CN108048475A - - 2 gene of razor clam I types of hanging lysozyme, encoding proteins and the construction method for recombinating -2 genetic engineering bacterium of razor clam I types lysozyme of hanging - Google Patents

- 2 gene of razor clam I types of hanging lysozyme, encoding proteins and the construction method for recombinating -2 genetic engineering bacterium of razor clam I types lysozyme of hanging Download PDF

Info

Publication number
CN108048475A
CN108048475A CN201711363480.8A CN201711363480A CN108048475A CN 108048475 A CN108048475 A CN 108048475A CN 201711363480 A CN201711363480 A CN 201711363480A CN 108048475 A CN108048475 A CN 108048475A
Authority
CN
China
Prior art keywords
lysozyme
types
razor clam
hanging
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201711363480.8A
Other languages
Chinese (zh)
Other versions
CN108048475B (en
Inventor
李成华
邵铱娜
张卫卫
赵雪琳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ningbo University
Original Assignee
Ningbo University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ningbo University filed Critical Ningbo University
Priority to CN201711363480.8A priority Critical patent/CN108048475B/en
Publication of CN108048475A publication Critical patent/CN108048475A/en
Application granted granted Critical
Publication of CN108048475B publication Critical patent/CN108048475B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2462—Lysozyme (3.2.1.17)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01017—Lysozyme (3.2.1.17)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses 2 gene of razor clam I types lysozyme of hanging, encoding proteins and 2 construction of genetic engineering methods and applications of razor clam I types lysozyme of hanging are recombinated, feature is to hang 2 gene order of razor clam I types lysozyme as shown in SEQIDNO.1；The nested primer of 3 ' RACE is designed according to its cloning process with the EST est sequence for 2 DNA homolog of razor clam I types lysozyme of hanging, using 3 ' RACE technology amplification gene overall lengths；2 gene coded protein amino acid sequence of razor clam I types of hanging lysozyme is as shown in SEQIDNO.2, with containing respectivelyBamHI site andXhoThe primer amplification of I site is hung 2 albumen of razor clam I types lysozyme；Obtained target gene insertion carrier acquisition recombinant plasmid will be cloned, induced expression is carried out to recombinant plasmid, then purified and obtain genetic engineering bacterium, advantage is to Vibrio harveyi, and vibrio parahaemolytious and Vibrio splindidus are inhibited.

Description

- 2 gene of razor clam I types of hanging lysozyme, encoding proteins and restructuring are hung -2 base of razor clam I types lysozyme Because of the construction method of engineering bacteria
Technical field
The invention belongs to molecular biology and genetic engineering field, hang -2 base of razor clam I types lysozyme more particularly, to one kind Cause, encoding proteins and the construction method and the application that recombinate -2 genetic engineering bacterium of razor clam I types lysozyme of hanging.
Background technology
Antibacterial peptide/albumen is a kind of amphiphilic Small-molecule basic polypeptide being widely present in entire living nature, is body The key factor of congenital immunity.Steiner in giant silkworm most after having found, up to the present, is found in total in various biologies More than 1000 kinds of antibacterial peptide.The antibacterial peptide having found is divided into four by sequence, secondary structure and antibacterial characteristics according to antibacterial peptide etc. Major class：（1）Line style antibacterial peptide without cysteine, such as cecropin, magainins；（2）Ring-like antibacterial with cysteine Peptide, such as alexin, anti-fungus peptide etc.；（3）Rich in a certain or two kinds of amino acid antibacterial peptide, mainly include Pro-rich Antibacterial peptide and antibacterial peptide rich in glycine etc.；（4）The antibacterial peptide generated by precursor macromolecule enzymolysis, such as horseshoe crab in Merostomata Hemocyanin.
The mechanism of action of different types of antibacterial peptide is different from conventional antibiotic, its target site is mainly pathogen cells Film, therefore be not easy to produce resistance, and antibacterial peptide to eukaryocyte almost without toxic side effect, only act on prokaryotic cell and The eukaryocyte of lesion occurs.Antibacterial peptide acts not only on gram-positive bacteria and Gram-negative bacteria, and acts on true Bacterium, protozoon, some viruses and tumour cell, simultaneously, moreover it is possible to accelerate immune and wound healing process.Since pathogen is to antibiotic Progressively develop immunity to drugs, antibacterial peptide is develops new antibacterium, antimycotic, antiviral and antitumor drug open it is wide before Scape.Foreign countries have 4 kinds of antimicrobial peptide medicaments into three phases clinic at present, and 2 kinds enter the second stage of clinical trial.In addition, antibacterial peptidyl Because importing plant, it is allowed to be integrated into DNA sequence, generates disease-resistant plant and obtained encouraging progress.Therefore, resist The research of bacterium peptide is not only of great significance in theory, but also has huge potentiality in practice.
