CN103059110A - Candida albicans apoptosis-promoting factor gene and application thereof - Google Patents
Candida albicans apoptosis-promoting factor gene and application thereof Download PDFInfo
- Publication number
- CN103059110A CN103059110A CN201310001707XA CN201310001707A CN103059110A CN 103059110 A CN103059110 A CN 103059110A CN 201310001707X A CN201310001707X A CN 201310001707XA CN 201310001707 A CN201310001707 A CN 201310001707A CN 103059110 A CN103059110 A CN 103059110A
- Authority
- CN
- China
- Prior art keywords
- cawwm1
- polypeptide
- candida albicans
- sequence
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a candida albicans apoptosis-promoting factor gene CaWWM1 and application thereof, belonging to the technical field of biological medicines. The invention further provides a new apoptosis-promoting factor-CaWwm1 protein, a polynucleotide for encoding the CaWwm1 protein, a method for producing the CaWwm1 protein by a recombination technology and the application of the polynucleotide encoding the CaWwm1 protein, wherein the CaWwm1 is of the protein with the effect of promoting the apoptosis of candida albicans, and the improvement of the expression level can promote the apoptosis of yeast cells.
Description
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to the polynucleotide that new coding Candida albicans apoptosis promotes factor CaWwm1, and the polypeptide of this polynucleotide encoding, the invention still further relates to purposes and the preparation of these polynucleotide and polypeptide, more specifically, the present invention relates to from the genome of Candida albicans, be cloned into the Candida albicans apoptosis and promote factor gene CaWWM1 and uses thereof.
Background technology
Candida albicans is also referred to as Candida albicans (Candida albicans), it is a kind of a kind of opportunistic human body cause illness fungi that is separated to clinically, in the patient of immune down regulation, such as the organ transplantation patient, HIV patient etc., can cause widely superficial part and the infection of deep system, infection site comprises the oral cavity, vagina etc., cause white mouth, the diseases such as vaginitis also can be invaded epidermis and endotheliocyte and enter blood arrival internal organs, such as kidney, brain etc., cause septicemia, seriously can cause death (Odds, F.C.1994.J Am Acad Dermatol.31:S2-S5.).
Apoptosis is that a kind of important cell physiological is movable, is the external stimulus signal causes cell " suicide " by intracellular signal transduction pathway a kind of mechanism, thinks that in the past apoptosis mainly occurs in multicellular organism, plays the effect of coordinator bulk-growth.But, research discovery in recent years, also there is this physiological activity in single celled yeast, acetic acid, hydrogen peroxide, glucose, antifungal drug can cause the yeast apoptosis.Yet the signal transduction of which gene participation yeast cell apoptosis is also not fully aware of actually.Have and be reported in the Bax that expresses higher organism in the yeast saccharomyces cerevisiae, Bax Inhibitor(BI), the apoptosis-related genes such as Caspase can affect the apoptosis rate of yeast saccharomyces cerevisiae, illustrate that there is certain similarity in the mechanism of its apoptosis from the yeast to the higher organism.Find at present, Candida albicans is the meeting apoptosis under the inducing of multiple physical and chemical factor, yet the Study on Molecular Mechanism that the Candida albicans apoptosis is occured it be unclear that.
Because Candida albicans meeting serious threat people's is healthy, therefore, relevant various albumen or the factor of exploitation Candida albicans apoptosis, significant for better control infection by Candida albicans.
Summary of the invention
The purpose of this invention is to provide a kind of new apoptosis relevant with the Candida albicans growth promote factor CaWwm1 albumen with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, novel isolated CaWwm1 polypeptide is provided, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.
Preferably, this polypeptide is selected from lower group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have function that the regulation and control candida albicans hyphal forms by (a) derivative polypeptide.
More preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of these polypeptide of coding separation are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from lower group: (a) polynucleotide of the above-mentioned Candida albicans CaWwm1 polypeptide of coding; (b) polynucleotide complementary with polynucleotide (a).Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is to be selected from lower group a kind of: the sequence that (a) has 1-711 position among the SEQ ID NO:1; (b) has the sequence of 1-708 position among the SEQ ID NO:1; Or (c) has translation initiation codon among the SEQ ID NO:1 to the sequence of terminator codon.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or the host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of Candida albicans CaWwm1 protein-active, the method comprises: (a) under the condition that is fit to expression Candida albicans CaWwm1 albumen, cultivate the above-mentioned host cell that is converted or transduces; (b) from culture, isolate the polypeptide with Candida albicans CaWwm1 protein-active.
In a fifth aspect of the present invention, provide the antibody of being combined with above-mentioned Candida albicans CaWwm1 polypeptid specificity.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism Candida albicans CaWwm1 polypeptide active is provided, and the compound that suppresses the expression of Candida albicans CaWwm1 polypeptide.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is the encoding sequence of Candida albicans CaWwm1 polypeptide or the antisense sequences of its fragment.
In a seventh aspect of the present invention, the method that whether has CaWwm1 albumen in the test sample is provided, it comprises: the specific antibody of sample with CaWwm1 albumen contacted, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample CaWwm1 albumen.
