CN100497380C - White-/grey transformation regulation factor gene of Candida albicans and its uses - Google Patents
White-/grey transformation regulation factor gene of Candida albicans and its uses Download PDFInfo
- Publication number
- CN100497380C CN100497380C CNB2005100305852A CN200510030585A CN100497380C CN 100497380 C CN100497380 C CN 100497380C CN B2005100305852 A CNB2005100305852 A CN B2005100305852A CN 200510030585 A CN200510030585 A CN 200510030585A CN 100497380 C CN100497380 C CN 100497380C
- Authority
- CN
- China
- Prior art keywords
- catos9
- candida albicans
- polypeptide
- sequence
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a new white Monilia white-opaque transition modulating factor CaTos9 protein and polynucleotide to code CaTos9 protein and application, which improves shape transition rate and mating efficiency.
Description
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to new coding Candida albicans white/polynucleotide of grey transformation regulatory factor CaTOS9 gene, and the polypeptide of this polynucleotide encoding.The invention still further relates to the purposes and the preparation of these polynucleotide and polypeptide.
Background technology
Candida albicans is also referred to as Candida albicans (Candida albicans), it is a kind of a kind of opportunistic human body cause illness fungi that is separated to clinically, in the patient of immune down regulation, as the organ transplantation patient, HIV patient etc., can cause superficial part and the infection of deep system widely, infection site comprises the oral cavity, vagina etc., cause white mouth, diseases such as vaginitis also can be invaded epidermis and endotheliocyte and enter blood arrival internal organs, as kidney, brain etc., cause septicemia, seriously can cause death (Odds, F.C.1994.J Am Acad Dermatol.31:S2-S5.).
Candida albicans presents different growthhabits under different growth conditionss, comprise thalline (yeast form), pseudohypha (pseudohyphae) and mycelia (hyphae).Mutual conversion capability between the various forms directly influences pathogenecity (Odds, the F.C.1985.Crit Rev Microbiol.12:45-93 of Candida albicans; Brown, A.J.P.et al.1999.Trends Microbiol.7:334-338.), its system's infection ability of the bacterial strain of mycelial growth defective descends or disappears (Lo, H.J.et al, 1997.Cell.90:939-949; Braun, B.R.et al.2001.EMBO is J.20:4753-61; Hwang, C.S.et al.2003.Mol Microbiol.47:1029-43).
Many culture condition can cause the modality of Candida albicans, comprise serum, temperature, and the pH value, nitrogenous source utilization and oxygen are pressed or the like.
The molecular mechanism of regulating the Candida albicans modality in the cell mainly contains MAPK approach (mitogen-activaied protein kinase pathway) and cAMP/PKA approach (cAMP-dependent protein kinase Apathway).Also find what Cph2 mediated simultaneously, relevant (Lane, S.et al.2001.Mol Cell Biol.21:6418-28 also all take place with the form of Candida albicans in Efg1 signal pathway mediation and that pH replys; Stoldt, V.R., etal.1997.EMBO are J.16:1982-1991; El Barkani, A.et al.2000.Mol Cell Biol.20:4635-4647.).
The signal pathway that also has retarding effect in Candida albicans mainly is the signal pathway of Tup1 mediation, relies on specific DNA in conjunction with supressor Rfg1, and Nrg1 waits play a role (Kadosh, D.et al.2001.MolCell Biol.21:2496-2505; Braun, B.R.et al.2001.EMBO are J.20:4753-4761.).
The another kind of important modality of Candida albicans, promptly white/ash (white/opaque) changes, finds in the isolating clinically W/O-1 bacterial strain.White bacterium and grey bacterium are expressed a series of special genes (white or opaquespecific genes) separately, as genes such as white mycetocyte single-minded expression WH11 and EFG1, and genes such as grey mycetocyte single-minded expression OP4 and SAP4.The bacterium of these two kinds of forms also has different pathogenic, and white bacterium has stronger pathogenecity in system infects, and grey bacterium has stronger pathogenecity in epidermis infects.
Before 4 years, Candida albicans is considered to a kind of amphiploid yeast always, does not have sexual generation.Gene order-checking finds, exist on No. 5 karyomit(e)s of Candida albicans the MAT site that is similar to yeast saccharomyces cerevisiae (Mating-type-like sites, MTL).MTLa1, MTL α 1 and MTL α 2 are found.Subsequently, Magee and Johnson laboratory find independently that separately the pseudohaploid Candida albicans of MTLa1 or MTL α 1MTL α 2 disappearances can mating (mating) form tetraploid.The mating of Candida albicans is not only regulated and control in the MTL site, and regulating and control Candida albicans white/grey modality.Have only the pseudohaploid of MTLa1 or MTL α 2 disappearances that white/grey modality is just arranged.Found afterwards that WO-1 was the strain of MTLa1 disappearance.On the other hand, white/ash conversion influences the mating of Candida albicans again.The white mycetocyte of mating efficiency ratio of ash mycetocyte is high by 10
6Doubly.Thereby Candida albicans is by the process of MTL site and white/dual regulation and control mating of grey modality.
Yet, also do not report white/grey transformation regulatory factor of Candida albicans up to now.
Because Candida albicans meeting serious threat people's is healthy, therefore, this area presses for exploitation various albumen or the factor relevant with growth, course of infection or the toxicity of Candida albicans, so that prevent and treat the infection that Candida albicans causes better.
Summary of the invention
The purpose of this invention is to provide a kind of new white/grey transformation regulatory factor CaTos9 albumen relevant with infection by Candida albicans with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of these polypeptide of coding.