Lysozyme is as a kind of functional polypeptide/albumen of the antibacterial activity with broad spectrum activity, in clinical research and on a large scale Market application above receive more and more extensive concern.Medically, lysozyme can lead to as the marker of a variety of diseases Cross the concentration and activity change for measuring lysozyme in urine, secretion, serum or tissue, one of the index as diagnosis.According to Lysozyme energy bacteriolyze, but to organizing non-stimulated, avirulent characteristic, oneself is widely used in food, medicine, chemical industry, bioengineering The fields of grade.It hangs razor clam（Sinonovacula constricta）As one of four big cultivated shellfish of China, occupied in aquaculture Important economic status.However, with coastal cities expanding economy, marine pollution increasingly sharpens, and causes to cultivate razor clam disease of hanging Evil problem happens occasionally, and the disease that especially bacteriosis triggers seriously constrains the existence and growth for razor clam of hanging.It is hanging at present It is prevented mostly using antibiotic in razor clam cultivation, but antibiotic is a large amount of using the appearance for resulting in " superbacteria " and anti- Food-safety problem caused by the residual of raw element becomes increasingly conspicuous, and there is an urgent need to develop antibacterial agents to be prevented by people.Bacteriolyze Enzyme will not cause bacterial resistance sex chromosome mosaicism and effect harmless to the human body as a kind of natural disinfection albumen.Therefore, build Razor clam lysozyme gene of hanging expresses engineering bacteria, and then the green disease preparation of industrialization preparation is extremely urgent applied to aquaculture.
The content of the invention
The technical problems to be solved by the invention are to provide one kind and hang -2 gene of razor clam I types lysozyme, encoding proteins and restructuring The construction method of -2 genetic engineering bacterium of razor clam I types of hanging lysozyme and application, the recombinant protein of expression are magnificent to Gram-negative bacteria Vibrios, Vibrio harveyi, vibrio parahaemolytious have stronger bacteriostatic activity.
Technical solution is used by the present invention solves above-mentioned technical problem：
1st, one kind is hung -2 gene of razor clam I types lysozyme, which has the gene order shown in SEQID NO.1.The sequence 1558 bp include the open reading frame of 426 bp, encode 141 amino acid, 5 ' the non-coding head of district, 375 bp, 3 ' noncoding regions Long 757 bp, have polyadenosine acid signal, typical poly A tails are contained in sequence end.
The cloning process of above-mentioned -2 gene of razor clam I types lysozyme of hanging, according to the expressed sequence with -2 DNA homolog of I types lysozyme The nested primer of label E ST sequence designs RACE using RACE technology amplification gene overall lengths, is as follows：
（1）By the way that the razor clam hepatic tissue high throughput transcript profile of hanging that vibrio parahaemolytious infects is sequenced, it was found that 1 encoding Type I The est sequence of lysozyme gene carries out full length gene clone with this est sequence segment；
（2）RACE design of primers：According to 3 ' RACE of the EST for the Partial Fragment for encoding -2 gene of razor clam I types lysozyme of hanging clone's designs Nested primer：3 ' upstream specificity amplification primers 1：CAGTTTCCTCCCGGACCTGTTGA, 3 ' upstream specificity amplification primers 2：GCCAGACGTACGCTAGGGAACAC expands 3 ' adapter-primer Adaptor3：GGCCACGCGTCGACTAGTACTT；
It is as follows：
A. Total RNAs extraction：Take the hepatic tissue for razor clam of hanging that RNA extracting solutions are prepared；
B.3 '-RACE is expanded：By above-mentioned RNA extracting solutions with 3 '-Full RACE Core Set with PrimeScript The template of RTase kits reverse transcription synthesis amplification 3 ' as template, is connect using 3 ' upstream specific primers 1 and amplification 3 ' Head primer carries out PCR amplifications, and PCR product is as template after taking dilution, then with 3 ' upstream specific primers 2 and expands 3 ' connectors Primer carries out PCR amplification, obtains 3 ' end purpose bands；
C. the end of amplified production 3 ' purpose band being recycled using gel reclaims kit, recovery product is connected with carrier pMD19-T, It converts to Escherichia coliEscherichia coliAfter DH5 α, containing the LB plating mediums that ammonia benzyl concentration is 50 μ g/mL Middle culture 8-12 h, picking positive colony bacterium colony carry out PCR verifications and send to Shanghai Hua Da gene biological Engineering Co., Ltd to survey Sequence, acquired results obtain -2 full length gene sequence of razor clam I types lysozyme of hanging through the analysis splicing of DNAMAN softwares, and gene order is such as Shown in SEQIDNO.1.
