CN103060289A - Salt-tolerant xylanase, its coding gene and application - Google Patents
Salt-tolerant xylanase, its coding gene and application Download PDFInfo
- Publication number
- CN103060289A CN103060289A CN2011103171107A CN201110317110A CN103060289A CN 103060289 A CN103060289 A CN 103060289A CN 2011103171107 A CN2011103171107 A CN 2011103171107A CN 201110317110 A CN201110317110 A CN 201110317110A CN 103060289 A CN103060289 A CN 103060289A
- Authority
- CN
- China
- Prior art keywords
- sequence
- zytase
- albumen
- dna
- bcxyl10a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a salt-tolerant xylanase, its coding gene and application. The protein is as shown in (a) or (b) as follows: (a) a protein composed of an amino acid sequence shown by sequence 2 in a sequence table; and (b) an (a)-derived protein that is formed by subjecting an amino acid residual sequence of sequence 2 in the sequence table to substitution and/or deletion and/or adding by one or several amino acid residues and has an endoglucanase function. Experiments in the invention prove that the endo-xylanase provided in the invention has a low optimum reaction temperature, has high stability and stress resistance under a high salinity condition, and has high specific activity, thereby having good application prospects in marine product or pickled product processing.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of salt tolerant zytase and encoding gene and application.
Background technology
Xylan is a kind of poly five-carbon sugar, and main component is the D-wood sugar, is the important component part of plant hemicellulose, and it accounts for 1/3 of plant carbohydrates total amount, is the regeneration biological resource that content second enriches after Mierocrystalline cellulose at occurring in nature.The complex structure of xylan, main chain is connected into through β-Isosorbide-5-Nitrae-glycosidic link by β-D-xylopyranose residue, and the xylan of different sources has different side substitution groups.(endo-β-Isosorbide-5-Nitrae-D-xylanase) [EC 3.2.1.8] is called for short zytase to inscribe-β-Isosorbide-5-Nitrae-D-zytase, is responsible for the degraded of xylan backbone skeleton, is the enzyme of most critical in the xylanolytic enzyme system.Aminoacid sequence according to the glycoside hydrolase catalysis region forms and hydrophobicity analysis, glycoside hydrolases can be divided into different families, and the zytase of finding at present mainly belongs to F/10 and G/11 family.
Zytase has important potential using value, is widely used in the industries such as food, feed, pulping and paper-making, biological degumming.Zytase has huge application potential, but be applied in different fields the character of zytase is had different requirements.In general, optimum temperature has determined the application of enzymes field, and can thermostability then suitability for industrialized production have much relations with enzyme.Need the condition of high temperature and alkalescence such as papermaking, the paper pulp substrate needs thermophilic alkali enzyme could effectively carry out bio-bleaching.The salt tolerant zytase also is employed in biological degumming and the washing composition production.Add zytase before the feed granulation and mainly under 70～95 ℃, carry out, so the zytase of Heat stability is good may be used on the production of animal-feed.In addition, feeding enzyme must be about 40 ℃ in temperature, and pH is about the activity that has height under 4.8 the condition, to adapt to the environment of animal digestive tract.Starch adhesive group is usually in the condition modulated that is lower than 35 ℃, and therefore, enzyme is lived and very high had a liking for cold zytase and be used at present in low temperature or the middle temperature course of processing particularly grocery trade under the condition of low temperature or middle temperature.
Owing to needing enzyme of different nature in the different industrial production, therefore, studying the new zytase with advantageous property and be significant.
Summary of the invention
An object of the present invention is to provide a kind of albumen.
Albumen provided by the invention, but synthetic are following (a) or protein (b):
(a) protein that is formed by the amino acid residue sequence shown in the sequence in the sequence table 2;
(b) with the amino acid residue sequence of sequence in the sequence table 2 through replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and have the zytase function by (a) derivative protein.
Wherein sequence 2 is comprised of 348 amino acid in the sequence table, and molecular weight is 40kDa approximately
The encoding gene of zytase specifically can be following 1)-3) in arbitrary described dna molecular:
1) dna molecular shown in the sequence in the sequence table 1;
2) can be with 1 under stringent condition) dna molecular with the described albumen of zytase function of the dna sequence dna hybridization that limits and coding;
3) with 1) dna sequence dna that limits has the dna molecular that homology more than 90% and coding have the described albumen of zytase function.