Another object of the present invention provides the method for these polypeptide of production and the purposes of this polypeptide and encoding sequence.
In a first aspect of the present invention, provide a kind of novelty, isolated Candida albicans is white/grey transformation regulatory factor CaTos9 polypeptide, it comprises: polypeptide or its conservative property variation polypeptide or its active fragments or its reactive derivative with SEQ ID NO:2 aminoacid sequence.
Preferably, this polypeptide is selected from down group:
(a) has the polypeptide of SEQ ID NO:2 aminoacid sequence;
(b) SEQ ID NO:2 aminoacid sequence process is one or more (as 1-50, preferably 1-20,1-10 more preferably) replacement, disappearance or the interpolation of amino-acid residue form, and have the regulation and control Candida albicans white/function of grey modality by (a) polypeptides derived.
More preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 70% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned Candida albicans CaTos9 polypeptide of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (i) has 1451-3805 position among the SEQ ID NO:1; The sequence that (ii) has 1-4300 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
In a fourth aspect of the present invention, provide preparation to have the method for the polypeptide of Candida albicans CaTos9 protein-active, this method comprises: (a) be fit to cultivate the above-mentioned host cell that is transformed or transduce under the proteic condition of expression Candida albicans CaTos9; (b) from culture, isolate polypeptide with Candida albicans CaTos9 protein-active.
In a fifth aspect of the present invention, provide and above-mentioned Candida albicans CaTos9 polypeptid specificity bonded antibody.
In a sixth aspect of the present invention, the compound of simulation, promotion, antagonism Candida albicans CaTos9 polypeptide active is provided, and the compound that suppresses Candida albicans CaTos9 polypeptide expression.The method of screening and/or prepare these compounds also is provided.Preferably, this compound is encoding sequence or its segmental antisense sequences of Candida albicans CaTos9 polypeptide.
In a seventh aspect of the present invention, provide and whether had the proteic method of CaTos9 in the test sample, it comprises: sample is contacted with the proteic specific antibody of CaTos9, observe whether form antibody complex, formed antibody complex and just represented to exist in the sample CaTos9 albumen.
In a eighth aspect of the present invention, a kind of disease relevant with Candida albicans CaTos9 polypeptide unconventionality expression or method of disease susceptibility of detecting is provided, this method comprises: whether have sudden change in the nucleotide sequence of detection coding said polypeptide.
In a ninth aspect of the present invention, provide the purposes of polypeptide of the present invention and encoding sequence.Polypeptide of the present invention can be used to screen the agonist that promotes Candida albicans CaTos9 polypeptide active, and perhaps screening suppresses the antagonist of Candida albicans CaTos9 polypeptide active or is used to the peptide finger print identification.The proteic encoding sequence of Candida albicans CaTos9 of the present invention or its fragment can be used as primer and be used for pcr amplification reaction, perhaps are used for hybridization as probe, perhaps are used to make gene chip or microarray.
In a preference, Candida albicans CaTos9 polypeptide or gene are used to prepare the reagent that detects Candida albicans, and perhaps screening suppresses CaTOS9 expression or active inhibitor or antagonist, or suppress CaTOS9 as screening and express or active target spot.
In a tenth aspect of the present invention, a kind of pharmaceutical composition is provided, it contains antagonist or inhibitor or the antibody and the pharmaceutically acceptable carrier of the Candida albicans CaTos9 polypeptide of the present invention of safe and effective amount (as 0.001-99.99wt%).These pharmaceutical compositions can suppress the lime transformation of Candida albicans and then suppress the infection of Candida albicans.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Figure 1A has shown the nucleotide sequence of CaTOS9 gene, comprises the sequence of 5 ' promoter region 1450bp and 3 ' non-coding region 492bp.
Figure 1B has shown the proteic aminoacid sequence of Candida albicans CaTos9.
Fig. 1 C has shown Candida albicans CaTos9 and fission yeast Gti1 protein structure domain.
Fig. 1 D has shown Candida albicans CaTos9 and fission yeast SpGfi1, the comparison of the Tos9 structural domain of yeast saccharomyces cerevisiae Yel007w and fission yeast Pac2.
Fig. 2 has shown the transcriptional level of CaTOS9 gene in the strain of different transcription factor disappearance.
Fig. 3 A has shown the strategy that knocks out the CaTOS9 gene in Candida albicans.
Fig. 3 B has identified the result that knocks out of CaTOS9 with the Southern blotting.
Fig. 3 C has detected transcriptional level and the CaTOS9 single copy of CaTOS9 in WO-1 white corpuscle and gray cell with the Northern blotting and has knocked out transcriptional level in the strain.
Fig. 4 has shown the influence that the Candida albicans lime is changed that knocks out of CaTOS9 gene.
Fig. 5 has shown the influence to Candida albicans mating efficient of knocking out of CaTOS9 gene.
Fig. 6 has shown the Subcellular Localization of CaTos9 protein factor.
Fig. 7 A has shown that heterogenous expression CaTOS9 can promote the growth of yeast saccharomyces cerevisiae mycelia.
Fig. 7 B has shown that heterogenous expression CaTOS9 can promote the yeast saccharomyces cerevisiae intussusception.
Fig. 7 C has shown that heterogenous expression CaTOS9 can strengthen yeast saccharomyces cerevisiae FLO11 expression of gene level.
In each accompanying drawing, White represents white bacterium, and opaque represents grey bacterium, and control represents contrast.