In a eighth aspect of the present invention, a kind of disease relevant with Candida albicans CaWwm1 polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, the method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.For example polypeptide of the present invention can be used to screen the agonist that promotes Candida albicans CaWwm1 polypeptide active, and perhaps screening suppresses the antagonist of Candida albicans CaWwm1 polypeptide active or be used to the peptide fingerprinting spectrum to identify.The encoding sequence of Candida albicans CaWwm1 albumen of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps for the manufacture of gene chip or microarray.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains antagonist or inhibitor or antibody and the pharmaceutically acceptable carrier of the Candida albicans CaWwm1 polypeptide of the present invention of safe and effective amount (such as 0.001-99.99wt%).These pharmaceutical compositions can be treated the illnesss such as infection by Candida albicans.
Description of drawings
Following accompanying drawing is used for specific embodiments of the present invention is described, limits the scope of the invention that is defined by claims and be not used in.
Fig. 1 has shown Candida albicans CaWwm1 protein factor and Saccharomyces Cerevisiae in S cWwm1 protein factor structural domain relatively.
Fig. 2 has shown that utilizing PCR to increase obtains the CaWWM1 gene coding region from Candida albicans gene group DNA.
Fig. 3 is Northern hybridization figure, has shown the expression situation at Candida albicans bacterial strain SC5314 yeast type and the lower CaWWM1 gene of mycelia type growth conditions.Take the CaACT1 gene as contrast.
Fig. 4 shown in yeast saccharomyces cerevisiae express the CaWWM1 gene after, the cells survival rate of yeast saccharomyces cerevisiae under the effect of acetic acid and hydrogen peroxide.Result's demonstration, CaWwm1 albumen has improved the apoptosis rate of yeast saccharomyces cerevisiae in acetic acid and hydrogen peroxide, and this effect is in the situation that lower concentration is especially obvious.
Fig. 5 has shown that there are interaction in the CaWwm1 factor and the CaMca1 factor.
Embodiment
The inventor has cloned a kind of promotion Candida albicans antiapoptotic factors gene C aWwm1 first by extensive and deep research in Candida albicans.Particularly, the inventor utilizes the genetic expression principle, high expression level CaWWM1 in yeast saccharomyces cerevisiae, cause the brewing yeast cell survival rate than the obvious reduction of control cells, especially under lower concentration acetic acid and hydrogen peroxide effect, the expression of CaWWM1 gene in yeast saccharomyces cerevisiae causes the brewing yeast cell apoptosis rate to improve, and illustrates that CaWwm1 albumen is an important short antiapoptotic factors in the Candida albicans, has finished the present invention on this basis.
In the present invention, term " CaWwm1 albumen ", " CaWwm1 polypeptide " or " apoptosis promotes factor CaWwm1 " are used interchangeably, and all refer to have albumen or the polypeptide that the Candida albicans apoptosis promotes factor CaWwm1 aminoacid sequence (SEQ ID NO:2).They comprise that the apoptosis that contains or do not contain initial methionine promotes factor CaWwm1.
As used herein, " separation " refers to that material separates (if natural substance, primal environment namely is natural surroundings) from its primal environment.Do not have separation and purification such as the polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " CaWwm1 albumen or the polypeptide of separation " refers to that the CaWwm1 polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying CaWwm1 albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of CaWwm1 polypeptide can be used amino acid sequence analysis.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of Candida albicans CaWwm1 albumen.As used herein, term " fragment ", " derivative " refer to basically keep the identical biological function of natural Candida albicans CaWwm1 albumen of the present invention or active polypeptide with " analogue ".Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (such as leader sequence or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the formation of antigen I gG fragment).
In the present invention, term " Candida albicans CaWwm1 polypeptide " refers to have the polypeptide of the SEQID NO:2 sequence of Candida albicans CaWwm1 protein-active.This term also comprises having and variant form Candida albicans CaWwm1 albumen identical function, SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): one or morely (be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing with the close or similar amino acid of performance, usually can not change the function of protein.Again such as, add the function that or several amino acid also can not change protein usually at C-terminal and/or N-terminal.This term also comprises active fragments and the reactive derivative of Candida albicans CaWwm1 albumen.This term also comprises with the aminoacid sequence shown in the SEQ ID NO:2 having at least 70%, preferably at least 80%, more preferably at least 90%, and at least 95% sequence homogeny best, and the polypeptide with function that the regulation and control candida albicans hyphal forms.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low stringency condition can with the coded albumen of the DNA of Candida albicans CaWwm1DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of antifungal CaWwm1 polypeptide to obtain.The present invention also provides other polypeptide, as comprises the fusion rotein of Candida albicans CaWwm1 polypeptide or its fragment.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of Candida albicans CaWwm1 polypeptide.Usually, this fragment have Candida albicans CaWwm1 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
Invention also provides the analogue of Candida albicans CaWwm1 albumen or polypeptide.The difference of these analogues and natural Candida albicans CaWwm1 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not affect on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise genetic variant natural or that induce.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(such as D-amino acid), and the analogue with that non-natural exists or synthetic amino acid (such as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(usually the not changing primary structure) form of modification comprises: chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing such as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (such as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (such as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " Candida albicans CaWwm1 albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out amino acid substitution according to table 1 and produce.