Above-mentioned stringent condition can be 0.1 * SSPE (or in the solution of 0.1 * SSC), 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.
The recombinant vectors, expression cassette, transgenic cell line and the recombinant bacterium that contain above-mentioned protein coding gene also belong to protection scope of the present invention.
The recombinant vectors pET28a-Bcxyl10A that the encoding gene of the described albumen of insertion obtains between the BamH I that described recombinant vectors is specially at pET28a and Xho I site.
Described recombinant bacterium specifically can be in e. coli bl21 (DE3), BL21-Gold (DE3), BL21-Gold (DE3) pLysS or BL21-CodonPlus (DE3)-RIPL and to import the recombinant bacterium that the recombinant vectors that contains above-mentioned Xylanase coding gene obtains.
The primer pair of above-mentioned endo-xylanase encoding gene total length or its arbitrary fragment of increasing also belongs to protection scope of the present invention; the nucleotides sequence of a primer of described primer pair is classified the sequence 3 in the sequence table as, and the nucleotides sequence of another primer in the described primer pair is classified the sequence 4 in the sequence table as.
Second purpose of the present invention provides a kind of method for preparing zytase.
The method for preparing zytase provided by the present invention is the described recombinant bacterium of fermentation culture, namely obtains zytase.
Described culture temperature is 25 ℃, and the time of described cultivation is 10h.
Of the present invention experimental results show that, the present invention is separated to basophilic bacterium Bacillus cellulosilyticus SN5 from tin alliance alkali lake, by making up the bacterium genomic library, obtain the endo-xylanase encoding gene, and it is changed in the e. coli bl21 (DE3), experimental result shows, endo-xylanase of the present invention has lower optimal reactive temperature, stability and resistance are higher in high salt, therefore has higher ratio vigor, at sea-food or pickle in the product processing and have preferably application prospect.
Description of drawings
Fig. 1 is the SDS-PAGE electrophorogram of recombined xylanase Bcxyl10A
Fig. 2 is the optimal reactive temperature of recombined xylanase Bcxyl10A
Fig. 3 is the optimal reaction pH of recombined xylanase Bcxyl10A
Fig. 4 is the thermostability of recombined xylanase Bcxyl10A
Fig. 5 is the pH stability of recombined xylanase Bcxyl10A
Fig. 6 is that NaCl is on the enzymic activity impact of recombined xylanase Bcxyl10A
Fig. 7 is that recombined xylanase Bcxyl10A is to the tolerance of NaCl
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
The acquisition of embodiment 1, zytase and encoding gene thereof
1, the discovery of zytase and encoding gene thereof
To be Institute of Micro-biology of the Chinese Academy of Sciences 2010 separate in China's Simen, Inner Mongolia alkali lake the alkali lake basophilic bacterium SN5 of tin alliance obtains, its 16s rRNA gene order comparison result shows that the similarity with Bacillus cellulosilyticus DSM2522 is 99%, is initially identified as Bacillus cellulosilyticus.
Extract the genomic dna of alkali lake basophilic bacterium Bacillus cellulosilyticus SN5, after partially digested with restriction enzyme Sau3A I, cut the fragment of glue recovery 3-9kb, be connected with the pUC118 carrier that cuts phosphorylation through BamH I enzyme, transformed competence colibacillus cell E.coli DH5 α, be coated on the LB flat board and [contain 100Amp, 0.5M IPTG and 0.2%RBB-xylan (Remazol Brilliant Blue R-D-Xylan, sigma company product, catalog number (Cat.No.): M5019), pH8.0] on, 37 ℃ of overnight incubation obtain approximately 6000 clone's, wherein around 2 clone's transparent circle appears, positive clone's.
Insert Fragment to the contained plasmid of positive colony checks order, and obtains the ORF with 1047 Nucleotide, 348 amino acid of encoding.The aminoacid sequence that this ORF is found in sequence homology comparison has 71% similarity with aminoacid sequence from the endoxylanase of Paenibacillus sp.E18, belongs to glycosyl hydrolase 10 family members, with its called after Bcxyl10A.