Embodiment
The inventor is by extensive and deep research, in Candida albicans, cloned first a kind of white/the grey transformation regulatory factor.Particularly, the inventor utilizes the strain of yeast saccharomyces cerevisiae flo8 disappearance to proofread and correct by function, has obtained Candida albicans CaTOS9 full-length gene.Cross expression CaTOS9 and can promote growth of yeast saccharomyces cerevisiae mycelia and intussusception.In Candida albicans, knock out CaTOS9 and cause the forfeiture of Candida albicans, in the strain of Catos9 disappearance, express CaTOS9 again, can reply its ability again from white to grey modality from white to grey modality ability.In addition, the CaTOS9 gene knocks out the efficient that has reduced mating between the Candida albicans.Utilize the GFP fluorescin to serve as a mark, prove that CaTos9 is positioned in the nucleus.These results show, CaTos9 be Candida albicans white-ash (white-opaque) modality and the necessary nucleus of high-level efficiency mating in regulatory factor, thereby influence the pathogenic of Candida albicans.Finished the present invention on this basis.
In the present invention, term " transformation in vain/grey (form) ", " white/grey (form) changed " or " changing in vain-grey (form) " etc. are used interchangeably, and all refer to the transformation from ash to white form perhaps take place the conversion of Candida albicans generation from white to grey form.
In the present invention, term " CaTos9 albumen ", " CaTos9 polypeptide " or " white/grey transformation regulatory factor CaTOS9 " are used interchangeably, all refer to have Candida albicans white/albumen or the polypeptide of grey transformation regulatory factor CaTOS9 aminoacid sequence (SEQ ID NO:2).They comprise the white/grey transformation regulatory factor CaTOS9 that contains or do not contain initial methionine.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating CaTos9 albumen or polypeptide " is meant that the CaTos9 polypeptide is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying CaTos9 albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of Candida albicans CaTos9, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function or the active polypeptide of natural Candida albicans CaTos9 albumen of the present invention basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying, or with the fusion rotein of the segmental formation of antigen I gG).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
In the present invention, term " Candida albicans CaTos9 polypeptide " refers to have the SEQ ID NO:2 polypeptide of sequence of Candida albicans CaTos9 protein-active.This term also comprises having and variant form Candida albicans CaTos9 albumen identical function, SEQ ID NO:2 sequence.These variant forms comprise (but being not limited to): one or more (it is individual to be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of Candida albicans CaTos9 and reactive derivative.This term also comprises with the aminoacid sequence shown in the SEQ ID NO:2 having at least 70%, preferably at least 80%, more preferably at least 90%, at least 95% sequence homogeny best, and have the regulation and control Candida albicans white/polypeptide of the function of grey modality.
The variant form of this polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of Candida albicans CaTOS9 DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-Candida albicans CaTos9 polypeptide to obtain.The present invention also provides other polypeptide, as comprises Candida albicans CaTos9 polypeptide or its segmental fusion rotein (as the fusion rotein that forms with GST, 6His etc.).Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of Candida albicans CaTos9 polypeptide.Usually, this fragment have Candida albicans CaTos9 peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
The present invention's invention also provides the analogue of Candida albicans CaTos9 albumen or polypeptide.The difference of these analogues and natural Candida albicans CaTos9 polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " Candida albicans CaTos9 albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, there are 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or the proteic polynucleotide of separation coding CaTos9.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
Candida albicans CaTOS9 gene nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully by chemosynthesis obtain the encoding dna sequence dna of CaTos9 albumen of the present invention (or its fragment, or derivatives thereof).This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.In addition, also can will suddenly change and introduce in the CaTos9 protein sequence of the present invention by chemosynthesis.
Use method (Saiki, the et al.Science 1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to obtain the cDNA of total length from the library, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or CaTos9 albumen coded sequence, and the method that produces polypeptide of the present invention through recombinant technology.
Recombinant DNA technology (Science, 1984 by routine; 224:1431), can utilize polymerized nucleoside acid sequence of the present invention to can be used to express or produce the CaTos9 polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention Candida albicans CaTos9 polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
Among the present invention, Candida albicans CaTOS9 polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on T7 of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains Candida albicans CaTOS9 DNA sequences encoding and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in protokaryon or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
The extracellular can be expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The Candida albicans CaTos9 albumen or the polypeptide of reorganization are of use in many ways.These purposes include, but is not limited to: be used to screen antibody, polypeptide or other part that promotes or resist the CaTos9 protein function.The peptide molecule that can suppress Candida albicans CaTos9 protein function that can be used for seeking therapeutic value with the reorganization Candida albicans CaTos9 protein screening peptide library of expressing.
On the other hand, the present invention also comprises Candida albicans CaTOS9 DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody." specificity " is meant that antibody capable is incorporated into Candida albicans CaTOS9 gene product or fragment.Preferably, refer to that those can combine with Candida albicans CaTOS9 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Among the present invention antibody comprise those can in conjunction with and suppress the proteic molecule of Candida albicans CaTos9, comprise that also those do not influence the antibody of Candida albicans CaTos9 protein function.The present invention also comprise those can with modify or without the Candida albicans CaTOS9 gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule (people such as Ladner, U.S. Patent No. 4,946,778); Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the Candida albicans CaTOS9 gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Similarly, expressing Candida albicans CaTos9 albumen or its has antigenic segmental cell and can be used to immune animal and produce antibody.Antibody of the present invention also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology prepare (see people such as Kohler,
Nature256; 495,1975; People such as Kohler,
Eur.J.Immunol.6:511,1976; People such as Kohler,
Eur.J.Immunol.6:292,1976; People such as Hammerling,
In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).Antibody of the present invention comprises the antibody that can block Candida albicans CaTos9 protein function and the antibody that does not influence Candida albicans CaTos9 protein function.Each antibody-like of the present invention can utilize the fragment or the functional zone of Candida albicans CaTOS9 gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.Can come immune animal and produce with the gene product of producing in the prokaryotic cell prokaryocyte (for example E.Coli) with the unmodified form bonded antibody of Candida albicans CaTOS9 gene product; With posttranslational modification form bonded antibody (as the albumen or the polypeptide of glycosylation or phosphorylation), the gene product that produces in the available eukaryotic cell (for example yeast or insect cell) is come immune animal and is obtained.
