CN103060289B - Salt-tolerant xylanase, its coding gene and application - Google Patents
Salt-tolerant xylanase, its coding gene and application Download PDFInfo
- Publication number
- CN103060289B CN103060289B CN201110317110.7A CN201110317110A CN103060289B CN 103060289 B CN103060289 B CN 103060289B CN 201110317110 A CN201110317110 A CN 201110317110A CN 103060289 B CN103060289 B CN 103060289B
- Authority
- CN
- China
- Prior art keywords
- sequence
- zytase
- bcxyl10a
- albumen
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a salt-tolerant xylanase, its coding gene and application. The protein is as shown in (a) or (b) as follows: (a) a protein composed of an amino acid sequence shown by sequence 2 in a sequence table; and (b) an (a)-derived protein that is formed by subjecting an amino acid residual sequence of sequence 2 in the sequence table to substitution and/or deletion and/or adding by one or several amino acid residues and has an endoglucanase function. Experiments in the invention prove that the endo-xylanase provided in the invention has a low optimum reaction temperature, has high stability and stress resistance under a high salinity condition, and has high specific activity, thereby having good application prospects in marine product or pickled product processing.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of salt tolerant zytase and encoding gene and application.
Background technology
Xylan is a kind of poly five-carbon sugar, and main component is D-wood sugar, is the important component part of plant hemicellulose, and it accounts for 1/3 of plant carbohydrates total amount, is the abundant regeneration biological resource of content second after Mierocrystalline cellulose at occurring in nature.The complex structure of xylan, main chain is connected into through β-Isosorbide-5-Nitrae-glycosidic link by β-D-xylopyranose residue, and the xylan of different sources has different side substitution groups.Inscribe-β-Isosorbide-5-Nitrae-D-zytase (endo-β-Isosorbide-5-Nitrae-D-xylanase) [EC 3.2.1.8], is called for short zytase, is responsible for the degraded of xylan backbone skeleton, is the enzyme of most critical in xylanolytic enzyme system.According to aminoacid sequence composition and the hydrophobicity analysis of glycoside hydrolase catalysis region, glycoside hydrolases can be divided into different families, the zytase of finding at present mainly belongs to F/10 and G/11 family.
Zytase has important potential using value, is widely used in the industries such as food, feed, pulping and paper-making, biological degumming.Zytase has huge application potential, but be applied in different fields, the character of zytase is had to different requirements.In general, optimum temperature has determined the Application Areas of enzyme, and can thermostability suitability for industrialized production have much relations with enzyme.As papermaking needs high temperature and alkaline condition, paper pulp substrate needs thermophilic alkali enzyme could effectively carry out bio-bleaching.Salt tolerant zytase is also employed in biological degumming and washing composition production.Before feed granulation, add zytase mainly at 70～95 ℃, to carry out, therefore the zytase of Heat stability is good may be used on the production of animal-feed.In addition, feeding enzyme must be about 40 ℃ in temperature, and pH is about the activity under 4.8 condition with height, to adapt to the environment of animal digestive tract.Starch adhesive group is conventionally in the condition modulated lower than 35 ℃, and therefore, under the condition of low temperature or middle temperature, enzyme is lived and very high had a liking for cold zytase and be used at present in low temperature or the middle temperature course of processing particularly grocery trade.
Owing to needing enzyme of different nature in different industrial production, therefore, study the new zytase with advantageous property and be significant.
Summary of the invention
An object of the present invention is to provide a kind of albumen.
Albumen provided by the invention, can synthetic, is following (a) or protein (b):
(a) protein being formed by the amino acid residue sequence shown in sequence in sequence table 2;
(b) by the amino acid residue sequence of sequence in sequence table 2 through replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and have zytase function by (a) derivative protein.
Wherein in sequence table, sequence 2 is made up of 348 amino acid, the about 40kDa of molecular weight
The encoding gene of zytase specifically can be following 1)-3) in arbitrary described DNA molecular:
1) DNA molecular shown in the sequence 1 in sequence table;
2) can be with 1 under stringent condition) the DNA sequence dna hybridization that limits and coding have the DNA molecular of albumen described in zytase function;
3) with 1) DNA sequence dna that limits has more than 90% homology and coding and has the DNA molecular of albumen described in zytase function.
