CN103045604A - Method for preparing antibacterial peptide by carrying out PCR recombination on sinonovacula antibacterial peptide gene and application of antibacterial peptide - Google Patents

Abstract

The invention relates to a method for preparing an antibacterial peptide by carrying out PCR (Polymerase Chain Reaction) recombination on a sinonovacula antibacterial peptide gene. According to the method, sinonovacula blood sinus lymphocyte is used as a material; total RNA (Ribose Nucleic Acid) is extracted from the sinonovacula blood sinus lymphocyte; a specific primer is designed; by adopting an embedded PCR method, a scp (Single Cell Protein) gene with the size of 258bp is obtained; the scp gene is inserted into a pPICZ alpha A expression vector; the pPICZ alpha A expression vector is transferred into pichia pastoris GS115 to obtain an expression strain LGS-3; and by optimizing the expression conditions, the optimal expression conditions of temperature of 28 DEG C, methanol concentration of 1 percent and induction expression time of 72h are obtained. The product antibacterial peptide obtained by induction expression has strong inhibitory activity on Aeromonas veronii. When the antibacterial peptide is applied to loach culture and 0.5 percent of antibacterial peptide preparation is added into a feed, under the condition of adding the Aeromonas veronii, the survival rate of loaches can be improved by about 48 percent and yield of the loaches is improved by about 28.55 percent.

Description

The PCR restructuring of razor clam antibacterial peptide gene of hanging prepares method and the purposes of antibacterial peptide

Technical field

The present invention relates to a kind of method and purposes of antibacterial peptide, particularly a kind of PCR of the razor clam antibacterial peptide gene of hanging restructuring prepares method and the purposes of antibacterial peptide.

Background technology

Along with developing rapidly of culture fishery, the aquatic products disease is on the rise, prevent and treat a large amount of life-time service of microbiotic in the process even some forbidden drugses, not only threaten food safety, and destroyed aquatic environment, many bacteriums have produced obvious resistance, have affected the sustainable development of culture fishery.Abuse of antibiotics also makes Export of Chinese Aquatic Products be obstructed repeatedly, has caused massive losses to water industry.Therefore the task of top priority that seek that antimicrbial power is strong, has a broad antifungal spectrum, activity stabilized antibiotic substitute becomes control aquatic products disease.

Antibacterial peptide is the defensive peptide class active substance that a class of generation in the organism is resisted exogenous pathogenic agent pathogenic effects, has broad spectrum antibiotic activity, " traditional microbiotic " incomparable superiority is arranged simultaneously: can not induce the generation of drug resistance strain, promise to be antiseptic-germicide of new generation.Antibacterial peptide adds in the feed of cultured fishes, not only can suppress and eliminate the pathogenic micro-organism in the aquatic environment, improves the immunological competence of fish body, and can avoid microbiotic accumulating in the fish body, improves aquatic product quality.At present both at home and abroad research is take from organism separation and purification antibacterial peptide as main, and the few cost of the antibacterial peptide amount that this method obtains is higher, therefore is difficult to be able to widespread use.

Summary of the invention

Technical problem to be solved by this invention is for the deficiencies in the prior art, provides a kind of new PCR restructuring that the aquatic products disease is had a razor clam antibacterial peptide gene of hanging of prevention effect to prepare the method for antibacterial peptide.

Another technical problem to be solved by this invention provides a kind of purposes of the antibacterial peptide that preceding method makes.

Technical problem to be solved by this invention is to realize by following technical scheme.The present invention is the method that a kind of PCR restructuring of the razor clam antibacterial peptide gene of hanging prepares antibacterial peptide, is characterized in, its step is as follows:

(1) collects razor clam hemolymph 10 mL that hang, 4 ℃, centrifugal 25 min obtain blood lymphocyte under 4000 rpm, abandon supernatant liquor, the collecting precipitation thing is in the EP of 1.5 mL RNase-free pipe, add 1 mL Trizol, room temperature leaves standstill 5 min behind the piping and druming mixing, and every pipe adds 500 μ L chloroforms, jolting 30s, ice bath 3 min, then at 4 ℃, centrifugal 15 min under 12000 rpm, draw supernatant liquor, being transferred to the EP pipe of an other RNase-free, is the chloroform of 24:1 with volume ratio: the primary isoamyl alcohol extracting is drawn supernatant liquor to without albumen precipitation, the 500 μ L Virahols that add 4 ℃ of precoolings, mixing leaves standstill l0 min on ice, 4 ℃, centrifugal 15 min of 12000 rpm abandon supernatant; 75% ethanol that adds 4 ℃ of precoolings of 1 mL is washed once, and 4 ℃, centrifugal 5 min of 8000 rpm outwell ethanol, and room temperature is inverted 15 min, adds 10 mL DEPC and processes water dissolution, and the total RNA sample of the razor clam of must hanging places 4 ℃ of refrigerations;

(2) as follows the total RNA sample of the razor clam of hanging is carried out pcr amplification:

A. reverse transcription cDNA synthetic system is set up:

Get 20 μ l, 70 ℃ of lower incubation 10 min of the total RNA sample of razor clam that hang, cooled on ice obtains the total RNA of sex change rapidly, and is for subsequent use; Set up as follows reverse transcription cDNA synthetic system:

With the reagent mixing of above-mentioned volume, 42 ℃ of incubation 60 min, then 95 ℃ of sex change 5 min place 5 min for 4 ℃;

B. nested PCR

1. PCR reaction system for the first time:

PCR response procedures for the first time

2. PCR reaction system for the second time

PCR response procedures for the second time

Described primer is respectively:

M13-MGDs 5'-ACAATTTCACACAGGAGATTGAGGTG-3 ；

Anchor primer 1 5'-ACGACTCACTATAGGGTTTTTTTTTTTTC-3';

Anchor primer 2 5'-ACGACTCACTATAGGGTTTTTTTTTTTTG-3';

Anchor primer 3 5'-ACGACTCACTATAGGGTTTTTTTTTTTTA-3 ';

M13 5'-ACAATTTCACACAGGA-3' ；

T7 5'-ACGACTCACTATAGGG-3' ；

(3) 3 ' RACE amplified production is cut glue and reclaim, after the pMD18-T carrier is connected, transform E. coliDH5 α, grow bacterium colony after, the screening positive transformant, order-checking obtains PCR product gene order, called after ScpGene;

(4) Yeast expression carrier makes up:

ScpThe gene two ends add restriction enzyme site EcoRI and XbaI,

Forward primer SCPF:5'-CG GAATTCATGAAGACATTCAGT-3', underscore is EcoRThe I restriction enzyme site, reverse primer SCPR:5'-GC TCTAGAGGATCCCCGGGTACC-3', underscore is XbaThe I restriction enzyme site increases from positive transformant ScpGene, again with after the pMD18-T carrier is connected, screening obtains positive transformant, extracts plasmid, uses EcoRI and XbaThe I enzyme is cut, and cuts that glue reclaims with restriction enzyme site ScpGene fragment, and same using EcoRI and XbaThe plasmid vector pPICZ α A that the I enzyme is cut connects by the mol ratio of 10:1, is converted into E. coliAmong the DH5 α, with the LB plate screening positive transformant that contains 25 μ g/mL Zeocin, extract the expression vector plasmid;