The proteic antibody of anti-Candida albicans CaTos9 can be used in the immunohistochemistry technology, detects the Candida albicans CaTos9 albumen in the biopsy specimen.
Antibody among the present invention can be used for treating or prevention and the relevant disease of Candida albicans CaTos9 albumen.The antibody that gives suitable dosage can stimulate or block proteic generation of Candida albicans CaTos9 or activity.
Antibody also can be used for being designed to the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of Candida albicans CaTos9 albumen high-affinity can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing the proteic Candida albicans of expression CaTos9.
The production of polyclonal antibody available Candida albicans CaTos9 albumen or polypeptide immune animal, as rabbit, mouse, rat etc.Multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.
Utilize CaTos9 albumen of the present invention,, can filter out with CaTos9 albumen interactional material takes place, as antibody, inhibitor, agonist or antagonist etc. by various conventional screening methods.
The proteic antibody of CaTos9 of the present invention, inhibitor or antagonist etc. when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): in the oral cavity, intravaginal, intramuscular, intraperitoneal, intravenously, subcutaneous, intracutaneous or topical.
For example, the proteic antibody of CaTos9 of the present invention, inhibitor or antagonist can be directly used in disease treatment, for example, are used to suppress the normal growth of Candida albicans, and then alleviate the infection that Candida albicans is caused.When using CaTos9 albumen of the present invention, also can use the other treatment agent simultaneously, as other anti-mycotic agent fluconazoles etc.
The present invention also provides a kind of pharmaceutical composition, and it contains antibody or its antagonist and the pharmaceutically acceptable carrier or the vehicle of the anti-CaTos9 polypeptide of safe and effective amount.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that proteic antagonist of the CaTos9 of safe and effective amount or antibody are applied to Mammals, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with the protein bound peptide molecule of Candida albicans CaTos9 obtains.During screening, should carry out mark to Candida albicans CaTos9 protein molecular.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization Candida albicans CaTos9 protein level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The Candida albicans CaTos9 protein level that is detected in the test can be as judging whether Candida albicans can cause serious infection.
Whether having the proteic method of CaTos9 in a kind of detection test sample is to utilize the proteic specific antibody of CaTos9 to detect, and it comprises: sample is contacted with the CaTos9 protein specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample CaTos9 albumen.
The proteic polynucleotide of CaTos9 can be used for the diagnosis of CaTos9 protein related diseases.Aspect diagnosis, whether the proteic polynucleotide of CaTos9 can be used for detecting the proteic expression of CaTos9.Can be used for the hybridization of biopsy specimen to judge the proteic abnormal expression of CaTos9 as the CaTOS9 dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of CaTos9 albumen and also can detect the proteic transcription product of CaTos9.
The sudden change that detects the CaTOS9 gene also can be used for the disease of diagnosing CaTos9 albumen relevant.The form of CaTos9 protein mutation comprises that the point mutation compared with normal wild type CaTOS9DNA sequence, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
In an example of the present invention, a kind of isolating polynucleotide are provided, its coding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.Polynucleotide of the present invention are isolated from the Candida albicans genomic library.Its sequence is shown in SEQ ID NO:1, and the polynucleotide sequence total length that it comprises is 4300 bases, and its open reading frame is positioned at the 1451-3805 position, and the coding total length is 785 amino acid whose Candida albicans CaTos9 albumen (SEQ IDNO:2).CaTos9 albumen provides new treatment approach for preventing and treating infection by Candida albicans, has the potential application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Embodiment
Material
Restriction enzyme, T4 dna ligase, probe mark test kit are all available from American I nvitrogen company; Be used for the Toyobo company of the KOD plus of pcr amplification available from Japan, Taq and pfu Taq enzyme are available from Beijing ancient cooking vessel state biotech company.
Universal method:
(1) Candida albicans genome DNA extraction
Candida albicans overnight incubation ddH
2O washes 1 time, be suspended in (1M sorbyl alcohol in the 500 μ l solution A, 100mMEDTA pH8.0), the zymolase (Zymolase) that adds 5 μ l20mg/ml, place after 1 hour for 37 ℃, high speed centrifugation removes supernatant, and cell is with 500 μ lTE damping fluid (20mM TrisHCl pH7.5,1mM EDTA) washes once, be suspended in the 350 μ lTE damping fluids, and add 90 μ l solution B (250mM EDTA pH8.0,400mM TrisHClpH8.0,2% SDS), placed 30 minutes for 65 ℃, add 80 μ l 5M KAc, placed on ice 1 hour, high speed centrifugation 5 minutes, draw supernatant and add the dehydrated alcohol of 1ml, placed high speed centrifugation 5 minutes 20 minutes for-20 ℃, precipitation is washed once with 70% ethanol, the oven dry of centrifugal back.
(2) Southern analyzes
After the Candida albicans genome DNA extraction, genomic dna EcoRI complete degestion, agarose gel after electrophoresis is finished soaks 45min with sex change liquid and neutralizer respectively, nylon membrane soaks into distilled water or 10 x SSC, putting up changes the film platform, glue and intermembranous with the Parafilm sealing adds a 500g counterweight.With 10 x SSC serves as to change the transfer of film liquid to spend the night, and rinsing in second day is dried crosslinked.Film after the crosslinked hybrid pipe of packing into adds 10ml prehybridization solution (6xSSC, 5xdenhardt ' s Reagent, 0.5%SDS, 100 μ g/ml milt DNA are in 42 ℃ of prehybridization 12h, and probe adds 42 ℃ of hybridization of 150 μ l (the spy example of about 1/3 mark) 10-16h at 100 ℃ of sex change 5min.0.1xSSC 0.1%SDS washes two to three times, each 40min takes out film, dries room temperature or-70 ℃ of compressing tablets.Probe mark is with the random primer labelling test kit of Invitrogene company, according to its description operation.The solution that will contain 25ng DNA places ice bath in 100 ℃ of heat denatured 5-10min, adds random primer buffer solution mixture (Random Primers Buffer Mixture) more successively, 2 μ l dCTP, and 2 μ l dGTP, 2 μ l dTTP, 3 μ l[α-
32P]-dATP (10 μ Ci/ μ l), add 1 μ l Klenow enzyme behind the mixing, in 25 ℃ of insulation 1h, with the centrifugal 4min of 3000rpm, collect centrifugate with Sephadex G-25 post, be the probe solution behind the purifying.Probe adds in the hybridization system after 100 ℃ of sex change 5min cooled on ice.
(3) Northern analyzes
With the total RNA of hot phenol method extracting Candida albicans, and Northern hybridization analysis method is carried out according to a conventional method.Each bacterial strain is at YPD, is cultured to the logarithmic phase later stage in 30 ℃, is forwarded to YPD+10% serum, perhaps Lee ' s substratum, and initial OD=0.05, and under relevant temperature, cultivate the fixed time, with the total RNA of hot phenol method extracting Candida albicans.20 μ l applied sample amounts comprise RNA sample 12 μ l (25 μ g), 4 μ l formaldehyde, 2 μ l10xMOPS, 2 μ l sample-loading buffers, 65 ℃ of heating 10min, 0 ℃ of cooling 2min, centrifugal 5s, last sample.Electrophoresis carries out (87mI DEPC treating water, the cold slightly back of heating and melting adds 2.7ml37% formaldehyde for 1g agarose, 10ml 10 x MOPS) containing on the sex change glue of formaldehyde.Deposition condition is 100mA, and 50-70V changes film equally after the 5-7h electrophoresis is finished with the capillary method, changes film liquid with 5 x SSC.After the commentaries on classics film spends the night, take out film, film is parched, UV-crosslinked with Bio-Ra GS Gene LinkerC3protocol, add the 10ml prehybridization solution, 65 ℃, be replaced by the 10ml hybridization solution behind the 2h, add 65 ℃ of hybridization of probe and spend the night, with 2 x SSC, 0.1%SDS washes film twice for 65 ℃, each 30min.The film that hybridization is good does not dry, and wraps-70 ℃ of compressing tablets in back with preservative film.Heavily film 0.5%SDS is washed in hybridization, and 90-100 ℃ of heating 5-10min, or recommend use 0.5%SDS according to Clontech takes out standbyly behind 90-100 ℃ of its naturally cooling of heating 10min relief 10min, as if use immediately, wrap with preservative film and to be placed on-20 ℃ of preservations.
(4) conversion of Candida albicans and yeast saccharomyces cerevisiae
Prepare PEG/LiAc solution (pH7.5) 10m1; In 1.5mI Eppendof pipe, add plasmid (if change yeast saccharomyces cerevisiae, plasmid 0.1 μ g is if change Candida albicans, the about 5 μ g of linearization plasmid) successively, 10 μ l10mg/ml milt DNA, mixing; Add 0.1ml competent cell and 0.6ml PEG/LiAc, the votex mixing; 30 ℃ of 200rpm cultivate 30min; Add 70 μ l DMSO, mixings gently; 42 ℃ of thermal shocking 15min, during shake up gently frequently; Ice bath～2min: high speed centrifugation 15s sops up supernatant, with 0.2ml TE re-suspended cell; Coat on the suitable nutrition screening SD flat board.
(5) Candida albicans white-ash conversion and mating test
MTLa and MTLalpha bacterial strain are by conventional YEPS (Sou
+) substratum selects.Method is as follows: Candida albicans lines Lee ' s substratum (adding 5 μ g/ml phloxin B), cultivates for 23 ℃ and selects white, ash clone in 7 days.(Science 2000, V.289 (5477): carry out by method 310-313) according to Magee and Magee for the Candida albicans mating test.
(6) intussusception of haploid yeast bacterium and cellular form are observed
The single yeast colony of picking is evenly coated the YPD flat board, cultivates 3 days for 30 ℃, is transferred on polylith YPD and the SD flat board with the flannelette of sterilizing, and cultivates 3-5 days for 30 ℃.With uniform water washing plate surface, fail the cell that the cell of intussusception invaded in the agar by flush away can remain.Before and after flushing, take pictures respectively.