Table 1
Initial residue | Representational replacement | The preferred replacement |
Ala(A) | Val;Leu;Ile | Val |
Arg(R) | Lys;Gln;Asn | Lys |
Asn(N) | Gln;His;Lys;Arg | Gln |
Asp(D) | Glu | Glu |
Cys(C) | Ser | Ser |
Gln(Q) | Asn | Asn |
Glu(E) | Asp | Asp |
Gly(G) | Pro;Ala | Ala |
His(H) | Asn;Gln;Lys;Arg | Arg |
Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
Lys(K) | Arg;Gln;Asn | Arg |
Met(M) | Leu;Phe;Ile | Leu |
Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
Pro(P) | Ala | Ala |
Ser(S) | Thr | Thr |
Thr(T) | Ser | Ser |
Trp(W) | Tyr;Phe | Tyr |
Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " refers in the present invention encode and has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; The encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural occurs.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from the function of the polypeptide that changes in fact its coding.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " refers to: (1) than the hybridization under low ionic strength and the comparatively high temps and wash-out, such as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, such as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (such as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding CaWwm1 albumen.
Polypeptide among the present invention preferably provides with the form of separating with polynucleotide, more preferably is purified to homogeneous.
Candida albicans CaWwm1 Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain in large quantity relevant sequence with recombination method.This normally is cloned into carrier with it, changes cell over to again, then separates obtaining relevant sequence from the host cell after the propagation by ordinary method.
In addition, also can synthesize relevant sequence, especially fragment length more in short-term with the method for synthetic.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully by chemosynthesis obtain the encoding dna sequence dna of CaWwm1 albumen of the present invention (or its fragment, or derivatives thereof).Then this dna sequence dna can be introduced in various existing dna moleculars as known in the art (or such as carrier) and the cell.In addition, also can will suddenly change by chemosynthesis and introduce in the CaWwm1 protein sequence of the present invention.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is such as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or CaWwm1 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or the CaWwm1 polypeptide of Restruction.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention Candida albicans CaWwm1 polypeptide, or with the recombinant expression vector that contains these polynucleotide appropriate host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, Candida albicans CaWwm1 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell is viral, mammalian cell is viral such as adenovirus, retrovirus or other carriers.Applicable carrier includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is usually to contain replication orgin, promotor, marker gene and translation controlling elements.
Method well-known to those having ordinary skill in the art can be used for make up and contain Candida albicans CaWwm1 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise the (Sambroook such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body, et al.Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989).Described dna sequence dna can be effectively connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; But eukaryotic promoter comprises CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, the LTRs of retrovirus and the promotor that some other known controlling gene is expressed in protokaryon or eukaryotic cell or its virus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, phenotypic character with the host cell that is provided for selecting transforming, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness such as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise above-mentioned suitable dna sequence dna and the suitable carrier of promotor or control sequence, can be used for transforming suitable host cell, with can marking protein.
Host cell can be prokaryotic cell prokaryocyte, such as bacterial cell; Or the eukaryotic cell such as low, such as yeast cell; Or higher eucaryotic cells, such as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art are all known the suitable carrier of How to choose, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can in exponential growth after date results, be used CaCl
2Method is processed, and used step is well-known in this area.Another kind method is to use MgCl
2If necessary, transforming also the method for available electroporation carries out.When the host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, substratum used in the cultivation can be selected from various conventional mediums.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (such as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular be expressed or be secreted into to recombinant polypeptide in the above methods can in cell or at cytolemma.If necessary, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation processes, process the combination of (salt analysis method), centrifugal, the broken bacterium of infiltration, super processing, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods with protein precipitant.
Candida albicans CaWwm1 albumen or the polypeptide of restructuring are of use in many ways.These purposes include, but is not limited to: be used for antibody, polypeptide or other part that screening promotes or resist the CaWwm1 protein function.The peptide molecule that can suppress Candida albicans CaWwm1 protein function that can be used for seeking therapeutic value with the restructuring Candida albicans CaWwm1 protein screening peptide library of expressing.
On the other hand, the present invention also comprises Candida albicans CaWwm1DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " refers to that antibody capable is incorporated into Candida albicans CaWwm1 gene product or fragment.Preferably, refer to that those can be combined with Candida albicans CaWwm1 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the molecule of Candida albicans CaWwm1 albumen, comprise that also those do not affect the antibody of Candida albicans CaWwm1 protein function.The present invention also comprise those can with the antibody of modifying or being combined without the Candida albicans CaWwm1 gene product of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, such as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered scFv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the Candida albicans CaWwm1 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expression Candida albicans CaWwm1 albumen or its cell with antigenic fragment can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see the people such as Kohler,
Nature256; 495,1975; The people such as Kohler,
Eur.J.Immunol.6:511,1976; The people such as Kohler,
Eur.J.Immunol.6:292,1976; The people such as Hammerling,
In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block Candida albicans CaWwm1 protein function and the antibody that does not affect Candida albicans CaWwm1 protein function.Each antibody-like of the present invention can utilize fragment or the functional zone of Candida albicans CaWwm1 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize the recombination method preparation or utilize Peptide synthesizer synthetic.The antibody of being combined with the unmodified form of Candida albicans CaWwm1 gene product can come immune animal and produces with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli); The antibody of being combined with the posttranslational modification form (such as albumen or the polypeptide of glycosylation or phosphorylation) can come immune animal and obtains with the gene product that produces in the eukaryotic cell (for example yeast or insect cell).