2, the acquisition of zytase and encoding gene thereof
Take the genomic dna of Bacillus cellulosilyticus SN5 as template, the primer is as follows: forward primer 5 ' GCATGGATCCATGTTAATGAGTGATTATGGGAGGA 3 ' (comprise BamH I enzyme and cut recognition site, sequence 3); Reverse primer 5 ' GCTACTCGAGTGAATTTGCAACTTTGATTAATTCA 3 ' (comprise Xho I enzyme and cut recognition site, sequence 4) carries out pcr amplification, and the pcr amplification condition is as follows: 95 ℃ of denaturation 5min of elder generation, then 95 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 90s, totally 35 circulations; Last 72 ℃ are extended 7min, obtain the PCR product of 1067bp.
Above-mentioned PCR reaction product is cut glue reclaim purifying, get the again template of PCR of product 1 μ l conduct, the primer and amplification condition are all the same.To again PCR reaction product cycle-pure kit purifying, with BamH I and Xho I double digestion, enzyme is cut product and is connected with 4 ℃ of T4 ligase enzymes with the pET28a carrier of cutting through same enzyme (available from Promega company) and spends the night, connect product and transform the bacillus coli DH 5 alpha competent cell, obtain recombinant bacterium.Extract the plasmid sequence verification of recombinant bacterium, the result shows, PCR product in this plasmid has the Nucleotide shown in the sequence 1 in the sequence table, be Bcxyl10A with the unnamed gene of its PCR product, the albumen called after Bcxyl10A of this genes encoding, the aminoacid sequence of this albumen is the sequence 2 in the sequence table, and the sequence 1 in the sequence table is inserted between the BamH I and Xho I site of pET28a called after pET28a-Bcxyl10A.
Also but artificial synthesized sequence 1, adopts above-mentioned method to obtain equally pET28a-Bcxyl10A.
1, contains the acquisition of the recombinant bacterium of Xylanase coding gene
Recombinant plasmid pET28a-Bcxyl10A is transformed among the expression competence host BL21 (DE3), obtain recombinant bacterium BL21 (DE3)/pET28a-Bcxyl10A, extracting plasmid checks order, plasmid is pET28a-Bcxyl10A, illustrates that structure obtains containing the recombinant bacterium BL21 (DE3) of this plasmid/pET28a-Bcxyl10A.
Adopting uses the same method changes empty carrier pET28a among the BL21 (DE3) over to, obtain recombinant bacterium BL21 (DE3)/pET28a, extract plasmid and carry out the PCR evaluation, primer is forward 5 ' GCATGGATCCATGTTAATGAGTGATTATGGGAGGA 3 ' (sequence 3); Reverse5 ' GCTACTCGAGTGAATTTGCAACTTTGATTAATTCA 3 ' (sequence 4), the result does not obtain the purpose fragment, illustrates to make up to obtain turning empty carrier recombinant bacterium BL21 (DE3)/pET28a.
2, the acquisition of zytase and determination of activity
1) extraction of zytase and purifying
A, cultivation
Single colony inoculation to the kantlex final concentration of the recombinant bacterium BL21 (DE3) that above-mentioned steps 1 is obtained/pET28a-Bcxyl10A is in the 5ml LB liquid nutrient medium of 50 μ g/ml, cultivates 12h for 37 ℃.Nutrient solution is forwarded in the fresh LB liquid nutrient medium of 2L according to 1% inoculum size, and 37 ℃ are cultured to OD600 and reach 0.6, and adding final concentration again in substratum is the IPTG of 1mM, and 25 ℃ are continued inducing culture 10h.The centrifugal 10min of nutrient solution 6000g is collected thalline.
B, extraction
With thalline be resuspended in 40ml binding buffer liquid (20mM Tris-HCl, 500mM NaCl, the 10mM imidazoles, pH7.9) in, ultrasonication thalline (16v, 20min), 4 ℃, the centrifugal 10min of 15,000g collects supernatant liquor, is the Bcxyl10A crude extract.