The acquisition and the sequential analysis of Candida albicans CaTOS9 gene
The utilization principle that has complementary functions, the Candida albicans genome dna library that ordinary method is made up changes in the conventional monoploid yeast saccharomyces cerevisiae flo8 disappearance strain, screens those and can proofread and correct the gene of this disappearance strain to agar intussusception defective.In current screening, obtain a clone that can proofread and correct flo8 disappearance strain intussusception defective strongly.To this clone through restriction enzyme mapping analysis and sequencing analysis relatively, and from network BLASTn and Candida albicans genome database learn that this clone contains a complete reading frame.
According to comparative result, synthetic following primer:
Upstream primer:
5’ACTTTCTTTCCTAAACATTA3’(SEQ?ID?NO：3)
Downstream primer:
5’AAGGTGAATTCGCAATGACA3’(SEQ?ID?NO：4)
With wild-type Candida albicans genomic dna is template, obtains the amplified production of the about 4.3Kb of length by the PCR reaction of routine.
By synthetic a series of primers the contained dna sequence dna of amplified production is carried out two-way mensuration.Computer Analysis shows that the contained full length DNA of this amplified production is a new dna sequence dna (shown in SEQ ID NO:1 and Figure 1A).
The long 2358bp of CaTOS9 gene open reading frame, 785 the amino acid whose albumen (shown in SEQ IDNO:2 and Figure 1B) of encoding, molecular weight is about 83kD.The CaTos9N-end has a conservative Tos9 structural domain, so this gene is named as CaTOS9.The Tos9 structural domain comprises a conservative die body sequence (KRWTDG), a possible Pka1 phosphorylation site.CaTos9 also comprises a nuclear localization signal sequence.In addition, CaTos9 also comprise the abundant zones of two glutaminases (Q-rich regions, 289-309 and 448-463) and three Serines abundant regional (serine-rich regions, 315-383,534-638 and 711-756) (Fig. 1 C, 1D).
The nucleotide sequence of Candida albicans CaTOS9 gene has sent GenBank login, and is still unexposed before the application.
Embodiment 2
The regulation and control of Candida albicans CaTOS9 gene transcription
In Candida albicans amphiploid wild-type bacteria, the CaTOS9 gene can not be transcribed, but at nrg1, can transcribe in tup1 and the strain of efg1 disappearance.The CaTOS9 genetic transcription is subjected to the regulation and control of mycelial growth regulatory factor Nrg1, Tup1 and Efg1.The CaTOS9 gene has two transcripts, be respectively～3.9kb and～2.5kb.At 25 ℃, under the YPD culture condition, Nrg1 suppresses the expression of the little transcript of CaTOS9.And in tup1 and the strain of efg1 disappearance, no matter be at 25 ℃ (YPD), still be under 37 ℃ of (YPD increase serum) culture condition, two transcript transcriptional levels of CaTOS9 size all improve (Fig. 2).In Candida albicans WO-1 bacterium white corpuscle (white cells), almost detect expression of gene, and two transcripts of CaTOS9 gene size all there is expression (Fig. 3 C) in WO-1 bacterium gray cell (opaque cells) less than CaTOS9.
Embodiment 3
Candida albicans gene C aTOS9 knocks out
In order to study function and the effect of CaTOS9 gene in the Candida albicans form takes place, present embodiment utilizes the PCR method to knock out the CaTOS9 gene.Knock out strategy and see Fig. 3 A.
Concrete grammar is as follows:
Utilize 5 ' primer:
5’GGAACCTGTTTCCAGAAGACCCCATGAACGTGAACGAGGCGTGCTTATAGTTTCTGGAAGGTTTTCCCAGTCACGACGTT3’(SEQ?ID?NO：5)
With 3 ' primer:
5’CGGTGTAATACGACCCAGAAGAATTTCCAACTGCGTCATCTGTTCCAGCAGCAACCAATGTGTGGAATTGTGAGCGGATA3’(SEQ?ID?NO：6)
(wherein 60 bases of 5 ' of each primer end and CaTOS9 dna homolog, 20 bases of 3 ' end and be used for the DNA pairing of pcr amplification template plasmid)
With conventional carrier pGEM-HIS1, and pGEM-URA3 and pGEM-ARG4 (R.Bryce Wilson, DanaDavis, and Aaron P.Mitchell, Journal of Bacteriology, March 1999, p.1868-1874, Vol.181, No.6; Marcus E.Marvin, Robert P.Mason and Annette M.Cashmore, Microbiology150 (2004), 2197-2208; DOI 10.1099/mic.0.27004-0; Or US patent application 20030175712) is template, amplifies two ends and contain product HIS1, URA3 and ARG4 with Candida albicans CaTOS9 gene 60bp homologous sequence.The PCR product of gained is transformed Candida albicans respectively, can obtain the screened marker gene HIS1 of CaTOS9 gene, the transformant that URA3 and ARG4 replace.
The result that knocks out of CaTOS9 gene detects with the Southern hybridization technique and identifies, the result shows that the CaTOS9 gene of two copies is substituted by ARG4 and HIS1 respectively, obtains CaTOS9 and lacks strain (Fig. 3 B) through the knocking out of two-wheeled.
Embodiment 4
CaTos9 be Candida albicans white/grey form changes and the necessary protein regulation factor of mating
In vain-ash (white-opaque) modality is a kind of important form transition regime of Candida albicans, the bacterium of these two kinds of forms has different pathogenecities, white bacterium has stronger pathogenecity in system infects, and grey bacterium has stronger pathogenecity in epidermis infects.The transformation of lime form plays an important role in the Candida albicans pathogenic course.
The experimental observation of the Catos9 disappearance strain that embodiment 3 is obtained shows that the transformation of Candida albicans from white corpuscle (white cell) to gray cell (opaque cell) blocked in knocking out of Catos9 gene.