3rd, above-mentioned -2 gene coded protein of razor clam I types lysozyme of hanging, the encoding proteins have the amino acid shown in SEQIDNO.2 Sequence.The molecular weight of albumen is 17.33965 KDa, and isoelectric point 7.90, mature peptide is with the amino shown in SEQIDNO.3 Acid sequence.
4th, it is a kind of to recombinate -2 gene of razor clam I types lysozyme of hanging using above-mentioned -2 gene coded protein of razor clam I types lysozyme structure of hanging The method of engineering bacteria, step are as follows：
（1）PCR primer is designed, with containing respectivelyBamHI site andXhoThe primer amplification of I site hang razor clam I types lysozyme -2 coding The ripe peptide sequence of albumen；
（2）Obtained target gene insertion pET28 will be cloned（a）Carrier obtains recombinant plasmid pET28（a）- I types lysozyme -2；
（3）To recombinant plasmid pET28（a）- I types lysozyme -2 carries out induced expression, then is purified to obtain and recombinate razor clam I types of hanging - 2 genetic engineering bacterium of lysozyme.
It is as follows：
（1）- 2 full length gene of I types lysozyme is cloned and the construction and expression of recombinant protein
A.PCR is expanded：Take the hepatic tissue for razor clam of hanging that RNA extracting solutions are prepared；By RNA extracting solutions cDNA synthetic agent box Reverse transcription synthesizes cDNA, then using the cDNA of synthesis as template, with containing respectivelyBamHI site andXhoThe primer amplification of I site The ripe peptide sequence of -2 encoding proteins of razor clam I types of hanging lysozyme, wherein containingBamH- 2 upstream amplification primer of I site I types lysozyme：GGATCCCAGTTTCCTCCCGGACCTGTTGA；ContainXho- 2 downstream amplification primer of I site I types lysozyme：CTCGAGTTAAACAAGATGCCCACATCCGG；
B.PCR positive colony plasmids：After amplified reaction, PCR product is recycled with plastic recovery kit, then recovery product and carrier PMD19-T connections, convert to Escherichia coliEscherichia coliAfter DH5 α, containing the LB that ammonia benzyl concentration is 50 μ g/mL 8-12 h are cultivated in plating medium, picking positive colony bacterium colony carries out PCR verifications and sequencing identification, obtains correct PCR sun Property cloned plasmids；
C. recombinant plasmid：PCR positive colony plasmids are usedBamHI andXhoI restriction enzymes double zyme cuttings, Ago-Gel electricity Swimming recycling purpose band, with the pET28 through similary digestion（a）Prokaryotic expression carrier digestion products connect, conversionEscherichia coliDH5 α, PCR screening positive clones obtain the correct expression vector pET28 of encoder block through sequencing identification（a）- I type bacteriolyzes - 2 recombinant plasmid of enzyme；
D. the expression of recombinant protein：By positive recombinant plasmid pET28（a）- I types lysozyme -2 is transformed into competence expressive host BL21（DE3）, inoculate kanamycins concentration be 50 μ g/mL LB culture solutions in, 37 DEG C, 200r/min shaken cultivations extremely Bacterium solution OD600Value be 0.4-0.6 when, add in isopropyl-beta D-thio galactopyranoside make its final concentration of 1 mmol/L, 37 DEG C of 7 h of induced expression collect bacterium solution, through 10000g, 4 DEG C, centrifuge 5 min, abandon supernatant, obtain bacterial precipitation object；
（2）The purifying of recombinant protein
A, cellular lysate：Bacterial sediment is resuspended in 100 mL bacterial precipitations objects, 10 mL lysis buffer, adds in 1 mg/mL Lysozyme, be incubated 30 min on ice, ultrasonication thalline, 10000 g, centrifuge 20 min, collect supernatant by 4 DEG C；
B, protein purification：Draw 1 mL Ni-NTA SefinoseTMResin upper props with sterile washing twice, then use lysis Buffer is balanced once；By the Ni-NTA Sefinose of supernatant and upper prop beforeTMResin is mixed, 4 DEG C of 2 h of mixing, is collected Efflux is eluted, every time 10 mL with wash buffer, is eluted 2 times, is then added in 1.25 mL elution buffer, wash It is 4 times de-, efflux is collected respectively；The efflux that the elution buffer collected every time are eluted is taken to carry out SDS-PAGE electrophoresis mirror It is fixed, it obtains and recombinates -2 genetic engineering bacterium of razor clam I types lysozyme of hanging.