C, purifying
Crude extract is crossed His Bind Column (production of Novagen company) purifying: wash pillar with 5ml binding buffer liquid before the loading; Treat that binding buffer drops to chromatographic medium surface, the careful crude enzyme liquid for preparing that adds; 1 * binding buffer with 10 times of bed volumes washes, and removes unconjugated foreign protein; 1 * wash buffer of 5 times of bed volumes washes, and removes in conjunction with weak foreign protein; 1 * elute buffer of 5 times of bed volumes washes.Approximately 5ml discards initial 0.2ml and last 1.8ml, the 3ml (albumen mainly concentrates on this zone) in the middle of collecting.
To collect liquid and carry out desalination in AKTA FPLC system, the desalination condition is: damping fluid: 20mM Tris-HCl, pH8.0; Flow velocity: 3ml/min collects protein peak.
Sample solution behind employing centrifugal concentrating pipe (production of the Milipore company) concentrating and desalinating is to 1ml, be loaded to Superdex 75 10/300GL posts (GE company product) and carry out sieve chromatography, level pad is that 20mMTris-HCl (contains 0.15M NaCl, pH8.0), flow velocity 0.3ml/min, collect the sample of each protein peak, SDS-PAGE identifies the sample of each elution peak, keeps the sample (the wash-out column volume begins to occur this product when being 9.78ml) that contains Bcxyl10A.Take recombinant bacterium BL21 (DE3)/pET28a and BL21 (DE3) as contrast.
Purified product is carried out the SDS-PAGE electrophoretic analysis, the results are shown in Figure 1,1: molecular weight Marker; 2:BL21 (DE3)/pET28a lysate supernatant; 3: crude enzyme liquid; 4: cross the ni-sepharose purification result; 5: molecular sieve purification result; Swimming lane 3-5 has size that the albumen of 45kD (please provide) is provided, and than theoretical value (because N end and the C of recombinant protein holds the one section His label that contains on the carrier) bigger than normal, purified product is Bcxyl10A.
Recombinant bacterium BL21 (DE3)/pET28a and BL21 (DE3) are contrast, do not obtain size and are that the target protein of 45kD, its eluted product are respectively contrast purified product 1 and contrast purified product 2.
2) determination of activity of zytase
To above-mentioned steps 1) purified product, contrast purified product 1 and the contrast purified product 2 that obtain carry out respectively the enzyme biopsy and survey.1 enzyme unit alive (U) is defined as: under the certain condition, it is a unit that per minute produces the needed enzyme amount of 1 μ mol wood sugar.
The reaction system of enzyme activity determination is as follows: it is 50mM that 0.5g beech wood glycan (Xylan from beechwood, sigma, X4252) is dissolved in 100ml concentration, in Sodium phosphate dibasic-citrate buffer solution of pH7.0, obtains the xylan substrate solution; Get the above-mentioned xylan substrate solution of 480 μ l, being the above-mentioned steps 1 of 0.05mg/ml with 20 μ l concentration respectively) the purified product Bcxyl10A, contrast purified product 1 and the contrast purified product 2 that obtain mix, behind 40 ℃ of reaction 10min, add equal-volume DNS reagent, and then boil the 5min colour developing.After the instant cooling, get 200 μ l, the light absorption value at test 540nm place.
Three repetition are established in experiment, and results averaged, result show, above-mentioned steps 1) the enzyme average specific vigor of purified product Bcxyl10A of acquisition is 84.5u/mg (mg is the dry weight of enzyme).
And the average specific vigor of contrast purified product 1 and contrast purified product 2 enzymes is 0, further proves step 1) the purified product Bcxyl10A that obtains is zytase.
3, zymologic property characterizes
Following experiment is triplicate, results averaged.
The mensuration of A, the suitableeest enzymatic reaction temperature
Get 480 μ l above-mentioned steps 2 2) the xylan substrate solution, add 20 μ l concentration and be 0.05mg/ml above-mentioned steps 2 1) the zytase Bcxyl11A that obtains, mix rear respectively under 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃ and 65 ℃, according to above-mentioned steps 2 2) the enzyme activity determination method measure the enzyme of zytase Bcxyl10A under differing temps and live, to determine the suitableeest enzymatic reaction temperature.