In addition, the CaTOS9 gene clone in Candida albicans ACT1 promotor back, is imported the ability (Fig. 4) that can reply its white/grey form transformation in the strain of Catos9 disappearance again again.Show that on evidence the sexual propagation of fungi plays an important role in its pathogenic course.The inventor is finding the observation of Catos9 disappearance strain, the CaTOS9 gene knock out the efficient (Fig. 5) that has reduced the Candida albicans mating, the disappearance that the CaTOS9 gene is described has reduced magnetism and the adhesive power between the different in nature Candida albicans cell, means that the CaTOS9 gene will participate in the adhesion process of Candida albicans.
Embodiment 5
CaTos9 is positioned in the Candida albicans nucleus
In the present embodiment, with CaTos9 and GFP fluorescin amalgamation and expression, to observe the location of CaTos9.Method is as follows: CaTOS9 is cloned in Candida albicans GFP expression vector p584, and with GFP segment amalgamation and expression.Transform Candida albicans CAI4 again, recon is lined the 5-FOA flat board, obtain the amalgamation and expression bacterial strain.MTLa and MTLalpha bacterial strain are by conventional YEPS (Sou
+) substratum selects.
No matter found that, be at amphiploid Candida albicans cell, and still in the Candida albicans white corpuscle and gray cell of MTLa type, GFP-CaTos9 is positioned (Fig. 6) in the nucleus.This presentation of results CaTos9 plays regulating and controlling effect in directly in nucleus Candida albicans lime form being changed.
Embodiment 6
Heterogenous expression CaTOS9 expression of gene promotes growth of yeast saccharomyces cerevisiae mycelia and intussusception
In yeast saccharomyces cerevisiae wild strain, ste12 and the strain of flo8 disappearance, cross expression CaTOS9 gene, can promote its mycelial growth (amphiploid) and intussusception (monoploid) (Fig. 7).This promoter action has been walked around Ste20-Ste7-Kss1MAPK approach and cAMP/Pka1 approach.
Northern hybridization shows, the FLO11 expression of gene of having crossed expression CaTOS9 gene activation.FLO11 is important cell wall protein in the growth of yeast saccharomyces cerevisiae mycelia, intussusception and the cell adhesion process, and this further illustrates CaTos9 is an important transcriptional regulator.
Embodiment 7
Recombinant expressed and the purifying of CaTos9 albumen
In this embodiment, be template with the pcr amplification product among the embodiment 1, use corresponding to the ORF5 ' of CaTOS9 and the PCR Oligonucleolide primers of 3 ' end and carry out pcr amplification, the DNA of the ORF of acquisition Candida albicans CaTOS9 is as inserting fragment.
Behind the PCR product purification of Candida albicans CaTos9 gene ORF, insert the multiple clone site of plasmid pGEX-2T (purchasing company) according to a conventional method in American I nvitrogen, form carrier pGEX-2T-CaTOS9, be converted into the competence bacillus coli DH 5 alpha then, the picking positive colony is cut the evaluation direction of insertion with the EcoRI enzyme, and enzyme is cut product in 0.8% agarose gel electrophoresis analysis.Identify back purifying and order-checking (377 type sequenators of ABI company, BigDye
The Terminator test kit, PE company).Confirm through order-checking, inserted complete CaTOS9 encoding sequence.
Choosing the positive DH5 α clone who expresses CaTOS9 is inoculated in 100ml 2 * YTA substratum, 37 ℃ of 300rpm shaking culture 12-15hr, 2 * YTA substratum that 1:10 is diluted in preheating continues shaking culture 1.5hr, add behind the 100mM IPTG to 0.1mM 30 ℃ and induce 2-6hr, 5,4 ℃ of centrifugal 10min of 000g remove supernatant, put and use 50ml1 * PBS (0.14M NaCl on ice, 2.7mM KCl, 10.1mM Na
2HPO
4, 1.8mM KH
2PO
4PH7.3) resuspended, add 20%Triton X-100 to 1% jog 30min again after ultrasonic (B.Braun Labsonic U) fragmentation, then 12,4 ℃ of centrifugal 10min of 000g, supernatant with 0.8 μ m membrane filtration after, cross 1ml 50% glutathione S epharose 4B chromatography column, behind 1 * PBS thorough washing, (pH8.0) room temperature leaves standstill after 30 minutes and collects elutriant for 10mM gsh, 50mM Tris-HCl to add 500ul gsh elution buffer, repeat wash-out 2-3 time, obtain Candida albicans CaTos9 albumen.
Embodiment 8
The generation of anti-CaTos9 protein antibodies
The reorganization Candida albicans CaTos9 albumen that obtains among the embodiment 7 is used for immune animal to produce antibody, and concrete grammar is as follows.Recombinant molecule is standby after separating with chromatography.Also available SDS-PAGE gel electrophoresis separates, electrophoretic band downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.Albumen with 50-100 μ g/0.2ml emulsification carries out peritoneal injection to mouse.After 14 days,, mouse is carried out peritoneal injection with booster immunization with the dosage of 50-100 μ g/0.2ml with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least three times.The sero-fast specific reaction that obtains is active to be assessed in the ability of external precipitation Candida albicans CaTos9 protein gene translation product with it.Found that antibody can combine with CaTos9 albumen of the present invention specifically.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉Candida albicans white/grey transformation regulatory factor gene and uses thereof
<130>058174
<160>6
<170>PatentIn?version3.2
<210>1
<211>4300
<212>DNA
＜213〉Candida albicans (Candida albicans)
<220>
<221>CDS
<222>(1451)..(3805)
<400>1
<210>2
<211>785
<212>PRT
＜213〉Candida albicans (Candida albicans)
<400>2
<210>3
<211>20
<212>DNA
＜213〉oligonucleotide
<400>3
<210>4
<211>20
<212>DNA
＜213〉oligonucleotide
<400>4
<210>5
<211>80
<212>DNA
＜213〉oligonucleotide
<400>5
<210>6
<211>80
<212>DNA
＜213〉oligonucleotide
<400>6
Claims (7)
1. an isolating Candida albicans CaTos9 polypeptide is characterized in that this amino acid sequence of polypeptide is shown in SEQ ID NO:2.
2. isolating polynucleotide is characterized in that, the polypeptide of described polynucleotide encoding aminoacid sequence shown in SEQ ID NO:2.
3. polynucleotide as claimed in claim 2 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(i) sequence of 1451-3805 position among the SEQ ID NO:1;
The (ii) sequence of 1-4300 position among the SEQ ID NO:1.
4. a carrier is characterized in that, it contains the described polynucleotide of claim 2.
5. a genetically engineered host cell is characterized in that, it contains the described carrier of claim 4.
6. the preparation method of the described Candida albicans CaTos9 of claim 1 polypeptide is characterized in that this method comprises:
(a) under conditions suitable for the expression, cultivate the described host cell of claim 5;
(b) from culture, isolate Candida albicans CaTos9 protein polypeptide.
7. energy and the described Candida albicans CaTos9 of claim 1 protein-specific bonded antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100305852A CN100497380C (en) | 2005-10-17 | 2005-10-17 | White-/grey transformation regulation factor gene of Candida albicans and its uses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100305852A CN100497380C (en) | 2005-10-17 | 2005-10-17 | White-/grey transformation regulation factor gene of Candida albicans and its uses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1951956A CN1951956A (en) | 2007-04-25 |
| CN100497380C true CN100497380C (en) | 2009-06-10 |
Family
ID=38058527
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100305852A Expired - Fee Related CN100497380C (en) | 2005-10-17 | 2005-10-17 | White-/grey transformation regulation factor gene of Candida albicans and its uses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100497380C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101362798B (en) * | 2007-08-08 | 2011-04-20 | 中国科学院上海生命科学研究院 | Candida albicans hyphal development inhibitor and application thereof |
-
2005
- 2005-10-17 CN CNB2005100305852A patent/CN100497380C/en not_active Expired - Fee Related
Non-Patent Citations (6)
| Title |
|---|
| Genbank. Jones, T.等. 2005 |
| Genbank. Jones, T.等. 2005 * |
| 白色念珠菌形态发生相关基因的克隆与鉴定. 陈曦，王勤，陈江野.生物化学与生物物理学报，第32卷第5期. 2000 |
| 白色念珠菌形态发生相关基因的克隆与鉴定. 陈曦，王勤，陈江野.生物化学与生物物理学报，第32卷第5期. 2000 * |
| 白色念珠菌形态转换的调控. 陈曦，陈江野.生命的化学，第20卷第5期. 2000 |
| 白色念珠菌形态转换的调控. 陈曦，陈江野.生命的化学，第20卷第5期. 2000 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1951956A (en) | 2007-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1948335B (en) | Candida albicans mycellium regulating and controlling factor gene and its use | |
| CN100497380C (en) | White-/grey transformation regulation factor gene of Candida albicans and its uses | |
| CN100480379C (en) | Candida albicans CTD protein kinase gene and application therefor | |
| CN101362798B (en) | Candida albicans hyphal development inhibitor and application thereof | |
| CN1952129B (en) | Angptl4 deletion mutant and application thereof | |
| CN102337218B (en) | Factor for regulating toxicity of Candida albicans and its application | |
| CN100480264C (en) | Earthworm protein suppressing cancer cell accretion by road spectrum and coding sequence thereof | |
| CN100519578C (en) | White candidas transcription factor gene and its use | |
| CN101712935B (en) | Candida albicans toxicity related gene CaMSS11 and application thereof | |
| US7544485B2 (en) | Baldness related gene and the polypeptide encoded thereby, and uses | |
| CN100999725A (en) | Cell periodic important regulating and controlling kinase PFTK1 | |
| CN101638624B (en) | Hyphal development related gene of candida albicans and application thereof | |
| CN100543133C (en) | Phosphokinase and application thereof | |
| CN100443501C (en) | Mitochondria traffic protein molecule for human marrow stromal cell and sequence encoding same and use thereof | |
| CN102477085A (en) | Construction and application of Candida albican growth-related factor Cas5 mutant | |
| CN100355782C (en) | New liver cancer up expressing gene and its encoded protein and application | |
| CN103059110A (en) | Candida albicans apoptosis-promoting factor gene and application thereof | |
| CN102443056A (en) | Exon deleted variant of epidermal growth factor receptor | |
| CN100358917C (en) | Tumor tag and the use thereof | |
| CN1778816B (en) | Human cell surface membrane molecule and use thereof | |
| CN100543134C (en) | Phosphokinase and application thereof | |
| CN1171901C (en) | New interferon-like protein and its code sequence and use | |
| CN101492501A (en) | Penaeus japonicus Rab protein, coded sequence and uses thereof | |
| CN1288057A (en) | Coded novel human angiotensin II-1 receptor related protein gene, and application and prepn. method therefor | |
| CN1299827A (en) | New human CD20 homolgous molecule and its code sequence and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090610 Termination date: 20121017 |