(5) conversion and PCR checking:

With BstI linearization for enzyme restriction recombinant expression vector plasmid, with yeast expression host GS115 competent cell mixing, at 1.5 kv, 25 μ F, 200 Ω shock by electricity under the 5 msec conditions, add at once 1 M sorbyl alcohol, 1 mL, absorption 100 μ L are applied to and contain the antibiotic MD flat board of 100 mg/L Zeocin behind the mixing, and 30 ℃ of cultivations are until grow yeast recon bacterium colony LGS-3; Extract the DNA of LGS-3, use primer 5'-AOX and 3'-AOX and SCPF and SCPR to carry out the PCR checking; Cultivate LGS-3 bacterium liquid, press LGS-3 bacterium liquid: 30% glycerine volume ratio 1:1 preserves bacterial classification;

(6) abduction delivering of recombinant protein:

LGS-3 bacterium liquid is inoculated in the 250 mL triangular flasks that contain 50 mL BMGY substratum, and 30 ℃, 200 rpm cultivate 24 h; The centrifugal supernatant of abandoning is transferred in the 500 mL triangular flasks that contain 100 mL BMMY, and 30 ℃, 200 rpm cultivate, and are centrifugal, obtain containing the supernatant liquor of antibacterial peptide;

Wherein: the MD substratum: 13.4 g/L are without amino yeast nitrogen, 0.4 mg/L vitamin H, 20g/L glucose, 1.5% agar;

The BMGY/BMMY substratum: 2% peptone, 1% yeast extract, 100 mM pH6.0 potassium phosphate buffers, 1.34% without amino yeast nitrogen, the 0.4mg/L vitamin H, 1% glycerine replaces 1% glycerine with 0.5% methyl alcohol during preparation BMMY; Collocation method: get the l0g yeast extract, 20 g peptones, be dissolved in the 700 mL deionized waters, autoclaving 20 min are cooled to room temperature, 10 after the adding filtration sterilization * without amino yeast nitrogen, 100 mL2 mL500 * vitamin Hs, 100 mL10 * glycerine, 100 mLl mol/L potassium phosphate buffers, 4 ℃ save backup.

Below the present invention is carried out more detailed elaboration.

The present invention is by molecular biology method, from the large sea farming economic shellfish of China hang razor clam ( Sinonovacula constrictaLamarck) its antibacterial peptide gene of clone in by making up yeast expression system, improves the output of antibacterial peptide, for the control aquatic animal disease lays the foundation.

Materials and methods

1.1 material

The razor clam 1.1.1 hang: the fresh and alive razor clam of hanging is purchased from the Lianyungang fish market.

Reagent and enzyme: the PCR primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized; AMV reversed transcriptive enzyme, RNA enzyme inhibitors, TaqEnzyme, dNTP, PCR damping fluid, Mg ²⁺, DNA marker, RNA extract test kit, dna gel and reclaim test kit etc. and be purchased from precious biotechnology (Dalian) company limited; Other medicine is analytical pure.

Culture medium prescription:

LB substratum (g/L): Pryptone 10.0, Yeast extract 5.0, and NaCl 10.0, pH7.0 ~ 7.5, solid adds 1.5% agar.

The MD substratum: 13.4 g/L are without amino yeast nitrogen (YNB), 0.4 mg/L vitamin H (B), 20g/L glucose (D), 1.5% agar.Compound method: dissolving 15 g agar powders in 800 mL deionized waters, autoclaving 20 min are cooled to about 60 ℃, 100 mL10 after the adding filtration sterilization * YNB, 2 mL500 * B, 100 mL10 * D are down flat plate immediately behind the mixing, and 4 ℃ save backup.

BMGY/BMMY substratum: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffers (pH6.0), 1.34% YNB, 0.4mg/L vitamin H, 1% glycerine (replacing with 0.5% methyl alcohol during preparation BMMY).Collocation method: get the l0g yeast extract, 20 g peptones, be dissolved in the 700 mL deionized waters, autoclaving 20 min, be cooled to room temperature, 100 mL10 * YNB after the adding filtration sterilization, 2 mL500 * B, 100 mL10 * GY (glycerine), 100 mL l mol/L potassiumphosphates (pH6.0).4 ℃ save backup.If preparation BMMY replaces 10 * GY with 100 mL, 10 * M (methyl alcohol).Doing the methyl alcohol different concns induces when experiment to add by experimental design.

Method

1.2.1 the extraction of total RNA

Collection approximately 10 mL of razor clam hemolymph that hang, 4 ℃, centrifugal 25 min obtain blood lymphocyte under 4000 rpm, abandon supernatant liquor, the collecting precipitation thing is in the EP of 1.5 mLRNase-free pipe, add 1 mL Trizol, room temperature leaves standstill 5 min behind the piping and druming mixing, and every pipe adds 500 μ L chloroforms, jolting 30s exerts oneself, ice bath 3 min, then at 4 ℃, centrifugal 15 min under 12000 rpm, the careful supernatant liquor of drawing, be transferred to the EP pipe of an other RNase-free, to without obvious albumen precipitation, carefully draw supernatant liquor with chloroform/primary isoamyl alcohol (24:1) extracting, the 500 μ L Virahols that add 4 ℃ of precoolings, mixing immediately, quiet l0 min on ice, 4 ℃, centrifugal 15 min of 12000 rpm abandon supernatant.75% ethanol that adds 1 mL precooling is washed once, and 4 ℃, centrifugal 5 min of 8000 rpm outwell ethanol, and room temperature is inverted about 15 min, adds 10 mL DEPC and processes water dissolution.Place 4 ℃ of refrigerator and cooled to hide.

The analysis of RNA and quantitative

(1) OD260/OD280 detects RNA purity

Take out the total RNA sample of 2 μ l, be diluted to 200 μ l with DEPC water, take 200 μ l DEPC water as blank, survey OD260 absorption value relative to OD280 in ultraviolet spectrophotometer, if the total RNA in the sample is pure, then OD260/OD280 ratio should be 2.0.

(2) electrophoretic examinations RNA integrity

Get the total RNA sample of 5 μ l, and add behind the 3 μ l 6x Loading Buffer mixings in the 1.2% sepharose point sample hole, 100 V constant voltage electrophoresis are 30 min approximately, after EB dyeing in the gel imaging instrument observations and taking pictures, to check the integrity of total RNA.