The antibody of antifungal CaWwm1 albumen can be used in the immunohistochemistry technology, detects the Candida albicans CaWwm1 albumen in the biopsy specimen.
The disease that antibody among the present invention can be used for treating or prevention is relevant with Candida albicans CaWwm1 albumen.The antibody that gives suitable dosage can stimulate or block generation or the activity of Candida albicans CaWwm1 albumen.
Antibody also can be used for being designed to the immunotoxin for a certain privileged sites in the body.As the monoclonal antibody of Candida albicans CaWwm1 albumen high-affinity can with bacterium or plant poison (such as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the Candida albicans of expressing CaWwm1 albumen.
The production of polyclonal antibody available Candida albicans CaWwm1 albumen or polypeptide immune animal, such as rabbit, mouse, rat etc.Multiple adjuvant can be used for strengthening immune response, includes but not limited to freund's adjuvant etc.
Utilize CaWwm1 albumen of the present invention, by various conventional screening methods, can filter out with CaWwm1 albumen interactional material occurs, such as antibody, inhibitor, agonist or antagonist etc.
The antibody of CaWwm1 albumen of the present invention, inhibitor or antagonist etc. when when (administration) used in treatment, can provide different effects.Usually, but these materials are formulated in nontoxic, inertia with pharmaceutically acceptable aqueous carrier medium in, wherein pH is about 5-8 usually, preferably pH is about 6-8, although the pH value can change to some extent with the character that is formulated material and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): in the oral cavity, intravaginal, intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
For example, the antibody of CaWwm1 albumen of the present invention, inhibitor or antagonist can be directly used in disease treatment, for example, are used for suppressing the normal growth of Candida albicans, and then alleviate the infection that Candida albicans is caused.When using CaWwm1 albumen of the present invention, also can use simultaneously the other treatment agent, such as other anti-mycotic agent fluconazoles etc.
The present invention also provides a kind of pharmaceutical composition, and it contains antibody or its antagonist and pharmaceutically acceptable carrier or the vehicle of the CaWwm1 polypeptide of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as Tablet and Capsula can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, Tablet and Capsula should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 5 mg/kg body weight of 1 microgram/kg body weight-Yue.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, that antagonist or antibody with the CaWwm1 albumen of safe and effective amount is applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than approximately 8 mg/kg body weight, preferably this dosage is the about 1 mg/kg body weight of 10 micrograms/kg body weight-Yue.Certainly, concrete dosage also should be considered the factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Can be incorporated into the random peptide library that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of Candida albicans CaWwm1 obtains.During screening, must carry out mark to Candida albicans CaWwm1 protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization Candida albicans CaWwm1 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The Candida albicans CaWwm1 protein level that detects in the test can be as judging whether Candida albicans can cause serious infection.
A kind of method that whether has CaWwm1 albumen in the test sample that detects is to utilize the specific antibody of CaWwm1 albumen to detect, and it comprises: sample is contacted with the CaWwm1 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample CaWwm1 albumen.
The polynucleotide of CaWwm1 albumen can be used for the diagnosis of CaWwm1 protein related diseases.Aspect diagnosis, whether the polynucleotide of CaWwm1 albumen can be used for detecting the CaWwm1 protein expression.Can be used for the hybridization of biopsy specimen unusual to judge the CaWwm1 protein expression such as the CaWwm1DNA sequence.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe and is fixed on microarray (microarray) or the DNA chip (being called again " gene chip "), is used for analyzing Differential expression analysis and the gene diagnosis of tissue gene.Carry out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect CaWwm1 albumen with the special primer of CaWwm1 albumen.
The sudden change that detects the CaWwm1 gene also can be used for the disease of diagnosing CaWwm1 albumen relevant.The form of CaWwm1 protein mutation comprises that the point mutation compared with normal wild type CaWwm1DNA sequence, transposition, disappearance, restructuring and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might affect protein expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
In an example of the present invention, a kind of polynucleotide of separation are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.Polynucleotide of the present invention are isolated from the Candida albicans cDNA library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 711 bases, and its open reading frame is positioned at the 1-711 position, and the coding total length is 236 amino acid whose Candida albicans CaWwm1 albumen (SEQ ID NO:2).CaWwm1 albumen has potential application prospect for the treatment infection by Candida albicans provides new treatment approach.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment
Material
(1) material
Restriction enzyme, T4DNA ligase enzyme, probe mark test kit are all available from American I nvitrogen company; Zymolase (Zymolyase100T) is available from Japanese Seikagaku company; Pickling glass pearl (425~600 μ m), Calcoflour White fluorescence dye, FLAG M2 antibody, proteinase inhibitor is all available from Sigma company, the proteinG-bead suspension is available from Roche company, GFP antibody is available from Santa Cruz company, and ECL reagent is used for the KOD plus of pcr amplification available from the Toyobo company of Japan available from Pierce company.