The result can find out that optimum temperuture is 40 ℃ as shown in Figure 2, and the activity of enzyme 40 ℃ the time is set as 100%, and then between 20-50 ℃, relative reactivity reaches more than 50%.In the time of 25 ℃, have 80% enzyme and live, belong to cold-adapted enzyme.
The mensuration of B, the suitableeest enzymatic reaction pH value
The beech wood glycan is dissolved in respectively in the following damping fluid of 50mM: Na
2HPO
4/ citric acid (pH4.6-7.6),, among Tris/HCl (pH 7.6-8.8) and the glycine/NaOH (pH 8.8-10.4), prepare 0.5% xylan substrate solution of different pH values.Get the xylan substrate solution of the above-mentioned different pH values of 480 μ l, add 20 μ l concentration and be 0.05mg/ml above-mentioned steps 2 1) the zytase Bcxyl10A that obtains, mix rear under 40 ℃, according to above-mentioned steps 2 2) the enzyme activity determination method measure the enzyme of zytase Bcxyl10A under condition of different pH and live, to determine the pH value of the suitableeest enzymatic reaction.
The result can find out as shown in Figure 3: the optimum pH of enzyme is 7.0, and the activity of enzyme when the pH7.0 is set as 100%, and then between pH6-8.4, relative reactivity reaches more than 50%.
The mensuration of C, thermostability
With above-mentioned steps 2 1) the zytase Bcxyl10A that obtains is with the Na of 50mM pH6
2HPO
4It is 0.05mg/ml that/citric acid damping fluid is diluted to final concentration, above-mentioned enzyme liquid is incubated 10min, 20min and 30min at 40 ℃ respectively, then according to above-mentioned steps 2 2) the enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl10A, to measure the thermostability of above-mentioned zytase Bcxyl10A.
The result can find out as shown in Figure 4, and the Bcxyl10A thermostability is relatively poor, under the condition of pH 6.0,40 ℃ of insulation 10min, 20min and 30min, remnant enzyme activity reach respectively that initial enzyme lives 62.2%, 32.5% and 22.8%.
D, pH stability
With above-mentioned steps 2 1) the zytase Bcxyl10A that obtains is with the different damping fluid [Na of 50mM
2HPO
4/ citric acid (pH 4.0-7.6), Tris/HCl (pH 7.6-8.8) and glycine/NaOH (pH 8.8-10.4)] to be diluted to final concentration be 0.05mg/ml, place 4 ℃ to deposit 24h, then according to above-mentioned steps 2 2) the enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl10A, to measure the pH stability of zytase Bcxyl10A.
The result can find out as shown in Figure 5, and Bcxyl10A has widely pH stability, and is the most stable when pH6, and after pH5.6-9.6 temperature was bathed 24h, remnant enzyme activity reached more than 80%, but is higher than 9.6 or be lower than 5.6 o'clock enzymes and live loss seriously.
E, the salt ion resistance is tested
With above-mentioned steps 2 1) the zytase Bcxyl10A that obtains is respectively at the Na of the 0.5% beech wood glycan substrate that contains the NaCl of different concns (0-4M)
2HPO
4In/citric acid damping fluid (50mM, the pH7.0) solution, according to above-mentioned steps 2 2) the enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl10A, to measure above-mentioned zytase Bcxyl10A to the resistance of high salt.
The result can find out as shown in Figure 6, and in the substrate that contains 0.5M NaCl, activity is the highest, reaches 134.5%.
F, to the test of the tolerance of salt ion
With above-mentioned steps 2 1) the zytase Bcxyl10A that obtains places the Na of the NaCl (0-4M) of different concns
2HPO
4/ citric acid damping fluid (50mM, pH6.0) in, take a sample after placing 24h for 4 ℃, according to above-mentioned steps 2 2) the enzyme activity determination method measure the residual enzyme activity of zytase Bcxyl10A, to investigate the tolerance of above-mentioned zytase Bcxyl10A under high salt condition.
The result can find out as shown in Figure 7, and this enzyme still has 47.4% remnant enzyme activity under the high salt condition up to 4M NaCl, still have 87.4% and 50.3% remnant enzyme activity behind the 24h incubation.