Above-mentioned stringent condition can be at 0.1 × SSPE (or 0.1 × SSC), in the solution of 0.1%SDS, hybridizes and wash film under 65 ℃ of conditions.
The recombinant vectors, expression cassette, transgenic cell line and the recombinant bacterium that contain above-mentioned protein coding gene also belong to protection scope of the present invention.
Between the BamH I that described recombinant vectors is specially at pET28a and Xho I site, insert the recombinant vectors pET28a-Bcxyl10A that the encoding gene of described albumen obtains.
Described recombinant bacterium specifically can be the recombinant bacterium that importing contains above-mentioned Xylanase coding gene in e. coli bl21 (DE3), BL21-Gold (DE3), BL21-Gold (DE3) pLysS or BL21-CodonPlus (DE3)-RIPL recombinant vectors obtains.
The primer pair of above-mentioned endo-xylanase encoding gene total length or its arbitrary fragment of increasing also belongs to protection scope of the present invention; the nucleotides sequence of a primer of described primer pair is classified the sequence 3 in sequence table as, and the nucleotides sequence of another primer in described primer pair is classified the sequence 4 in sequence table as.
Second object of the present invention is to provide a kind of method of preparing zytase.
The method of preparing zytase provided by the present invention, is the recombinant bacterium described in fermentation culture, obtains zytase.
Described culture temperature is 25 ℃, and the time of described cultivation is 10h.
Of the present invention experimental results show that, the present invention is separated to basophilic bacterium Bacillus cellulosilyticus SN5 from tin alliance alkali lake, by building bacterium genomic library, obtain endo-xylanase encoding gene, and proceeded in e. coli bl21 (DE3), experimental result shows, endo-xylanase of the present invention has lower optimal reactive temperature, in high salt, stability and resistance are higher, there is higher ratio vigor, therefore there is good application prospect at sea-food or in pickling product processing.
Accompanying drawing explanation
Fig. 1 is the SDS-PAGE electrophorogram of recombined xylanase Bcxyl10A
Fig. 2 is the optimal reactive temperature of recombined xylanase Bcxyl10A
Fig. 3 is the optimal reaction pH of recombined xylanase Bcxyl10A
Fig. 4 is the thermostability of recombined xylanase Bcxyl10A
Fig. 5 is the pH stability of recombined xylanase Bcxyl10A
Fig. 6 is the enzymic activity impact of NaCl on recombined xylanase Bcxyl10A
Fig. 7 is the tolerance of recombined xylanase Bcxyl10A to NaCl
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
The acquisition of embodiment 1, zytase and encoding gene thereof
1, the discovery of zytase and encoding gene thereof
To be Institute of Micro-biology of the Chinese Academy of Sciences 2010 obtain from separating in China's Simen, Inner Mongolia alkali lake the alkali lake basophilic bacterium SN5 of tin alliance, its 16s rRNA gene order comparison result shows that with the similarity of Bacillus cellulosilyticus DSM2522 be 99%, is initially identified as Bacillus cellulosilyticus.
Extract the genomic dna of alkali lake basophilic bacterium Bacillus cellulosilyticus SN5, after partially digested with restriction enzyme Sau3A I, cut the fragment of glue recovery 3-9kb, with cut dephosphorylized pUC118 carrier through BamH I enzyme and be connected, transformed competence colibacillus cell E.coli DH5 α, be coated on LB flat board [containing 100Amp, 0.5M IPTG and 0.2%RBB-xylan (Remazol Brilliant Blue R-D-Xylan, sigma company product, catalog number (Cat.No.): M5019), pH8.0] on, 37 ℃ of overnight incubation, obtain approximately 6000 clones, there is transparent circle around in 2 clones wherein, positive clone.