Universal method:
(1) Candida albicans gene group DNA extracting
The Candida albicans overnight incubation is washed 1 time with ddH2O, be suspended in (1M sorbyl alcohol in the 500 μ l solution A, 100mM EDTA pH8.0), the zymolase (Zymolase) that adds 5 μ l20mg/ml, 37 ° of C placed after 1 hour, and high speed centrifugation removes supernatant, and cell is with 500 μ lTE damping fluid (20mM Tris.HCl pH7.5,1mM EDTA) washes once, be suspended in the 350 μ lTE damping fluids, and add 90 μ l solution B (250mM EDTA pH8.0,400mM Tris.HCl pH8.0,2%SDS), 65 ° of C placed 30 minutes, added 80 μ l5M KAc, placed on ice 1 hour, high speed centrifugation 5 minutes, draw supernatant and add the dehydrated alcohol of 1ml ,-20 ° of C placed high speed centrifugation 5 minutes 20 minutes, precipitation is washed once centrifugal post-drying with 70% ethanol.
(2) conversion of yeast saccharomyces cerevisiae
Prepare PEG/LiAc solution (pH7.5) 10m1; In 1.5mI Eppendof pipe, add successively plasmid 5 μ g, 10 μ l10mg/ml milt DNA, mixing; Add 0.1ml competent cell and 0.6m1PEG/LiAc, the votex mixing; 30 ℃ of 200rpm cultivate 30min; Add 70 μ l DMSO, gently mixings; 42 ℃ of thermal shocking 15min, during frequently shake up gently; Ice bath 2min: high speed centrifugation 15s, sop up supernatant, use the 0.2m1TE re-suspended cell; Coat on the nutrition screening SD flat board.
(3) detection of yeast transformant betagalactosidase activity
Get a Whatman filter paper, be covered in (carbon source is semi-lactosi) on the corresponding selective medium, with sterilizing toothpick from the selective medium flat board picking yeast conversion daughter colony (diameter 1~2mm) point is to filter paper, cultivated 2 days for 30 ℃, then take out careful the immersion in the liquid nitrogen (bacterium colony faces up), approximately take out behind the 0.5min, put the room temperature several minutes, filter paper (bacterium colony faces up) is put in Z damping fluid/X-gal solution (X-gal, the 0.27ml beta-mercaptoethanol that add 1.67ml20g/L in the 100mlZ damping fluid; Z buffer contains 60mmol/L Na
2HPO
4, 40mmol/L NaH
2PO
4, 10mmol/L KCl, 1mmol/L MgSO
4) on the filter paper of prewetting, cultivate 0.5~8h for 30 ℃, whether the check bacterium colony is aobvious blue.Aobvious blue bacterium colony betagalactosidase activity is positive in the 8h.
(4) Candida albicans total protein extracting, immunoprecipitation and Western B1ot detect
The Candida albicans bacterial strain is cultured to OD=1 in YPD, collecting cell, with 400 μ l yeast cell lysate (20mMTris-HCl pH7.5,1mM EDTA, 150mM NaCl, 0.5%NP-40) be resuspended in 400 μ l yeast cell lysates after the washing 3 times, add 0.5mm pearl (bead) 0.5g and proteinase inhibitor (protease inhibitor cocktail, available from Sigma company) in 0 ℃, on Fastprep120, vibrate three times each 30 seconds with 5m/s.The centrifugal 15min of 12000rpm draws supernatant, centrifugal 15min again, and the collection supernatant is cell lysate.Get 500 μ l cell lysates, add anti-FLAG M2 monoclonal antibody (available from Sigma company) (1 μ g/ reaction), at 4 ℃ of vibration 1h.The centrifugal 2min of 12000rpm adds 50%protein G-agarose (available from the Roche company) suspension that 30 μ l cross with yeast cell lysate balance in supernatant, 4 ℃ of vibration 2h.Immunoprecipitate is washed three times with IP damping fluid (20mM Tris-HCl pH7.5,2mM EGTA, 150mM NaCl, 1%NP-40,1mM DTT).Then be resuspended in 1 * protein electrophorese sample-loading buffer, carry out 10% SDS-PAGE electrophoresis.
With wet method protein band is transferred on the nitrocellulose filter, with the TBS-T that contains 5% skim-milk (10mM Tris-HCl (pH7.5), 150mM NaCl, 0.1%Tween-20) solution closing membrane 2-3 hour, 4 ℃ of combinations of anti-FLAG and anti-GFP (Santa Cruz) (antibody dilution is 1:1000) are spent the night, wash film four times with the TBS-T room temperature, each 15 minutes.Resist in room temperature in conjunction with 2 hours with two, wash film four times with TBS-T again, each 15 minutes.Exhaust unnecessary liquid with thieving paper, use the ECL reagent colour development.
CDNA sequence and the existing public dna sequence data storehouse measured are compared, found that a cDNA clone's dna sequence dna is new full-length cDNA.
CaWwm1cDNA is 5073bp (Fig. 1 and SEQ ID NO:1), contains complete open frame 5073bp, and coding contains the polypeptide (Fig. 2 and SEQ ID NO:2) of 1690 amino-acid residues.
Embodiment 1
Acquisition and the sequential analysis of Candida albicans CaWWM1 gene
We obtain a gene fragment in Candida albicans gene is analyzed, the method for utilizing the homologous sequence search from Candida albicans (Candida albicans) genome sequence (
Http:// genolist.pasteur.fr/CandidaDB/) search for its upstream and downstream sequence, obtain full length coding region.
According to Search Results, synthetic following primer:
Upstream primer: ATGACCAAAGACGATTCTAAAAAC (SEQ ID NO:3)
Downstream primer: CTAGAAGTCTCCGCCGCCAAAG (SEQ ID NO:4)
Take wild-type Candida albicans gene group DNA as template, the PCR reaction by routine obtains the approximately amplified production of 0.7Kb of length.
Carry out two-way mensuration by the synthetic contained dna sequence dna of a series of primer pair amplified productions.Computer Analysis shows, the contained full length DNA of this amplified production is a new dna sequence dna (shown in SEQ ID NO:1), 236 the new amino acid whose protein (shown in SEQ ID NO:2) of encoding.This protein is named as CaWwm1 albumen, its encoding gene called after CaWWM1 gene.
Utilize the search of BLAST structural domain and homology comparative analysis, find that this gene product and yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) WWM1 gene product has certain homology, carry out homology comparing amino acid sequence identity (identity) by Jotun Hein method and reach 42%, therefore be this unnamed gene CaWWM1, its corresponding coded product is CaWwm1.By domain analyses, find that CaWwm1 contains the WW structural domain.Therefore sequence comparing analysis shows that Candida albicans CaWWM1 gene is the homologous gene of Saccharomyces Cerevisiae in S cWWM1 gene, and the Candida albicans CaWwm1 factor is the homologous protein of the Saccharomyces Cerevisiae in S cWwm1 factor.
Embodiment 2
CaWWM1 genetic expression detects in the Candida albicans
In order to detect the CaWWM1 gene in the expression of Candida albicans, we carry out the Northern hybrid experiment with the CaWWM1 full-length gene label probe of 1.3kb.We are with SC5314 overnight incubation in YPD, then be transferred to respectively 30 ℃ YPD substratum (thalli growth condition) and 37 ℃ middle the cultivation 3 hours of YPD increase serum substratum (mycelial growth condition), extracted total RNA, the hybridization of CaWWM1 gene probe, detect its expression level, take the CaACT1 gene probe results of hybridization of constitutive expression as contrast, the result shows, CaWWM1 all has expression in above-mentioned bacterial strains, and expression amount is basic identical, illustrates that CaWwm1 is the albumen that the Candida albicans normal growth is played an important role.
Embodiment 3
Expression CaWWM1 gene in yeast saccharomyces cerevisiae causes the yeast saccharomyces cerevisiae apoptosis rate to improve
Utilize following primer amplification CaWWM1 full-length gene:
Upstream primer: GCTCGAGATGACCAAAGACGATTCTAAAAAC
Downstream primer: GCTCGAGCTAGAAGTCTCCGCCGCCAAAG
Utilize XhoI that amplified production and Yeast Plasmid pVTU are carried out enzyme and cut, enzyme is cut and is transformed intestinal bacteria after product connects, and the screening recon obtains recombinant plasmid pVTU-CaWWM1.With the pVTU empty plasmid, pVTU-CaWWM1 changes yeast saccharomyces cerevisiae over to respectively, uses respectively acetic acid and the hydrogen peroxide-induced yeast saccharomyces cerevisiae apoptosis of different concns, and induction method is pressed the document operation.The result shows, change the brewing yeast cell survival rate of pVTU-CaWWM1 plasmid over to than the obvious reduction of control cells, especially under lower concentration acetic acid and hydrogen peroxide effect, illustrate that the expression of CaWWM1 gene in yeast saccharomyces cerevisiae causes the brewing yeast cell apoptosis rate to improve.
Embodiment 4
Exist between CaWwm1 albumen and the CaMca1 albumen and interact
The expression plasmid that CaWwm1 and DBP LexA are merged and with CaMca1(Metacaspase) the expression plasmid cotransformation (plasmid and bacterial strain are all available from CLontech company) in yeast HLY819 that merges with transcriptional activation domain.Utilize betagalactosidase activity to detect, show to exist specificity to interact between two albumen.CaMca1 is the core protein factor in the apoptosis process, and CaWwm1 and its existence interact and show in its apoptosis process that may participate in the driving of CaMca1 albumen.
The generation of anti-CaWwm1 protein antibodies
The restructuring Candida albicans CaWwm1 albumen that obtains is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule separates rear for subsequent use with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band is downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days, with the same antigen of non-complete Freund ' s adjuvant emulsion, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation Candida albicans CaWwm1 protein gene translation product with it.Found that, antibody can be combined with CaWwm1 albumen of the present invention specifically.
SEQUENCE LISTING
<110〉Shaoxing University
<120〉the Candida albicans apoptosis promotes factor gene and uses thereof
<130> 1
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 711
<212> DNA
<213〉Candida albicans (Candida albicans)
<220>
<221> CaWWM1
<222> (1)..(711)
<220>
<221> CDS
<222> (1)..(708)
<400> 1
atg acc aaa gac gat tct aaa aac cca cca caa gtt cct gat gga tgg 48
Met Thr Lys Asp Asp Ser Lys Asn Pro Pro Gln Val Pro Asp Gly Trp
1 5 10 15
gtg gcc aaa ttt gac gaa gag tat tct aca tgg tat tat gtc gac ttg 96
Val Ala Lys Phe Asp Glu Glu Tyr Ser Thr Trp Tyr Tyr Val Asp Leu
20 25 30
aag aca aag aaa tcc caa tgg gat gct cca gct gga aca aga ttt gat 144
Lys Thr Lys Lys Ser Gln Trp Asp Ala Pro Ala Gly Thr Arg Phe Asp
35 40 45
agc aaa tct gct ggt gac gac gtt ccg cca cca gct tat agt ccc aca 192
Ser Lys Ser Ala Gly Asp Asp Val Pro Pro Pro Ala Tyr Ser Pro Thr
50 55 60
gaa ttc aaa tca agg tct aat gcc cca agc ggt aat caa cca cgt ccg 240
Glu Phe Lys Ser Arg Ser Asn Ala Pro Ser Gly Asn Gln Pro Arg Pro
65 70 75 80
gca gct tca aat cca aat aca caa aga gat tac caa caa ggg cct cca 288
Ala Ala Ser Asn Pro Asn Thr Gln Arg Asp Tyr Gln Gln Gly Pro Pro
85 90 95
caa ggt caa tat tac caa caa ggg ccg cca caa ggt caa tat tat caa 336
Gln Gly Gln Tyr Tyr Gln Gln Gly Pro Pro Gln Gly Gln Tyr Tyr Gln
100 105 110
caa ggc ccc cca cag ggt cag tat tac cag caa ggt cca cca cag ggt 384
Gln Gly Pro Pro Gln Gly Gln Tyr Tyr Gln Gln Gly Pro Pro Gln Gly
115 120 125
cag tat tac caa caa ggt cca cca cag ggt cag tat tac caa caa ggc 432
Gln Tyr Tyr Gln Gln Gly Pro Pro Gln Gly Gln Tyr Tyr Gln Gln Gly
130 135 140
cca cca cca gga caa tat tat caa caa gga cca cca caa ggt caa tat 480
Pro Pro Pro Gly Gln Tyr Tyr Gln Gln Gly Pro Pro Gln Gly Gln Tyr
145 150 155 160
tac cag cag caa caa caa caa caa cca caa aaa caa agt cga ttt ggt 528
Tyr Gln Gln Gln Gln Gln Gln Gln Pro Gln Lys Gln Ser Arg Phe Gly
165 170 175
ggt ggt gct ggg agc atg gca tta ggt gtt ggt ggt ggt ttg tta gga 576
Gly Gly Ala Gly Ser Met Ala Leu Gly Val Gly Gly Gly Leu Leu Gly
180 185 190
ggt atg cta ttg gga aat gct atc aat agt tgg gaa gat cat gag aga 624
Gly Met Leu Leu Gly Asn Ala Ile Asn Ser Trp Glu Asp His Glu Arg
195 200 205
atg gag ggt tac caa gat ggt tat caa gat ggt tat gat aat ggt ggt 672
Met Glu Gly Tyr Gln Asp Gly Tyr Gln Asp Gly Tyr Asp Asn Gly Gly
210 215 220
gac tac gat ggt ggt gac ttt ggc ggc gga gac ttc tag 711
Asp Tyr Asp Gly Gly Asp Phe Gly Gly Gly Asp Phe
225 230 235
<210> 2
<211> 236
<212> PRT
<213〉Candida albicans (Candida albicans)
<400> 2
Met Thr Lys Asp Asp Ser Lys Asn Pro Pro Gln Val Pro Asp Gly Trp
1 5 10 15
Val Ala Lys Phe Asp Glu Glu Tyr Ser Thr Trp Tyr Tyr Val Asp Leu
20 25 30
Lys Thr Lys Lys Ser Gln Trp Asp Ala Pro Ala Gly Thr Arg Phe Asp
35 40 45
Ser Lys Ser Ala Gly Asp Asp Val Pro Pro Pro Ala Tyr Ser Pro Thr
50 55 60
Glu Phe Lys Ser Arg Ser Asn Ala Pro Ser Gly Asn Gln Pro Arg Pro
65 70 75 80
Ala Ala Ser Asn Pro Asn Thr Gln Arg Asp Tyr Gln Gln Gly Pro Pro
85 90 95
Gln Gly Gln Tyr Tyr Gln Gln Gly Pro Pro Gln Gly Gln Tyr Tyr Gln
100 105 110
Gln Gly Pro Pro Gln Gly Gln Tyr Tyr Gln Gln Gly Pro Pro Gln Gly
115 120 125
Gln Tyr Tyr Gln Gln Gly Pro Pro Gln Gly Gln Tyr Tyr Gln Gln Gly
130 135 140
Pro Pro Pro Gly Gln Tyr Tyr Gln Gln Gly Pro Pro Gln Gly Gln Tyr
145 150 155 160
Tyr Gln Gln Gln Gln Gln Gln Gln Pro Gln Lys Gln Ser Arg Phe Gly
165 170 175
Gly Gly Ala Gly Ser Met Ala Leu Gly Val Gly Gly Gly Leu Leu Gly
180 185 190
Gly Met Leu Leu Gly Asn Ala Ile Asn Ser Trp Glu Asp His Glu Arg
195 200 205
Met Glu Gly Tyr Gln Asp Gly Tyr Gln Asp Gly Tyr Asp Asn Gly Gly
210 215 220
Asp Tyr Asp Gly Gly Asp Phe Gly Gly Gly Asp Phe
225 230 235
Claims (10)
1. the Candida albicans CaWwm1 polypeptide of a separation is characterized in that, this polypeptide is selected from lower group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have promote the apoptosis function by (a) derivative polypeptide.