Three repeated experiments, result show, above-mentioned steps 2 1) optimal reactive temperature of the zytase Bcxyl10A that obtains is 40 ℃, has 80% enzyme and live in the time of 25 ℃, belongs to cold-adapted enzyme; Optimal reaction pH value is 7.0; The Bcxyl10A thermostability is relatively poor, and under the condition of pH 6.0,40 ℃ are incubated 10min, 20min and 30min, and remnant enzyme activity reaches respectively 62.2%, 32.5% and 22.8%; Bcxyl10A has widely pH stability, and is the most stable when pH6, and after pH5.6-9.6 temperature was bathed 24h, remnant enzyme activity reached more than 80%, but is higher than 9.6 or be lower than 5.6 o'clock enzymes and live loss seriously.This zytase is in the substrate that contains 0.5M NaCl, and activity is the highest, reaches 134.5%, and the 0.5M NaCl salinity of seawater just.This enzyme still has 47.4% remnant enzyme activity under the high salt condition up to 4M NaCl.Simultaneously, this endo-xylanase still has 87.4% and 50.3% remnant enzyme activity behind the 24h incubation in 2M NaCl and 4M NaCl.Experimental data shows, zytase Bcxyl10A belongs to cold-adapted enzyme, has good salt tolerance, has application prospect in sea-food or pickling food processing.
Claims (10)
1. albumen is following (a) or protein (b):
(a) protein that is formed by the aminoacid sequence shown in the sequence in the sequence table 2;
(b) with the amino acid residue sequence of sequence in the sequence table 2 through replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and have the zytase function by (a) derivative protein.
2. the encoding gene of the described albumen of claim 1.
3. encoding gene according to claim 2, it is characterized in that: described encoding gene is following 1)-3) in arbitrary described dna molecular:
1) dna molecular shown in the sequence in the sequence table 1;
2) can be with 1 under stringent condition) dna molecular with the described albumen of zytase function of the dna sequence dna hybridization that limits and coding;
3) with 1) dna sequence dna that limits has the dna molecular that homology more than 90% and coding have the described albumen of zytase function.
4. the recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contain claim 2 or 3 described genes.
5. recombinant vectors according to claim 4 is characterized in that: the recombinant vectors that described recombinant vectors obtains for the encoding gene that inserts the described albumen of claim 1 between the multiple clone site of pET carrier; Described pET carrier is preferably carrier pET28a.
6. recombinant bacterium according to claim 4, it is characterized in that: described recombinant bacterium is that recombinant vectors claimed in claim 5 is imported to the recombinant bacterium that obtains in the e. coli bl21 (DE3).
7. amplification claim 2 or the total length of 3 described genes or the primer pair of its arbitrary fragment, the nucleotides sequence of a primer of described primer pair is classified the sequence 3 in the sequence table as, and the nucleotides sequence of another primer in the described primer pair is classified the sequence 4 in the sequence table as.
8. albumen claimed in claim 1 is as the xylan application of enzymes;
Or the application of albumen claimed in claim 1 in sea-food or pickling food processing.
9. a method for preparing zytase comprises the steps: fermentation culture claim 4 or 6 described recombinant bacteriums, namely obtains zytase.