Design of primers is with synthetic

Auele Specific Primer M13-MGDs; BMD 1; BMD 2; BMD 3; Forward primer M13; Reverse primer T7 with reference to the conserved sequence design of close species-mussel antibacterial peptide gene, gives birth to worker's biotechnology company limited by Shanghai and synthesizes.

M13-MGDs is the conserved sequence design GSP(gene-specific primer according to mussel antibacterial peptide MGDs gene), and at the 5 ' terminal modified M13 promoter sequence; Reverse primer adopts the simplification anchor primer (T7-(dT) 12N) of the 5 ' used in the mRNA differential display (Differential Display RT-PCR, DDRT-PCR) terminal modified T7 promoter sequence, and the primer underscore partly is promoter sequence.

Screen the designed GSP:(26 mer of razor clam antibacterial peptide gene that hangs)

M13-MGDs 5'- ACAATTTCACACAGGAGATTGAGGTG-3'

PCR primer pair for the first time:

Forward primer: (26mer)

M13-MGDs 5'- ACAATTTCACACAGGAGATTGAGGTG-3

Reverse transcription/reverse primer (3): (29 mer)

Anchor primer (T7-(dT) 12N)

BMD1 5' -ACGACTCACTATAGGGTTTTTTTTTTTTC-3'

BMD2 5'- ACGACTCACTATAGGGTTTTTTTTTTTTG-3'

BMD3 5'- ACGACTCACTATAGGGTTTTTTTTTTTTA-3’

PCR primer pair for the second time:

Forward primer: (16 mer)

M13 5'- ACAATTTCACACAGGA-3'

Reverse primer: (16 mer)

T7 5'- ACGACTCACTATAGGG-3'

1.2.4 RACE pcr amplification

(1) reverse transcription cDNA synthetic system (20 μ l)

The RNA sex change: get 70 ℃ of lower incubation 10 min of the total RNA of 1 μ g, cooled on ice is for subsequent use rapidly.

Mixing, 42 ℃ of incubation 60 min, then 95 ℃ of sex change 5 min place 5 min for 4 ℃.

(2) nested PCR

1. PCR reaction system (50 μ l) for the first time

PCR response procedures for the first time

2. PCR reaction system (50 μ l) for the second time

PCR response procedures for the second time

1.2.5 the PCR product cut that glue reclaims, the T/A clone and sequence

Reclaim the test kit specification sheets with reference to gel DNA, to 3 ' RACE amplified production, namely ScpGene fragment is cut glue and is reclaimed, and after the pMD18-T carrier is connected, transforms E. coliDH5 α, grow bacterium colony after, screening positive clone, extract plasmid checking successful connection after, serve the Hai Shenggong order-checking.

Yeast expression carrier makes up

According to sequencing result redesign primer, ScpThe gene fragment two ends add restriction enzyme site EcoRI and XbaI, forward primer SCPF:5'-CG GAATTCThe ATGAAGACATTCAGT-3'(underscore is EcoRThe I restriction enzyme site), reverse primer SCPR:5'-GC TCTAGAThe GGATCCCCGGGTACC-3'(underscore is XbaThe I restriction enzyme site), amplifying target genes from positive colony, again with after the pMD18-T carrier is connected, screening obtains positive colony, extracts plasmid, uses EcoRI and XbaThe I enzyme is cut, and cuts that glue reclaims with restriction enzyme site ScpGene fragment, and same using EcoRI and XbaThe plasmid vector pPICZ α A that the I enzyme is cut connects by the mol ratio of 10:1, is converted into E. coliAmong the DH5 α, use to contain the LB plate screening positive colony transformant of 25 μ g/mL Zeocin, and carry out bacterium liquid PCR evaluation and double digestion evaluation.At last, the correct recombinant expression plasmid that contains will be identified ScpThe bacterium liquid of-pPICZ α A is served the order-checking of extra large English fine horse biotechnology company limited, analyzes ScpWhether the open reading frame of gene correctly is inserted into the downstream of the signal α peptide factor of pPICZ α A.

Transform and the PCR checking

Process ScpThe restriction enzyme site analysis of gene and pPICZ α A carrier is adopted BstI linearization for enzyme restriction recombinant plasmid.Electric shock (1.5 kv, 25 μ F, 200 Ω, 5 msec) changes yeast expression host GS115 bacterial strain over to.Add at once 1 M sorbyl alcohol, 1 mL after the electric shock, absorption 100 μ L are applied to and contain the antibiotic MD flat board of 100 mg/L Zeocin behind the mixing, and 30 ℃ of cultivations are until grow bacterium colony (approximately 2-3 d).Extract pastoris genomic dna, use primer 5'-AOX and 3'-AOX and SCPF and SCPR to carry out the PCR checking, verify errorless after, press bacterium liquid: 30% glycerine 1:1 preserves bacterial classification.This experimental verification LGS-3 (GS115/ Scp-pPICZ α A) correct, carry out subsequent operations as material.

The abduction delivering of recombinant protein and analysis

Corpusculum is abduction delivering: will resist the positive transformant LGS-3 of Zeocin to be inoculated in the test tube that contains 3 mL BMGY substratum, 30 ℃, 200 rpm are cultivated 24 h, the centrifugal supernatant of abandoning is transferred to resuspended thalline in the 100 mL triangular flasks that contain 25 mL BMMY substratum, and 30 ℃ are continued to cultivate 120 h.Centrifugal collection supernatant detects analyzing proteins active.

Shaking flask is induced: positive transformant LGS-3 is inoculated in the 250 mL triangular flasks that contain 50 mL BMGY substratum, and 30 ℃, 200 rpm cultivate 24 h.The centrifugal supernatant of abandoning is transferred in the 500 mL triangular flasks that contain 100 mL BMMY, and 30 ℃, 200 rpm cultivate, and per 24 h take a sample once, and sample is used for the expression of analyzing proteins.

The activation analysis of recombinant protein

The recombinant expressed bacterium LGS-3 of activation is transferred in the 250 mL triangular flasks that contain 50 mL BMGY substratum with 2% inoculum size, 30 ℃, 200 rpm are cultivated 24 h, and the centrifugal supernatant of abandoning is transferred in the 500 mL triangular flasks that contain 100 mL BMMY, 30 ℃, 200 rpm take a sample after cultivating 48 h.

On the LB flat board with aseptic cotton carrier be coated with all grand Aeromonass ( Aeromonas veronii) bacterium liquid, placing 6 mm aseptic filter paper sheets, the bacterium liquid 20,40,60, the 80 μ L that get abduction delivering slowly drip on filter paper, drip 50 μ L LB substratum on the middle filter paper and do contrast, observe the antibacterial situation of induction expression protein.

The optimization of expression of recombinant proteins condition

1.2.10.1 the optimization of abduction delivering time

The recombinant expressed bacterium LGS-3 of activation is transferred in the 250 mL triangular flasks that contain 50 mL BMGY substratum with 2% inoculum size, 30 ℃, 200 rpm cultivate 24 h, the centrifugal supernatant of abandoning, be transferred in the 500 mL triangular flasks that contain 100 mL BMMY, 30 ℃, 200 rpm cultivate, per 24 h sampling once is sampled to 144 h(6 d).Respectively get 1 mL bacterium liquid, detect the bacteriostatic activity of expressing protein under the different induction times.

1.2.10.2 the optimization of inductor concentration

The recombinant expressed bacterium LGS-3 of activation is inoculated in the 250 mL triangular flasks that contain 50 mL BMGY substratum, 30 ℃, 200 rpm cultivate 24 h, the centrifugal supernatant of abandoning, be transferred to and contain 100 mL BMMY(without methyl alcohol) 500 mL triangular flasks in, add respectively methyl alcohol to final concentration 0.5%, 1.0%, 1.5%, 2.0% and 2.5%, continue inducing culture 72 h, respectively get 1 mL bacterium liquid, detect the bacteriostatic activity of expressing protein under the different induction times.

1.2.10.3 the expression of recombinant protein under the different inducing temperatures

The recombinant expressed bacterium LGS-3 of activation is inoculated in the 250 mL triangular flasks that 50 mL contain the BMGY substratum, 30 ℃, 200 rpm cultivate the centrifugal supernatant of abandoning of 24 h., be transferred in the 500 mL triangular flasks that contain 100 mL BMMY, respectively at 20 ℃, 25 ℃, 28 ℃ 30 ℃, continue inducing culture 72 h under 200 rpm, respectively get 1 mL bacterium liquid, detect the bacteriostatic activity of expressing protein under the different induction times.

The separation and purification of recombinant expression protein

This research nickel affinity chromatography post, sample preparation: draw above-mentioned albumen supernatant liquor with 10 mL syringes, and remove impurity in the supernatant liquor with 0.45 μ m filter membrane, in order to avoid stop up the nickel post.Then use the FPLC purifying: with 5 * V(5 times of volume) Buffer A balance His-Trap post, after the loading again 5 * V Buffer A balance wash the foreign protein of non-specific binding in the nickel post off, 5 * V Buffer A wash-out, while Buffer B rises to 100% pair of albumen from 0 and carries out gradient elution.BufferA:50 mM Tris-HCl(pH 8.0), 300 mM NaCl; BufferB:50 mM Tris-HCl(pH8.0), 300 mM NaCl, 500 mM imidazoles.

Analyze

Electrophoresis apparatus is Mini-protean II type electrophoresis apparatus (Bio-rad product), thick 0.75 mm of plate glue.Resolving gel concentration is respectively 16.5% and 10%, and concentrated gum concentration is 4%.Adopt discontinuous buffering system, anode buffer liquid is 0.2 mol/L Tris (pH 8.9), the negative electrode damping fluid is that 0.1 mol/L Tricine includes 0.1% (3.47 mmol/L) SDS and 0.1 mol/L Tris (pH 8.25), and gel buffer liquid is that 3 mol/L Tris include 0.3% (0.01 mol/L) SDS (pH 8.45).Application of sample 15 μ l in every sample pool are in 80 V constant voltage electrophoresis.Behind the electrophoresis, with the dye liquor that contains 0.1% (1.2 mmol/L) coomassie brilliant blue R_250,40% ethanol, 10% acetic acid 7 h that dye, 10% acetic acid decolours clear to band.

Antimicrobial peptide preparation is used for the application experiment of loach breeding

Feed for nursing adds respectively the antimicrobial peptide preparation of 0.1%, 0.5%, 1.0%, 1.5%, 2.0%, 2.5% 6 level on conventional feed prescription basis, not add antimicrobial peptide preparation as contrast (CK1).Water approximately 1/3 is changed in day bait throwing in twice every day, and (concentration is 10 in the water to throw in all grand Aeromonas bacterium liquid in the water ⁶The cell/mL order of magnitude), other establishes one and does not throw in all grand Aeromonass, and feed does not add the contrast (CK2) of antimicrobial peptide preparation yet.The loach seedling is available from Lianyungang Xinpu District one loach breeding field (on average wet quality 13.1 g ± 0.2 g), and loach is supported 1 week, water temperature 20-25 ℃ temporarily in a glass fibre tank (200 cm * 100 cm * 100 cm).Then divide in the aquarium cultivation, each aquarium (60cm * 45 cm * 40 cm, aquaculture water 60 L) is a processing (or contrast), put the healthy loach of 30 tails in a suitable place to breed, each level is established 3 repetitions, and totally 24 aquariums are measured loach weight in wet base in each aquarium before the experiment.All aquarium dissolved oxygens maintain more than 5.0 mg/L, pH 7.0-7.5, and water temperature 20-25 ℃, be 30 d experimental period.Record during this time loach growth and survival condition, statistics output and survival rate.

2 results and analysis

2.1 the extraction of total RNA

Adopt Trizol method total RNA extraction reagent box (worker's biotechnology company limited is given birth in Shanghai) to extract total RNA of sample, from total RNA electrophoresis result figure, can very clearly observe 28S and two bright bands of 18S, the brightness of 28S approximately is the twice of 18S, the quality that the RNA that carries is described is better, can satisfy the requirement of subsequent experimental.

Purity detecting

Get 2 μ l RNA samples, be diluted to 200 μ l with DEPC water, take 200 μ l DEPC water as blank, in ultraviolet spectrophotometer, survey OD with micro-cuvette ₂₆₀And OD ₂₈₀Relative absorption value, parallel three batch totals are calculated OD ₂₆₀/ OD ₂₈₀Be about 1.9.

The OD of RNA sterling ₂₆₀/ OD ₂₈₀Should be 2.0, contain the impurity such as foreign protein and phenol in sample, this ratio will descend.This experiment OD ₂₆₀/ OD ₂₈₀Be about 1.9, show that RNA purity is higher, can satisfy the requirement of subsequent experimental.

The acquisition of product and PCR product

After the total RNA of the razor clam blood lymphocyte of hanging extracts, carry out the 3'RACE amplification take mRNA as template through three kinds of anchor primers, synthetic cDNA under the effect of AMV reversed transcriptive enzyme.Owing to comprising multiple mRNA in the eukaryotic cells, also being not quite similar in its kind of different growth periods and quantity, therefore many bands can appear in the cDNA that obtains.Electrophoresis detection as shown in Figure 1.As seen from the figure, the molecular size of synthetic cDNA is many bright bands of 100bp-600bp, meets by analysis the experiment expection.

Adopt nested PCR method, take cDNA as the template amplification target DNA, PCR obtains the approximately fragment of 270 bp sizes for the first time, as shown in Figure 2.

The screening of recombinant plasmid and sequencing

To the sequencing result demonstration of 3 ' RACE amplified production, this amplified production has the open reading frame of a 258bp, called after ScpGene, it is comprised of 86 amino acid. ScpGene is compared with Mediterranean Sea mussel Mytilus galloprovincialis mytilin B cDNA sequence, and homology reaches 97%, and is only different in 29,66,87,115,135,140,211,253,257 9 base sites; Compare with chilensis mussel Mytilus chilensis mytilin, homology reaches 98%, only has 29,66,87,115,135 5 base sites different.Explanation ScpThe sibship of gene and Mediterranean Sea mussel Mytilus galloprovincialis mytilin B and chilensis mussel Mytilus chilensis mytilin is nearer.

ScpThe structure of expression vector

2.5.1 pPICZ α A plasmid extraction and checking

As shown in Figure 3 plasmid extraction success is found out from the single endonuclease digestion the result of Fig. 4, and approximately about 3800 bp, the theoretical size of known pPICZ α A is 3.6 kb to the linear size of pPICZ α A, therefore size meets, checking pPICZ α A extracts correct.

ScpThe PCR of gene fragment

(1) reaction system optimization result:

10 * amplification buffer, 2.5 μ L

DNTP mixture (each 2.5 mM) 2 μ L

rTaq（5 U/μL，plus Mg ²⁺） 0.2 μL

Water 18.8 μ L

DNA 0.5 μL

Primer 1 (20 μ M) 0.5 μ L

Primer 2 (20 μ M) 0.5 μ L

Cumulative volume 25 μ L

(2) electrophoresis detection:

Amplification obtains single band, meets purpose band (267bp) size, cuts glue and reclaims, and adopts the PCR product that this time is recovered to increase as masterplate again, and experimental result is good, obtains a large amount of ScpGene fragment.

ScpGene is connected with pPICZ α A expression vector

(1) enzyme is cut

Because two kinds of enzymes from different manufacturers, because the Buffer difference can't make up the double digestion system, can only be cut by the substep enzyme, and through checking, first XbaI singly cuts rear ethanol precipitation and reclaims, again warp EcoThe RI enzyme is cut, like this better effects if.

As can be known from Fig. 5 and Fig. 6, singly cut and two cut all successful.Cause ScpFragment is too small, and enzyme is cut rear molecular weight and is more or less the same, therefore be difficult for observing out from scheming.

(2) enzyme connects and transforms

Under the effect of T4 dna ligase, couple together after reclaiming fragment, transform E.coliDH5 α coats that the Zeocin that contains 100 mg/L is flat to be pulled, and after the incubated overnight, grows transformant on the resistant panel, several transformants of picking, and bacterium liquid send biotech firm's order-checking after the checking of upgrading grain.

(3) ScpSequencing result after gene is connected with pPICZ α A

CGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACGATGAGATTTCCTTCAATTTTTACTGCTGTTTTATTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTGAATTC ATGAAGACATTCAGTGTTGCAGTTGCAGTGGCCGTTGTGCTCACCTTTATTTGCCTTCAGGAGAGCTCTGCTGCCTCATTCACTGAGGTGCAAGAGCTGGAGGAGCCAATGAGCAATGGCAGCCCAGTTGCTGCACATGAAGAGATGTCAGAGGAGTCCTGGAAGATGCCGTATGCCAGCAGAAGCAGCAGCGGACGCAAGCGCTGTCACTTTTGCTGTCGTTGCTGTCCTCGCATGATCGGATGTGGTGTCTGCTGCAGGTTCTGAGGTACCCGGGGATCCTCTAGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGCGCCGTCGACCATCATCATCATCATCATTGAGTTTGTAGCCTTAGACATGACTGTTCCTCAGTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAATCAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATTTTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCATTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAGCTGATGAATATCTTGTGGTAGGGGTTTGGGAAA

Sequence alignment by sequencing result and goal gene fragment can find out, SCP fragment success enzyme has been linked on the pPICZ α A expression vector, has obtained pPICZ α A- Scp

The electroporation of pichia spp transforms

2.6.1 preparation linearization plasmid

With BstX I enzyme is cut, and 55 ℃, 4 h, the theoretical size of pPICZ α A-SCP recombinant plasmid is 3867 bp.Bring up from bar, singly cut single and big or small meeting of rear band, therefore can judge linearizing success of recombinant plasmid.

Electroporation transforms

Electroporation transforms the electric shock condition: voltage: 1980V; Electric capacity: 25 μ F; Resistance: 200 Ω; Burst length: 5.1 ms; Once shock by electricity.Be coated on the Zeocin flat board, place 28 ℃ of constant incubators to cultivate 3 d.Observe colonial morphology: white, bacterium colony is larger, and the surface is somewhat moistening, and is smooth, can on resistant panel, prove that electricity changes into merit.

The abduction delivering of recombinant protein and Tricine-SDS-PAGE analyze

Expression strain LGS-3 (GS115/SCP-pPICZ α A) cultivates by the sampling in 72 hours of 1% methanol induction, and the albumen behind the albumen behind the Tricine-SDS-PAGE electrophoretic analysis bacterial cell disruption in total solution, the bacterial cell disruption in the supernatant liquor is seen Fig. 8.Find out from Fig. 7-8, expression strain has an obvious band about 9.5 KDa, illustrate the restructuring ScpGene can obtain successful expression in yeast GS115, and is a little peptide.The band molecular weight basically identical (Fig. 8) of abduction delivering in the protein band of ni-sepharose purification (Fig. 7) and GS115.

The activity of expressing protein (antibacterial peptide) detects

On the LB flat board, be coated with all grand Aeromonas bacterium liquid with aseptic cotton carrier, place 6 mm aseptic filter paper sheets, the bacterium liquid 20,40,60, the 80 μ L that get abduction delivering slowly drip on filter paper, drip 50 μ L LB substratum on the middle filter paper and do contrast, observations is found out, the abduction delivering product has stronger restraining effect to all grand Aeromonass of aquatic products disease, and inhibition zone increases along with the increase of bacterium liquid measure.

The optimization of recombinant protein (antibacterial peptide) expression condition

2.9.1 the optimization of abduction delivering time

Press the 1.2.10.1 method, abduction delivering 144 h.Every 24 h, the 1 mL bacterium liquid of taking a sample, detect the bacteriostatic activity of expressing protein under the different induction times.The results are shown in Figure 9.

As can be seen from Figure 9, after abduction delivering began, along with time lengthening, antibacterial substance accumulation, bacterium liquid antibacterial circle diameter reaches 13.2 mm during 72 h, antibacterial substance content no longer rose behind 72 h, so yeast fermentation is with 72 h(3 d) for well.

The optimization of inductor concentration

Press the 1.2.10.2 method, add respectively the methyl alcohol of different concns in the inducing culture thing, induce 72 h, detect the variation that the expressing protein enzyme is lived, the results are shown in Figure 10.

As can be seen from Figure 10, when methanol concentration was increased to 1.0% by 0. 5%, the enzyme work of expressing protein increased; After this enzyme work that increases the methanol concentration expressing protein decreases on the contrary, and therefore 1.0% methyl alcohol is this experiment optimum addition.

The expression of recombinant protein under the different inducing temperatures

Recombinant expressed bacterium under 20,25,28,30 ℃, behind inducing culture 72 h, detects the bacteriostatic activity of recombinant protein respectively, the results are shown in Figure 11.

The result shows, recombinant expressed bacterium LGS-3 induces under 28 ℃, and antibacterial circle diameter maximum (Figure 11) is so determine that the best abduction delivering temperature of recombinant expressed bacterium LGS-3 is 28 ℃.

In sum, the optimum expression condition of recombinant expressed bacterium LGS-3 is: 28 ℃, and methanol concentration 1%, abduction delivering 72 h products therefrom activity are the highest.

The experimental result of antibacterial peptide in loach breeding

Tested in the 2012.6-7 month and carry out in culture experiment chamber, this school.Experimental result sees Table 1.

Add the antimicrobial peptide preparation of different proportionings in table 1 feed to the impact of loach output and survival rate

As seen from Table 1, throwing in all grand Aeromonas bacterium liquid in the water can make the loach survival rate obviously reduce, on this basis, add antimicrobial peptide preparation with different proportionings, can make the loach survival rate improve 27%-51%, output is than the increase 24.09%-36.27% that throws in all grand Aeromonass, and this may be the growth that antimicrobial peptide preparation has suppressed pathogenic bacteria, strengthened the loach disease resistance, thereby the reason of robust growth.Than not throwing in all grand Aeromonass, the output increasing degree of also not adding antimicrobial peptide preparation is little, only 0.86%-9.12%.

Because the difference of adding 0.5% and 1% above proportioning is not very large, but with 0.1% differ larger, consider cost factor, suggestion selects 0.5% proportioning comparatively suitable, it improves 48%, increase by 28.55 % of output in the situation that throw in all grand Aeromonas survival rates.

The present invention therefrom extracts total RNA take the razor clam blood sinus lymphocyte of hanging as material, and the design special primer adopts nested PCR method, obtains 258 bp sizes ScpGene is inserted into pPICZ α A expression vector, changes Pichia pastoris GS115 over to, obtains expression strain LGS-3, and by expression condition optimization, obtaining its optimum condition of the expression is 28 ℃ of temperature, methanol concentration 1%, and the abduction delivering time is 72 h.The product antibacterial peptide of abduction delivering has stronger inhibition activity to all grand Aeromonass.Be applied to loach breeding, the result shows, adds 0.5% antimicrobial peptide preparation in the feed, can make loach in the situation that throw in all grand Aeromonas survival rates and improve 48%, increase by 28.55 % of output.

Description of drawings

Fig. 1 is RACE cDNA product electrophorogram, among the figure: M:Marker; 1:cDNA;

Fig. 2 PCR product electrophorogram, LM:DNA Marker among the figure; The 1:PCR product;

Fig. 3 is plasmid pPICZ α A electrophorogram, and among the figure, 1-9 is plasmid pPICZ α A;

Fig. 4 is the EcoR I single endonuclease digestion checking electrophorogram of plasmid pPICZ α A, among the figure: M:DNA Marker; 1:pPICZ α A does not cut; 2:pPICZ α A singly cuts;

Fig. 5 is ScpAnd the XbaI enzyme cutting electrophorogram of pPICZ α A, among the figure: M:DNA Marker; 1: ScpDo not cut; 2: ScpSingle endonuclease digestion; 3:pPICZ α A does not cut 4:pPICZ α A single endonuclease digestion;

Fig. 6 is ScpAnd the RcoR I restriction enzyme digestion and electrophoresis figure of pPICZ α A, among the figure: M:DNA Marker; 1: ScpSingly cut; 2: ScpTwo cutting; 3:pPICZ α A singly cuts; 4:pPICZ α A is two to be cut;

Fig. 7 is the His affinity chromatography column purification electrophoretogram of razor clam antibacterial peptide of hanging;

Fig. 8. Tricine-SDS gel electrophoresis (Tricine-SDS-PAGE) collection of illustrative plates of the razor clam antibacterial peptide of hanging; 1. antibacterial peptide behind the purifying; 2. supernatant liquor behind the bacterial cell disruption; 3. total solution behind the bacterial cell disruption; M. Protein Marker. separation gel gum concentration is 15%, degree of crosslinking 5%;

Fig. 9 is that different induction times are on the figure that affects of protein-active;

Figure 10 is that different inductor concentration are on the figure that affects of protein-active;

Figure 11 is that different inducing temperatures are on the figure that affects of protein-active.

Embodiment

Below further describe concrete technical scheme of the present invention, so that those skilled in the art understands the present invention further, and do not consist of its Copyright law.

Embodiment 1, and a kind of PCR restructuring of the razor clam antibacterial peptide gene of hanging prepares the method for antibacterial peptide, and its step is as follows:

(1) collects razor clam hemolymph 10 mL that hang, 4 ℃, centrifugal 25 min obtain blood lymphocyte under 4000 rpm, abandon supernatant liquor, the collecting precipitation thing is in the EP of 1.5 mL RNase-free pipe, add 1 mL Trizol, room temperature leaves standstill 5 min behind the piping and druming mixing, and every pipe adds 500 μ L chloroforms, jolting 30s, ice bath 3 min, then at 4 ℃, centrifugal 15 min under 12000 rpm, draw supernatant liquor, being transferred to the EP pipe of an other RNase-free, is the chloroform of 24:1 with volume ratio: the primary isoamyl alcohol extracting is drawn supernatant liquor to without albumen precipitation, the 500 μ L Virahols that add 4 ℃ of precoolings, mixing leaves standstill l0 min on ice, 4 ℃, centrifugal 15 min of 12000 rpm abandon supernatant; 75% ethanol that adds 4 ℃ of precoolings of 1 mL is washed once, and 4 ℃, centrifugal 5 min of 8000 rpm outwell ethanol, and room temperature is inverted 15 min, adds 10 mL DEPC and processes water dissolution, and the total RNA sample of the razor clam of must hanging places 4 ℃ of refrigerations;

(2) as follows the total RNA sample of the razor clam of hanging is carried out pcr amplification:

A. reverse transcription cDNA synthetic system is set up:

Get 20 μ l, 70 ℃ of lower incubation 10 min of the total RNA sample of razor clam that hang, cooled on ice obtains the total RNA of sex change rapidly, and is for subsequent use; Set up as follows reverse transcription cDNA synthetic system:

With the reagent mixing of above-mentioned volume, 42 ℃ of incubation 60 min, then 95 ℃ of sex change 5 min place 5 min for 4 ℃;

B. nested PCR

1. PCR reaction system for the first time:

PCR response procedures for the first time

2. PCR reaction system for the second time

PCR response procedures for the second time

Described primer is respectively:

M13-MGDs 5'- ACAATTTCACACAGGAGATTGAGGTG-3 ；

Anchor primer 1 5' -ACGACTCACTATAGGGTTTTTTTTTTTTC-3';

Anchor primer 2 5'- ACGACTCACTATAGGGTTTTTTTTTTTTG-3';

Anchor primer 3 5'- ACGACTCACTATAGGGTTTTTTTTTTTTA-3 ';

M13 5'- ACAATTTCACACAGGA-3' ；

T7 5'- ACGACTCACTATAGGG-3' ；

(3) 3 ' RACE amplified production is cut glue and reclaim, after the pMD18-T carrier is connected, transform E. coliDH5 α, grow bacterium colony after, the screening positive transformant, order-checking obtains PCR product gene order, called after ScpGene;

(4) Yeast expression carrier makes up:

ScpThe gene two ends add restriction enzyme site EcoRI and XbaI,

Forward primer SCPF:5'-CG GAATTCATGAAGACATTCAGT-3', underscore is EcoRThe I restriction enzyme site, reverse primer SCPR:5'-GC TCTAGAGGATCCCCGGGTACC-3', underscore is XbaThe I restriction enzyme site increases from positive transformant ScpGene, again with after the pMD18-T carrier is connected, screening obtains positive transformant, extracts plasmid, uses EcoRI and XbaThe I enzyme is cut, and cuts that glue reclaims with restriction enzyme site ScpGene fragment, and same using EcoRI and XbaThe plasmid vector pPICZ α A that the I enzyme is cut connects by the mol ratio of 10:1, is converted into E. coliAmong the DH5 α, with the LB plate screening positive transformant that contains 25 μ g/mL Zeocin, extract the expression vector plasmid;

(5) conversion and PCR checking:

With BstI linearization for enzyme restriction recombinant expression vector plasmid, with yeast expression host GS115 competent cell mixing, at 1.5 kv, 25 μ F, 200 Ω shock by electricity under the 5 msec conditions, add at once 1 M sorbyl alcohol, 1 mL, absorption 100 μ L are applied to and contain the antibiotic MD flat board of 100 mg/L Zeocin behind the mixing, and 30 ℃ of cultivations are until grow yeast recon bacterium colony LGS-3; Extract the DNA of LGS-3, use primer 5'-AOX and 3'-AOX and SCPF and SCPR to carry out the PCR checking; Cultivate LGS-3 bacterium liquid, press LGS-3 bacterium liquid: 30% glycerine volume ratio 1:1 preserves bacterial classification;

(6) abduction delivering of recombinant protein:

LGS-3 bacterium liquid is inoculated in the 250 mL triangular flasks that contain 50 mL BMGY substratum, and 30 ℃, 200 rpm cultivate 24 h; The centrifugal supernatant of abandoning is transferred in the 500 mL triangular flasks that contain 100 mL BMMY, and 30 ℃, 200 rpm cultivate, and are centrifugal, obtain containing the supernatant liquor of antibacterial peptide;

Wherein: the MD substratum: 13.4 g/L are without amino yeast nitrogen, 0.4 mg/L vitamin H, 20g/L glucose, 1.5% agar;

The BMGY/BMMY substratum: 2% peptone, 1% yeast extract, 100 mM pH6.0 potassium phosphate buffers, 1.34% without amino yeast nitrogen, the 0.4mg/L vitamin H, 1% glycerine replaces 1% glycerine with 0.5% methyl alcohol during preparation BMMY; Collocation method: get the l0g yeast extract, 20 g peptones, be dissolved in the 700 mL deionized waters, autoclaving 20 min are cooled to room temperature, 10 after the adding filtration sterilization * without amino yeast nitrogen, 100 mL2 mL500 * vitamin Hs, 100 mL10 * glycerine, 100 mLl mol/L potassium phosphate buffers, 4 ℃ save backup.

The purposes of the obtained supernatant liquor containing antibacterial peptide of the present embodiment method in preparation inhibition loach disease antimicrobial peptide preparation.

SEQ ID NO.1

＜110〉Huaihai Institute of Technology

＜120〉the hang PCR restructuring of razor clam antibacterial peptide gene prepares method and the purposes of antibacterial peptide

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 26

<212> DNA

＜213〉primer M13-MGDs

<400> 1

ACA ATT TCA CAC AGG AGA TTG AGG TG 26

<210> 2

<211> 29

<212> DNA

＜213〉anchor primer 1

<400> 2

ACG ACT CAC TAT AGG GTT TTT TTT TTT TC 29

<210> 3

<211> 29

<212> DNA

＜213〉anchor primer 2

<400> 3

ACG ACT CAC TAT AGG GTT TTT TTT TTT TG 29

<210> 4

<211> 29

<212> DNA

＜213〉anchor primer 3

<400> 4

ACG ACT CAC TAT AGG GTT TTT TTT TTT TA 29

<210> 5

<211> 16

<212> DNA

＜213〉primer M13

<400> 5

ACA ATT TCA CAC AGG A 16

<210> 6

<211> 16

<212> DNA

＜213〉primer T7

<400> 6

ACG ACT CAC TAT AGG G 16

<210> 7

<211> 923

<212> DNA

<213> pPICZα A-scp

<400> 7

CGACA ACTTG AGAAG ATCAA AAAAC AACTA ATTAT TCGAA ACGAT GAGAT TTCCT TCAAT 60

TTTTA CTGCT GTTTT ATTCG CAGCA TCCTC CGCAT TAGCT GCTCC AGTCA ACACT ACAAC 120

AGAAG ATGAA ACGGC ACAAA TTCCG GCTGA AGCTG TCATC GGTTA CTCAG ATTTA GAAGG 180

GGATT TCGAT GTTGC TGTTT TGCCA TTTTC CAACA GCACA AATAA CGGGT TATTG TTTAT 240

AAATA CTACT ATTGC CAGCA TTGCT GCTAA AGAAG AAGGG GTATC TCTCG AGAAA AGAGA 300

GGCTG AAGCT GAATT CATGA AGACA TTCAG TGTTG CAGTT GCAGT GGCCG TTGTG CTCAC 360

CTTTA TTTGC CTTCA GGAGA GCTCT GCTGC CTCAT TCACT GAGGT GCAAG AGCTG GAGGA 420

GCCAA TGAGC AATGG CAGCC CAGTT GCTGC ACATG AAGAG ATGTC AGAGG AGTCC TGGAA 480

GATGC CGTAT GCCAG CAGAA GCAGC AGCGG ACGCA AGCGC TGTCA CTTTT GCTGT CGTTG 540

CTGTC CTCGC ATGAT CGGAT GTGGT GTCTG CTGCA GGTTC TGAGG TACCC GGGGA TCCTC 600

TAGAA CAAAA ACTCA TCTCA GAAGA GGATC TGAAT AGCGC CGTCG ACCAT CATCA TCATC 660

ATCAT TGAGT TTGTA GCCTT AGACA TGACT GTTCC TCAGT TCAAG TTGGG CACTT ACGAG 720

AAGAC CGGTC TTGCT AGATT CTAAT CAAGA GGATG TCAGA ATGCC ATTTG CCTGA GAGAT 780

GCAGG CTTCA TTTTT GATAC TTTTT TATTT GTAAC CTATA TAGTA TAGGA TTTTT TTTGT 840

CATTT TGTTT CTTCT CGTAC GAGCT TGCTC CTGAT CAGCC TATCT CGCAG CTGAT GAATA 900

TCTTG TGGTA GGGGT TTGGG AAA 923

Claims (2)

1. the PCR of the razor clam antibacterial peptide gene of hanging restructuring prepares the method for antibacterial peptide, it is characterized in that, its step is as follows:

(1) collects razor clam hemolymph 10 mL that hang, 4 ℃, centrifugal 25 min obtain blood lymphocyte under 4000 rpm, abandon supernatant liquor, the collecting precipitation thing is in the EP of 1.5 mL RNase-free pipe, add 1 mL Trizol, room temperature leaves standstill 5 min behind the piping and druming mixing, and every pipe adds 500 μ L chloroforms, jolting 30s, ice bath 3 min, then at 4 ℃, centrifugal 15 min under 12000 rpm, draw supernatant liquor, being transferred to the EP pipe of an other RNase-free, is the chloroform of 24:1 with volume ratio: the primary isoamyl alcohol extracting is drawn supernatant liquor to without albumen precipitation, the 500 μ L Virahols that add 4 ℃ of precoolings, mixing leaves standstill l0 min on ice, 4 ℃, centrifugal 15 min of 12000 rpm abandon supernatant; 75% ethanol that adds 4 ℃ of precoolings of 1 mL is washed once, and 4 ℃, centrifugal 5 min of 8000 rpm outwell ethanol, and room temperature is inverted 15 min, adds 10 mL DEPC and processes water dissolution, and the total RNA sample of the razor clam of must hanging places 4 ℃ of refrigerations;

(2) as follows the total RNA sample of the razor clam of hanging is carried out pcr amplification:

A. reverse transcription cDNA synthetic system is set up:

Get 20 μ l, 70 ℃ of lower incubation 10 min of the total RNA sample of razor clam that hang, cooled on ice obtains the total RNA of sex change rapidly, and is for subsequent use; Set up as follows reverse transcription cDNA synthetic system:

With the reagent mixing of above-mentioned volume, 42 ℃ of incubation 60 min, then 95 ℃ of sex change 5 min place 5 min for 4 ℃;

B. nested PCR

1. PCR reaction system for the first time:

PCR response procedures for the first time

2. PCR reaction system for the second time

PCR response procedures for the second time

Described primer is respectively:

M13-MGDs 5'-ACAATTTCACACAGGAGATTGAGGTG-3 ；

Anchor primer 1 5'-ACGACTCACTATAGGGTTTTTTTTTTTTC-3';

Anchor primer 2 5'-ACGACTCACTATAGGGTTTTTTTTTTTTG-3';

Anchor primer 3 5'-ACGACTCACTATAGGGTTTTTTTTTTTTA-3 ';

M13 5'-ACAATTTCACACAGGA-3' ；

T7 5'-ACGACTCACTATAGGG-3' ；

(3) 3 ' RACE amplified production is cut glue and reclaim, after the pMD18-T carrier is connected, transform E. coliDH5 α, grow bacterium colony after, the screening positive transformant, order-checking obtains PCR product gene order, called after ScpGene;

(4) Yeast expression carrier makes up:

ScpThe gene two ends add restriction enzyme site EcoRI and XbaI,

Forward primer SCPF:5'-CG GAATTCATGAAGACATTCAGT-3', underscore is EcoRThe I restriction enzyme site, reverse primer SCPR:5'-GC TCTAGAGGATCCCCGGGTACC-3', underscore is XbaThe I restriction enzyme site increases from positive transformant ScpGene, again with after the pMD18-T carrier is connected, screening obtains positive transformant, extracts plasmid, uses EcoRI and XbaThe I enzyme is cut, and cuts that glue reclaims with restriction enzyme site ScpGene fragment, and same using EcoRI and XbaThe plasmid vector pPICZ α A that the I enzyme is cut connects by the mol ratio of 10:1, is converted into E. coliAmong the DH5 α, with the LB plate screening positive transformant that contains 25 μ g/mL Zeocin, extract the expression vector plasmid;

(5) conversion and PCR checking:

With BstI linearization for enzyme restriction recombinant expression vector plasmid, with yeast expression host GS115 competent cell mixing, at 1.5 kv, 25 μ F, 200 Ω shock by electricity under the 5 msec conditions, add at once 1 M sorbyl alcohol, 1 mL, absorption 100 μ L are applied to and contain the antibiotic MD flat board of 100 mg/L Zeocin behind the mixing, and 30 ℃ of cultivations are until grow yeast recon bacterium colony LGS-3; Extract the DNA of LGS-3, use primer 5'-AOX and 3'-AOX and SCPF and SCPR to carry out the PCR checking; Cultivate LGS-3 bacterium liquid, press LGS-3 bacterium liquid: 30% glycerine volume ratio 1:1 preserves bacterial classification;

(6) abduction delivering of recombinant protein:

LGS-3 bacterium liquid is inoculated in the 250 mL triangular flasks that contain 50 mL BMGY substratum, and 30 ℃, 200 rpm cultivate 24 h; The centrifugal supernatant of abandoning is transferred in the 500 mL triangular flasks that contain 100 mL BMMY, and 30 ℃, 200 rpm cultivate, and are centrifugal, obtain containing the supernatant liquor of antibacterial peptide;

Wherein: the MD substratum: 13.4 g/L are without amino yeast nitrogen, 0.4 mg/L vitamin H, 20g/L glucose, 1.5% agar;

The BMGY/BMMY substratum: 2% peptone, 1% yeast extract, 100 mM pH6.0 potassium phosphate buffers, 1.34% without amino yeast nitrogen, the 0.4mg/L vitamin H, 1% glycerine replaces 1% glycerine with 0.5% methyl alcohol during preparation BMMY; Collocation method: get the l0g yeast extract, 20 g peptones, be dissolved in the 700 mL deionized waters, autoclaving 20 min are cooled to room temperature, 10 after the adding filtration sterilization * without amino yeast nitrogen, 100 mL2 mL500 * vitamin Hs, 100 mL10 * glycerine, 100 mLl mol/L potassium phosphate buffers, 4 ℃ save backup.

2. the PCR of the razor clam antibacterial peptide gene of hanging claimed in claim 1 restructuring prepares the purposes of the obtained supernatant liquor containing antibacterial peptide of method in preparation inhibition loach disease antimicrobial peptide preparation of antibacterial peptide.

Images