2. polypeptide as claimed in claim 1, it is characterized in that: this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
3. the polynucleotide of a separation is characterized in that, it comprises a nucleotide sequence, and this nucleotide sequence is selected from lower group:
(a) the as claimed in claim 1 polynucleotide of polypeptide of encoding;
(b) polynucleotide complementary with polynucleotide (a).
4. polynucleotide as claimed in claim 3 is characterized in that, the sequence of these polynucleotide is selected from lower group a kind of:
(a) has the sequence of 1-711 position among the SEQ ID NO:1;
(b) has the sequence of 1-708 position among the SEQ ID NO:1.
5. carrier, it is characterized in that: it contains polynucleotide claimed in claim 3.
6. genetically engineered host cell, it is characterized in that: it contains carrier claimed in claim 5.
7. the preparation method of a peptide species is characterized in that, the method comprises:
(a) under conditions suitable for the expression, cultivate host cell claimed in claim 7;
(b) from culture, isolate Candida albicans CaWwm1 protein polypeptide.
8. antibody that energy is combined with Candida albicans CaWwm1 protein-specific claimed in claim 1.
9. whether there is the method for CaWwm1 albumen in the test sample, it is characterized in that: sample is contacted with antibody claimed in claim 9, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample CaWwm1 albumen.
10. such as the described polypeptide of claim 1-9, polynucleotide and encoding sequence, can be used for screening the agonist that promotes Candida albicans CaWwm1 polypeptide active, screening suppresses the antagonist of Candida albicans CaWwm1 polypeptide active, perhaps being used to the peptide fingerprinting spectrum identifies, polynucleotide can be used for the diagnosis of CaWwm1 protein related diseases, the encoding sequence of Candida albicans CaWwm1 albumen or its fragment, can be used as primer and be used for pcr amplification reaction, perhaps be used for hybridization as probe, perhaps for the manufacture of gene chip or microarray.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310001707XA CN103059110A (en) | 2013-01-05 | 2013-01-05 | Candida albicans apoptosis-promoting factor gene and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310001707XA CN103059110A (en) | 2013-01-05 | 2013-01-05 | Candida albicans apoptosis-promoting factor gene and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103059110A true CN103059110A (en) | 2013-04-24 |
Family
ID=48102035
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310001707XA Pending CN103059110A (en) | 2013-01-05 | 2013-01-05 | Candida albicans apoptosis-promoting factor gene and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103059110A (en) |
-
2013
- 2013-01-05 CN CN201310001707XA patent/CN103059110A/en active Pending
Non-Patent Citations (2)
Title |
---|
GENBANK: "XP_718234.1", 《GENBANK》 * |
TED JONES: "The diploid genome sequence of Candida albicans", 《PNAS》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JPH10509415A (en) | Conotoxin peptide | |
Wang et al. | A multigene family of Heteractis magnificalysins (HMgs) | |
US20130034558A1 (en) | Epidermal growth factor receptor variant | |
CN1948335B (en) | Candida albicans mycellium regulating and controlling factor gene and its use | |
CN100480379C (en) | Candida albicans CTD protein kinase gene and application therefor | |
CN103059110A (en) | Candida albicans apoptosis-promoting factor gene and application thereof | |
DK172400B1 (en) | Process for preparing purified minactivin, a minactivin- encoding DNA molecule, a recombinant DNA molecule, a fused gene, a host, a reagent for locating and defining the limits of tumours in histological samples, and the use of recombinaint DNA molecule and the minactivin and peptides thereof | |
CN101362798B (en) | Candida albicans hyphal development inhibitor and application thereof | |
CN100497380C (en) | White-/grey transformation regulation factor gene of Candida albicans and its uses | |
US7544485B2 (en) | Baldness related gene and the polypeptide encoded thereby, and uses | |
CN100480264C (en) | Earthworm protein suppressing cancer cell accretion by road spectrum and coding sequence thereof | |
CN1952129A (en) | ANGPTL4 deletion mutant and application thereof | |
JPH11243969A (en) | New murd | |
CN100425695C (en) | Novel human Rab GTP enzyme, its coding sequence and application | |
CN101638624B (en) | Hyphal development related gene of candida albicans and application thereof | |
US7485621B2 (en) | Tumor tag and the use thereof | |
CN100443501C (en) | Mitochondria traffic protein molecule for human marrow stromal cell and sequence encoding same and use thereof | |
CN1778816B (en) | Human cell surface membrane molecule and use thereof | |
CN100355782C (en) | New liver cancer up expressing gene and its encoded protein and application | |
JP2623807B2 (en) | Serine protease and serine protease gene | |
CN100519578C (en) | White candidas transcription factor gene and its use | |
CN100543133C (en) | Phosphokinase and application thereof | |
CN102443056A (en) | Exon deleted variant of epidermal growth factor receptor | |
CN100480263C (en) | Immunosuppressive receptor derived from dendritic cell, coding sequence and uses thereof | |
CN100358917C (en) | Tumor tag and the use thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130424 |