Insert Fragment to the contained plasmid of positive colony checks order, and obtains an ORF with 1047 Nucleotide, 348 amino acid of encoding.Sequence homology comparison finds that the aminoacid sequence of this ORF and the aminoacid sequence of the endoxylanase from Paenibacillus sp.E18 have 71% similarity, belong to glycosyl hydrolase 10 family members, by its called after Bcxyl10A.
2, the acquisition of zytase and encoding gene thereof
Take the genomic dna of Bacillus cellulosilyticus SN5 as template, the primer is as follows: forward primer 5 ' GCATGGATCCATGTTAATGAGTGATTATGGGAGGA 3 ' (comprise BamH I enzyme and cut recognition site, sequence 3); Reverse primer 5 ' GCTACTCGAGTGAATTTGCAACTTTGATTAATTCA 3 ' (comprise Xho I enzyme and cut recognition site, sequence 4) carries out pcr amplification, and pcr amplification condition is as follows: first 95 ℃ of denaturation 5min, then 95 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 90s, totally 35 circulations; Last 72 ℃ are extended 7min, obtain the PCR product of 1067bp.
Above-mentioned PCR reaction product is cut to glue and reclaim purifying, get product 1 μ l as the template of PCR again, the primer and amplification condition are all the same.PCR reaction product is purified with cycle-pure kit again, with BamH I and Xho I double digestion, enzyme is cut product and is connected and spends the night with 4 ℃ of T4 ligase enzymes with the pET28a carrier of cutting through same enzyme (purchased from Promega company), connect product and transform bacillus coli DH 5 alpha competent cell, obtain recombinant bacterium.Extract the plasmid sequence verification of recombinant bacterium, result shows, PCR product in this plasmid has the Nucleotide shown in sequence 1 in sequence table, be Bcxyl10A by the unnamed gene of its PCR product, the albumen called after Bcxyl10A of this genes encoding, the aminoacid sequence of this albumen is the sequence 2 in sequence table, the sequence in sequence table 1 is inserted between the BamH I and Xho I site of pET28a to called after pET28a-Bcxyl10A.
Also can artificial synthesized sequence 1, adopt above-mentioned method to obtain equally pET28a-Bcxyl10A.
The acquisition of the recombinant bacterium that 1, contains Xylanase coding gene
Recombinant plasmid pET28a-Bcxyl10A is transformed and expressed in competence host BL21 (DE3), obtain recombinant bacterium BL21 (DE3)/pET28a-Bcxyl10A, extracting plasmid checks order, plasmid is pET28a-Bcxyl10A, illustrates that structure obtains recombinant bacterium BL21 (the DE3)/pET28a-Bcxyl10A that contains this plasmid.
Adopting uses the same method proceeds to empty carrier pET28a in BL21 (DE3), obtain recombinant bacterium BL21 (DE3)/pET28a, extract plasmid and carry out PCR evaluation, primer is forward 5 ' GCATGGATCCATGTTAATGAGTGATTATGGGAGGA 3 ' (sequence 3); Reverse5 ' GCTACTCGAGTGAATTTGCAACTTTGATTAATTCA 3 ' (sequence 4), result does not obtain object fragment, illustrates to build to obtain turning empty carrier recombinant bacterium BL21 (DE3)/pET28a.
2, the acquisition of zytase and determination of activity
1) extraction of zytase and purifying
A, cultivation
Single colony inoculation to the kantlex final concentration of recombinant bacterium BL21 (DE3)/pET28a-Bcxyl10A that above-mentioned steps 1 is obtained is in the 5ml LB liquid nutrient medium of 50 μ g/ml, cultivates 12h for 37 ℃.Nutrient solution is forwarded in the LB liquid nutrient medium that 2L is fresh according to 1% inoculum size, and 37 ℃ are cultured to OD600 and reach 0.6, then in substratum, to add final concentration be the IPTG of 1mM, and 25 ℃ are continued inducing culture 10h.Centrifugal nutrient solution 6000g 10min is collected to thalline.
B, extraction
Thalline is resuspended in 40ml binding buffer liquid (20mM Tris-HCl, 500mM NaCl, 10mM imidazoles, pH7.9), ultrasonication thalline (16v, 20min), 4 ℃, 15, the centrifugal 10min of 000g, collects supernatant liquor, is Bcxyl10A crude extract.
C, purifying
Crude extract is crossed to His Bind Column (production of Novagen company) purifying: before loading, wash pillar with 5ml binding buffer liquid; Treat that binding buffer drops to chromatographic medium surface, carefully adds the crude enzyme liquid preparing; Wash with 1 × binding buffer of 10 times of bed volumes, remove unconjugated foreign protein; 1 × wash buffer of 5 times of bed volumes washes, and removes in conjunction with weak foreign protein; 1 × elute buffer of 5 times of bed volumes washes.About 5ml, discards initial 0.2ml and last 1.8ml, the 3ml (albumen mainly concentrates on this region) in the middle of collecting.
Collection liquid is carried out to desalination in AKTA FPLC system, and desalination condition is: damping fluid: 20mM Tris-HCl, pH8.0; Flow velocity: 3ml/min, collects protein peak.
Sample solution after employing centrifugal concentrating pipe (production of Milipore company) concentrating and desalinating is to 1ml, be loaded to Superdex 75 10/300GL posts (GE company product) and carry out sieve chromatography, level pad is that 20mMTris-HCl is (containing 0.15M NaCl, pH8.0), flow velocity 0.3ml/min, collect the sample of each protein peak, SDS-PAGE identifies the sample of each elution peak, retains the sample (wash-out column volume starts to occur this product while being 9.78ml) that contains Bcxyl10A.Take recombinant bacterium BL21 (DE3)/pET28a and BL21 (DE3) as contrast.
Purified product is carried out to SDS-PAGE electrophoretic analysis, the results are shown in Figure 1,1: molecular weight Marker; 2:BL21 (DE3)/pET28a lysate supernatant; 3: crude enzyme liquid; 4: cross ni-sepharose purification result; 5: molecular sieve purification result; Swimming lane 3-5 has size that the albumen of 45kD (please provide) is provided, and than theoretical value (because N end and the C end of recombinant protein contain one section of His label on carrier) bigger than normal, purified product is Bcxyl10A.
Recombinant bacterium BL21 (DE3)/pET28a and BL21 (DE3) are contrast, do not obtain the target protein of size for 45kD, and its eluted product is respectively contrast purified product 1 and contrast purified product 2.
2) determination of activity of zytase
To above-mentioned steps 1) obtain purified product, contrast purified product 1 and contrast purified product 2 carry out respectively enzyme biopsy survey.1 Ge Meihuo unit (U) is defined as: under certain condition, it is a unit that per minute produces the needed enzyme amount of 1 μ mol wood sugar.
The reaction system of enzyme activity determination is as follows: it is 50mM that 0.5g beech wood glycan (Xylan from beechwood, sigma, X4252) is dissolved in to 100ml concentration, in Sodium phosphate dibasic-citrate buffer solution of pH7.0, obtains xylan substrate solution; Get the above-mentioned xylan substrate solution of 480 μ l, the above-mentioned steps 1 that is 0.05mg/ml with 20 μ l concentration respectively) obtain purified product Bcxyl10A, contrast purified product 1 and contrast purified product 2 mix, after 40 ℃ of reaction 10min, add equal-volume DNS reagent, and then boil 5min colour developing.After instant cooling, get 200 μ l, the light absorption value at test 540nm place.
Three repetition are established in experiment, and results averaged, result shows, above-mentioned steps 1) the enzyme average specific vigor of the purified product Bcxyl10A of acquisition is 84.5u/mg (dry weight that mg is enzyme).
And the average specific vigor of contrast purified product 1 and contrast purified product 2 enzymes is 0, further proving step 1) the purified product Bcxyl10A that obtains is zytase.
3, zymologic property characterizes
Following experiment is in triplicate, results averaged.
The mensuration of A, the suitableeest enzymatic reaction temperature
Get 480 μ l above-mentioned steps 2 2) xylan substrate solution, add above-mentioned steps 2 that 20 μ l concentration are 0.05mg/ml 1) the zytase Bcxyl11A that obtains, mix rear respectively at 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃ and 65 ℃, according to above-mentioned steps 2 2) enzyme activity determination method measure the zytase Bcxyl10A enzyme under differing temps and live, to determine the suitableeest enzymatic reaction temperature.
Result as shown in Figure 2, can find out that optimum temperuture is 40 ℃, and the activity by enzyme 40 ℃ time is set as 100%, and, between 20-50 ℃, relative reactivity reaches more than 50%.In the time of 25 ℃, there is 80% enzyme work, belong to cold-adapted enzyme.
The mensuration of B, the suitableeest enzymatic reaction pH value
Beech wood glycan is dissolved in respectively in the following damping fluid of 50mM: Na
2hPO
4/ citric acid (pH4.6-7.6),, in Tris/HCl (pH 7.6-8.8) and glycine/NaOH (pH 8.8-10.4), prepare 0.5% xylan substrate solution of different pH values.Get the xylan substrate solution of the above-mentioned different pH values of 480 μ l, add above-mentioned steps 2 that 20 μ l concentration are 0.05mg/ml 1) the zytase Bcxyl10A that obtains, after mixing at 40 ℃, according to above-mentioned steps 2 2) enzyme activity determination method measure the zytase Bcxyl10A enzyme under condition of different pH and live, to determine the pH value of the suitableeest enzymatic reaction.
Result as shown in Figure 3, can be found out: the optimum pH of enzyme is 7.0, and the activity by enzyme when the pH7.0 is set as 100%, and, between pH6-8.4, relative reactivity reaches more than 50%.
The mensuration of C, thermostability
By above-mentioned steps 2 1) Na of the zytase Bcxyl10A 50mM pH6 that obtains
2hPO
4it is 0.05mg/ml that/citric acid damping fluid is diluted to final concentration, above-mentioned enzyme liquid is incubated to 10min, 20min and 30min at 40 ℃ respectively, then according to above-mentioned steps 2 2) enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl10A, to measure the thermostability of above-mentioned zytase Bcxyl10A.
Result as shown in Figure 4, can find out, Bcxyl10A thermostability is poor, under the condition of pH 6.0,40 ℃ of insulation 10min, 20min and 30min, remnant enzyme activity reach respectively that initial enzyme lives 62.2%, 32.5% and 22.8%.
D, pH stability
By above-mentioned steps 2 1) the zytase Bcxyl10A different damping fluid [Na of 50mM that obtain
2hPO
4/ citric acid (pH 4.0-7.6), Tris/HCl (pH 7.6-8.8) and glycine/NaOH (pH 8.8-10.4)] to be diluted to final concentration be 0.05mg/ml, be placed in 4 ℃ and deposit 24h, then according to above-mentioned steps 2 2) enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl10A, to measure the pH stability of zytase Bcxyl10A.
Result as shown in Figure 5, can find out, Bcxyl10A has pH stability widely, the most stable in the time of pH6, bathes after 24h in pH5.6-9.6 temperature, and remnant enzyme activity reaches more than 80%, but higher than 9.6 or serious lower than the loss of living of 5.6 o'clock enzymes.
E, salt ion resistance is tested
By above-mentioned steps 2 1) the zytase Bcxyl10A that obtains is respectively at the Na of the 0.5% beech wood glycan substrate that contains the NaCl of different concns (0-4M)
2hPO
4in/citric acid damping fluid (50mM, pH7.0) solution, according to above-mentioned steps 2 2) enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl10A, to measure the resistance of above-mentioned zytase Bcxyl10A to high salt.
Result as shown in Figure 6, can find out, containing in the substrate of 0.5M NaCl, activity is the highest, reaches 134.5%.
F, tolerance test to salt ion
By above-mentioned steps 2 1) the zytase Bcxyl10A that obtains is placed in the Na of the NaCl (0-4M) of different concns
2hPO
4/ citric acid damping fluid (50mM, pH6.0) in, place after 24h for 4 ℃ and sample, according to above-mentioned steps 2 2) enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl10A, to investigate the tolerance of above-mentioned zytase Bcxyl10A under high salt condition.
Result as shown in Figure 7, can find out, this enzyme, under the high salt condition up to 4M NaCl, still has 47.4% remnant enzyme activity, still has 87.4% and 50.3% remnant enzyme activity after 24h incubation.
Repeat experiment for three times, result shows, above-mentioned steps 2 1) optimal reactive temperature of the zytase Bcxyl10A that obtains is 40 ℃, has 80% enzyme and live in the time of 25 ℃, belongs to cold-adapted enzyme; Optimal reaction pH value is 7.0; Bcxyl10A thermostability is poor, and under the condition of pH 6.0,40 ℃ are incubated 10min, 20min and 30min, and remnant enzyme activity reaches respectively 62.2%, 32.5% and 22.8%; Bcxyl10A has pH stability widely, the most stable in the time of pH6, bathes after 24h in pH5.6-9.6 temperature, and remnant enzyme activity reaches more than 80%, but higher than 9.6 or serious lower than enzyme loss alive in 5.6 o'clock.This zytase is containing in the substrate of 0.5M NaCl, and activity is the highest, reaches 134.5%, and the 0.5M NaCl salinity of seawater just.This enzyme, under the high salt condition up to 4M NaCl, still has 47.4% remnant enzyme activity.Meanwhile, this endo-xylanase, in 2M NaCl and 4M NaCl, still has 87.4% and 50.3% remnant enzyme activity after 24h incubation.Experimental data shows, zytase Bcxyl10A belongs to cold-adapted enzyme, has good salt tolerance, in sea-food or pickling food processing, has application prospect.
Claims (11)
1. an albumen, the protein being formed by the aminoacid sequence shown in sequence in sequence table 2.
2. the encoding gene of albumen described in claim 1.
3. encoding gene according to claim 2, is characterized in that: described encoding gene is the DNA molecular shown in the sequence 1 in sequence table.
4. contain recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium of gene described in claim 2 or 3.
5. recombinant vectors according to claim 4, is characterized in that: described recombinant vectors is between the multiple clone site of pET carrier, to insert the recombinant vectors that the encoding gene of albumen obtains described in claim 1.
6. recombinant vectors according to claim 5, is characterized in that: described pET carrier is carrier pET28a.
7. recombinant bacterium according to claim 4, is characterized in that: described recombinant bacterium is that the recombinant vectors described in claim 5 or 6 is imported to the recombinant bacterium obtaining in e. coli bl21 (DE3).
8. the primer pair of the total length of gene described in amplification claim 2 or 3, the nucleotides sequence of a primer of described primer pair is classified the sequence 3 in sequence table as, and the nucleotides sequence of another primer in described primer pair is classified the sequence 4 in sequence table as.
9. albumen claimed in claim 1 is as the application of zytase;
Or the application of albumen claimed in claim 1 in sea-food or pickling food processing.
10. prepare a method for zytase, comprise the steps: the recombinant bacterium described in fermentation culture claim 4 or 7, obtain zytase.
11. methods according to claim 10, is characterized in that: described culture temperature is 25 ℃, and the time of described cultivation is 10h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110317110.7A CN103060289B (en) | 2011-10-18 | 2011-10-18 | Salt-tolerant xylanase, its coding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110317110.7A CN103060289B (en) | 2011-10-18 | 2011-10-18 | Salt-tolerant xylanase, its coding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103060289A CN103060289A (en) | 2013-04-24 |
| CN103060289B true CN103060289B (en) | 2014-05-28 |
Family
ID=48103188
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110317110.7A Expired - Fee Related CN103060289B (en) | 2011-10-18 | 2011-10-18 | Salt-tolerant xylanase, its coding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103060289B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015058700A1 (en) * | 2013-10-25 | 2015-04-30 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101805726A (en) * | 2010-04-19 | 2010-08-18 | 中国科学院微生物研究所 | Heat-resistance neutral xylanase, coding gene and application thereof |
-
2011
- 2011-10-18 CN CN201110317110.7A patent/CN103060289B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101805726A (en) * | 2010-04-19 | 2010-08-18 | 中国科学院微生物研究所 | Heat-resistance neutral xylanase, coding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| RaviD.Baraboteetal..Xyn10A a thermostable endoxylanase from Acidothermus cellulolyticus 11B.《Applied and environmental microbiology》.2010 |
| Xyn10A,a thermostable endoxylanase from Acidothermus cellulolyticus 11B;Ravi D.Barabote et al.;《Applied and environmental microbiology》;20101130;第76卷(第21期);第7363-7366页 * |
| 王健鑫.嗜极菌的极端酶的若干研究进展.《浙江海洋学院学报(自然科学版)》.2003,第22卷(第2期),第158-162页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103060289A (en) | 2013-04-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101591648B (en) | Method for preparing heat-resistant cutinase-CBD and application thereof in cotton fiber refining | |
| Balasubramanian et al. | Purification and biochemical characterization of a novel thermo-stable carboxymethyl cellulase from Azorean isolate Bacillus mycoides S122C | |
| EP3027745A1 (en) | Artificial cellulosomes comprising multiple scaffolds and uses thereof in biomass degradation | |
| Wang et al. | Cloning and characterization of a thermostable and pH-stable cellobiohydrolase from Neocallimastix patriciarum J11 | |
| AU2011283091B2 (en) | Polypeptides for use in the deconstruction of cellulose | |
| CN102286447B (en) | Novel endoxylanase and coding gene and use thereof | |
| Singh et al. | Overview of the process of enzymatic transformation of biomass | |
| CN103060290B (en) | Alkaline xylanase, its coding gene and application | |
| CN104745612A (en) | Genes of high temperature resistant xylanase and high temperature resistant xylosidase and protein expression and application thereof | |
| Zhivin-Nissan et al. | Unraveling essential cellulosomal components of the (Pseudo) Bacteroides cellulosolvens reveals an extensive reservoir of novel catalytic enzymes | |
| CN103060289B (en) | Salt-tolerant xylanase, its coding gene and application | |
| Dipasquale et al. | Characterization of a native cellulase activity from an anaerobic thermophilic hydrogen-producing bacterium Thermosipho sp. strain 3 | |
| CN107236692B (en) | Paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as encoding gene and application thereof | |
| CN101701214A (en) | Xylanase XYNA4 with wide pH applicability and gene and application thereof | |
| CN102358898B (en) | Medium-temperature beta-glucosidase BglA1, gene of same and application of same | |
| CN106148369A (en) | High-temperature alkaline transelminase Pel-863 and encoding gene thereof and application | |
| CN102329785B (en) | Medium-temperature alkali-resistant mannase Man5XH9 and gene and application thereof | |
| CN102041252B (en) | Efficient endoglucanase RuCelB, its encoding gene, preparation method and application | |
| CN103993025A (en) | Xylanase coding gene with excellent heat resistance and specific activity and application thereof | |
| CN103525791B (en) | A kind of high temperature resistant neutral cellulase Cel61P8 and gene thereof and application | |
| CN102154244B (en) | High-temperature acid cellulase EgG5 and gene and application thereof | |
| Brumm et al. | Identification, cloning and characterization of Dictyoglomus turgidum CelA, an endoglucanase with cellulase and mannanase activity | |
| Sharma et al. | Evaluation of different pretreatments versus forest wood waste and its selection as a solid substrate for enhanced cellulase production by Paenibacillus mucilaginous B5 | |
| Liu et al. | Molecular cloning and characterization of a novel bifunctional cellobiohydrolase/β-xylosidase from a metagenomic library of mangrove soil | |
| Luzics et al. | Cloning, expression, and biochemical characterisation of a novel endomannanase from Thermobifida alba |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140528 Termination date: 20191018 |