Above-mentioned steps（2）In,
The lysis buffer formulas are 50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazoles, pH=8.0；
The wash buffer formulas are 50 mM NaH2PO4, 300 mM NaCl, 40 mM imidazoles, pH=8.0；
The elution buffer formulas are 50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazoles, pH=8.0.
5th, above-mentioned restructuring is hung the application of -2 genetic engineering bacterium of razor clam I types lysozyme, and -2 albumen of I types lysozyme of expression is being made Standby Vibrio harveyi, the effect in terms of vibrio parahaemolytious and Vibrio splindidus inhibitor.
Compared with prior art, the advantage of the invention is that：The present invention is fast by 3 ' end cDNA using technique for gene engineering Speed amplification（3’-RACE）Method, clone has obtained -2 gene cDNA sequence of I types lysozyme from razor clam of hanging for the first time, while to hanging - 2 protein of razor clam I types lysozyme carries out structure and the expression of recombinant plasmid, and -2 albumen of restructuring I types lysozyme of acquisition, which has, to be inhibited Vibrio harveyi, vibrio parahaemolytious, the effect of Vibrio splindidus growth, and to gram-positive bacteria staphylococcus aureus and gamboge Micrococcus luteus then without bacteriostatic activity, the invention has the advantages that：
A, the recombinant protein obtained using technique for gene engineering is had the advantages that at low cost compared with chemical synthesis；
B, the recombinant protein has the inhibitory activity of Gram-negative bacteria specificity.Engineering bacteria is generated by the method for this research - 2 albumen of I types lysozyme be invested in razor clam breeding environment of hanging, added on the basis of razor clam itself of hanging generates I types lysozyme -2 - 2 pairs of negative pathogens rejection abilities of I types lysozyme can infect vibrios for razor clam of hanging and provide a kind of solution.
Description of the drawings
Fig. 1 be hang razor clam I types -2 vitro recombinations of lysozyme it is protein induced after SDS-PAGE analyses, M swimming lanes are protein point Sub- amount standard, 1 is does not induce full bacterium solution, and 2 be the full bacterium solution of induction.
Fig. 2 is the analyses of the SDS-PAGE after -2 vitro recombination protein purification of razor clam I types lysozyme of hanging, and M swimming lanes are protein point Sub- amount standard, 1 is purification of recombinant proteins.
Fig. 3 is inhibitory action design sketch of -2 vitro recombination albumen of razor clam I types lysozyme to Vibrio splindidus of hanging, 1,2,3 in figure It is negative control group 1 for 100 μ g/ Oxford cups of recombinant protein mass concentration, 50 μ g/ Oxford cups, 20 μ g/ Oxford cups, 4（It is sterile 2216E culture mediums）, 5 be negative control group 2（PBS）.
Fig. 4 is inhibitory action design sketch of -2 vitro recombination albumen of razor clam I types lysozyme to Vibrio harveyi of hanging, 1 in figure, 2, 3 be 100 μ g/ Oxford cups of recombinant protein mass concentration, 50 μ g/ Oxford cups, 20 μ g/ Oxford cups, and 4 be negative control group 1 （2216E culture mediums）, 5 be negative control group 2（PBS）.
Fig. 5 is inhibitory action design sketch of -2 vitro recombination albumen of razor clam I types lysozyme to vibrio parahaemolytious of hanging, 1 in figure, 2, 3 be 100 μ g/ Oxford cups of recombinant protein mass concentration, 50 μ g/ Oxford cups, 20 μ g/ Oxford cups, and 4 be negative control group 1 （2216E culture mediums）, 5 be negative control group 2（PBS）.
Fig. 6 is inhibitory action design sketch of -2 vitro recombination albumen of razor clam I types lysozyme to micrococcus luteus of hanging, 1 in figure, 2, 3 be 100 μ g/ Oxford cups of recombinant protein mass concentration, 50 μ g/ Oxford cups, 20 μ g/ Oxford cups, and 4 be negative control group 1（Rattan Yellow microballoon bacterium culture medium）, 5 be negative control group 2（PBS）.