10. method according to claim 9, it is characterized in that: described culture temperature is 25 ℃, the time of described cultivation is 10h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110317110.7A CN103060289B (en) | 2011-10-18 | 2011-10-18 | Salt-tolerant xylanase, its coding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110317110.7A CN103060289B (en) | 2011-10-18 | 2011-10-18 | Salt-tolerant xylanase, its coding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103060289A true CN103060289A (en) | 2013-04-24 |
| CN103060289B CN103060289B (en) | 2014-05-28 |
Family
ID=48103188
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110317110.7A Expired - Fee Related CN103060289B (en) | 2011-10-18 | 2011-10-18 | Salt-tolerant xylanase, its coding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103060289B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015058700A1 (en) * | 2013-10-25 | 2015-04-30 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101805726A (en) * | 2010-04-19 | 2010-08-18 | 中国科学院微生物研究所 | Heat-resistance neutral xylanase, coding gene and application thereof |
-
2011
- 2011-10-18 CN CN201110317110.7A patent/CN103060289B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101805726A (en) * | 2010-04-19 | 2010-08-18 | 中国科学院微生物研究所 | Heat-resistance neutral xylanase, coding gene and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| RAVI D.BARABOTE ET AL.: "Xyn10A,a thermostable endoxylanase from Acidothermus cellulolyticus 11B", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》 * |
| 王健鑫: "嗜极菌的极端酶的若干研究进展", 《浙江海洋学院学报（自然科学版）》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015058700A1 (en) * | 2013-10-25 | 2015-04-30 | Novozymes A/S | Polypeptides having endoglucanase activity and polynucleotides encoding same |
| US9926548B2 (en) | 2013-10-25 | 2018-03-27 | Novozymes A/S | Nucleic acid constructs and host cells for producing neurospora endoglucanases |
| US10308922B2 (en) | 2013-10-25 | 2019-06-04 | Novozymes A/S | Methods of processing textiles using polypeptides having endoglucanase activity |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103060289B (en) | 2014-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Guerriero et al. | Destructuring plant biomass: focus on fungal and extremophilic cell wall hydrolases | |
| Zhou et al. | Intronless celB from the anaerobic fungus Neocallimastix patriciarum encodes a modular family A endoglucanase | |
| He et al. | Metatranscriptomics of the Hu sheep rumen microbiome reveals novel cellulases | |
| CN101591648B (en) | Method for preparing heat-resistant cutinase-CBD and application thereof in cotton fiber refining | |
| Balasubramanian et al. | Purification and biochemical characterization of a novel thermo-stable carboxymethyl cellulase from Azorean isolate Bacillus mycoides S122C | |
| Eberhardt et al. | Primary sequence and enzymic properties of two modular endoglucanases, Cel5A and Cel45A, from the anaerobic fungus Piromyces equi | |
| Wang et al. | Cloning and characterization of a thermostable and pH-stable cellobiohydrolase from Neocallimastix patriciarum J11 | |
| Meng et al. | The functioning of a novel protein, Swollenin, in promoting the lignocellulose degradation capacity of Trichoderma guizhouense NJAU4742 from a proteomic perspective | |
| CN102286447B (en) | Novel endoxylanase and coding gene and use thereof | |
| Singh et al. | Overview of the process of enzymatic transformation of biomass | |
| CN103060290B (en) | Alkaline xylanase, its coding gene and application | |
| WO2012015605A1 (en) | Polypeptides for use in the deconstruction of cellulose | |
| Begemann et al. | Potential enhancement of biofuel production through enzymatic biomass degradation activity and biodiesel production by halophilic microorganisms | |
| CN104745612A (en) | Genes of high temperature resistant xylanase and high temperature resistant xylosidase and protein expression and application thereof | |
| Dipasquale et al. | Characterization of a native cellulase activity from an anaerobic thermophilic hydrogen-producing bacterium Thermosipho sp. strain 3 | |
| CN103060289B (en) | Salt-tolerant xylanase, its coding gene and application | |
| CN107236692B (en) | Paenibacillus cellulolyticus NP1 and xylanase PtXyn1 as well as encoding gene and application thereof | |
| CN102358898B (en) | Medium-temperature beta-glucosidase BglA1, gene of same and application of same | |
| CN106148369A (en) | High-temperature alkaline transelminase Pel-863 and encoding gene thereof and application | |
| CN103525791B (en) | A kind of high temperature resistant neutral cellulase Cel61P8 and gene thereof and application | |
| CN102154244B (en) | High-temperature acid cellulase EgG5 and gene and application thereof | |
| Goro et al. | Specific adsorption of Clostridium stercorarium xylanase to amorphous cellulose and its desorption by cellobiose | |
| CN104388409A (en) | F85-20 protein, coding gene thereof and application of F85-20 protein as beta-glucosidase | |
| Luzics et al. | Cloning, expression, and biochemical characterisation of a novel endomannanase from Thermobifida alba | |
| Liu et al. | Molecular cloning and characterization of a novel bifunctional cellobiohydrolase/β-xylosidase from a metagenomic library of mangrove soil |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140528 Termination date: 20191018 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |