of Bcxyl11A in containing the Tris/HCl damping fluid (50mM, pH8.8) of 2M NaCl is 66%; Residual enzyme activity in containing the Tris/HCl damping fluid (50mM, pH8.8) of 4M NaCl is 38%; Illustrate that Bcxyl11A has certain tolerance to salt ion.

The above results shows, above-mentioned steps 2 1) optimal reactive temperature of the zytase Bcxyl11A that obtains is 50 ℃; Optimal reaction pH value is 8.0; And thermostability is higher, under the condition of pH 8.8, and 50 ℃, 60 ℃, 70 ℃, the 80 ℃ lower 2h that process, remnant enzyme activity reaches respectively 80.7%, 53.7%, 31.6% and 18.5%; Bcxyl11A is the most stable when pH8.8, and is stable in alkaline range, preserves 24h in the pH8-11 scope, and remnant enzyme activity reaches more than 70%.This zytase has under the high salt condition up to 4M NaCl, still has 49% remnant enzyme activity.Simultaneously, this endo-xylanase still has 66% and 38% remnant enzyme activity behind the 24h incubation in 2M NaCl and 4M NaCl.Experimental data shows, zytase Bcxyl11A has good resistance and stability and high ratio vigor, has application prospect in association with pulp bleaching, biological degumming and washing composition production.

Claims

1. albumen is following (a) or (b) or protein (c):

2. the encoding gene of the described albumen of claim 1.

3. encoding gene according to claim 2, it is characterized in that: described encoding gene is following 1)-3) in arbitrary described dna molecular:

1) dna molecular shown in the sequence in the sequence table 1;

4. the recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contain claim 2 or 3 described genes.

5. recombinant vectors according to claim 4 is characterized in that: the recombinant vectors that described recombinant vectors obtains for the encoding gene that inserts the described albumen of claim 1 between the multiple clone site of pET carrier; Described pET carrier is preferably carrier pET28a.

6. recombinant bacterium according to claim 4, it is characterized in that: described recombinant bacterium is that recombinant vectors claimed in claim 5 is imported to the recombinant bacterium that obtains in the e. coli bl21 (DE3).

7. amplification claim 2 or the total length of 3 described genes or the primer pair of its arbitrary fragment, the nucleotides sequence of a primer of described primer pair is classified the sequence 3 in the sequence table as, and the nucleotides sequence of another primer in the described primer pair is classified the sequence 4 in the sequence table as.

8. albumen claimed in claim 1 is as the xylan application of enzymes;

Or the application of albumen claimed in claim 1 in association with pulp bleaching, biological degumming and washing composition.

9. a method for preparing zytase comprises the steps: fermentation culture claim 4 or 6 described recombinant bacteriums, namely obtains zytase.

10. method according to claim 9, it is characterized in that: described culture temperature is 37 ℃, the time of described cultivation is 6h.