Fig. 7 is inhibitory action design sketch of -2 vitro recombination albumen of razor clam I types lysozyme to staphylococcus aureus of hanging, in figure 1st, 2,3 be 100 μ g/ Oxford cups of recombinant protein mass concentration, 50 μ g/ Oxford cups, 20 μ g/ Oxford cups, and 4 be negative control group 1 （Staphylococcus aureus culture medium）, 5 be negative control group 2（PBS）.
Specific embodiment
The present invention is described in further detail below in conjunction with attached drawing embodiment.
Specific embodiment one
- 2 gene cloning and sequencing of I types lysozyme
（1）The EST of hang razor clam cDNA library is induced by early period vibrio parahaemolytious（EST）Analysis, it was found that 1 The est sequence of -2 gene of encoding Type I lysozyme clones this EST and carries out sequencing analysis, and it is molten to show that the clone encodes razor clam I types of hanging The Partial Fragment of bacterium enzyme -2；
（2）RACE design of primers：According to 3 ' RACE of the EST for the Partial Fragment for encoding -2 gene of razor clam I types lysozyme of hanging clone's designs Nested primer：3 ' upstream specificity amplification primers 1：CAGTTTCCTCCCGGACCTGTTGA, 3 ' upstream specificity amplification primers 2：GCCAGACGTACGCTAGGGAACAC expands 3 ' adapter-primer Adaptor3：GGCCACGCGTCGACTAGTACTT；
（3）- 2 full length gene sequence of razor clam I types lysozyme of hanging is obtained using 3 ' RACE amplifications, is as follows：
A. Total RNAs extraction：Take the hepatic tissue for razor clam of hanging（0.2 g-1 g）In 1.5 mL RNA free centrifuge tubes, add in Trizol reagents（It is purchased from Takara companies）1.0 mL are fully homogenized with homogenizer.4 DEG C, 12000 g, 5 min are centrifuged, Supernatant is taken, adds 0.2 mL chloroforms, shakes mixing, is stored at room temperature 5 min, 4 DEG C, 12000 g, centrifuges 15 min, in absorption Clearly into centrifuge tube, the isometric isopropanol of the supernatant is added in, mixing is stored at room temperature 5 min, 4 DEG C, 12000 rpm, centrifuges 5 Min removes supernatant, and 1 mL of ethyl alcohol that mass percentage concentration is 75% is added in precipitation, 4 DEG C, 12000 rpm, 5 min is centrifuged, abandons 1 mL of ethyl alcohol that mass percentage concentration is 75% is added in precipitation after supernatant and precipitation is resuspended, 4 DEG C, 12000 rpm, centrifuge 5 Min, removes supernatant, and precipitation stands 5-10 min, 20 μ L is added to obtain RNA extracting solutions without RNase water；
B.3 '-RACE is expanded：By above-mentioned RNA extracting solutions with 3 '-Full RACE Core Set with PrimeScript RTase kits（Takara companies）The template of reverse transcription synthesis amplification 3 ', specific synthetic method are operated according to kit specification, As template, PCR amplifications are carried out using 3 ' upstream specific primers 1 and 3 ' adapter-primers of amplification, take the PCR of 100 times of dilution 1 μ L of product carry out PCR amplification as template, then with 3 ' upstream specific primers 2 and 3 ' adapter-primers of amplification, obtain 3 ' end mesh Band；Wherein RACE amplification reaction systems and reaction condition：1.0 μ L, 10 × PCR buffer solutions of template（Containing Mg2+）2.5 μ L, The 2.0 μ L of dNTP of 2.5 mM of concentration, the 1.0 μ L of specific primer that 10 μM of concentration, 1.0 μ of adapter-primer that 10 μM of concentration The 0.2 μ L of archaeal dna polymerase of L, concentration 5U/ μ L, ultra-pure water：17.3 μL；Amplification condition：94 ℃ 5 min、94 ℃ 30 s、 55 DEG C of 45 s, 72 DEG C of 1 min, totally 35 cycle, 10 min of last 72 DEG C of extensions.
C. purpose band is held to use gel reclaims kit amplified production 3 '（Hundred Tykes）Recycling, recovery product and carrier pMD19-T（Takara companies）Connection, converts to Escherichia coliEscherichia coliDH5α（Takara companies）Afterwards, exist Contain the LB plating mediums that ammonia benzyl concentration is 50 μ g/mL（LB plating medium formulas：10 g/L of tryptone, yeast extraction 5 10 g/L of g/L, NaCl of object, agar powder 15g/L）Middle culture 8-12 h, picking positive colony bacterium colony carry out PCR verifications and send Be sequenced to Shanghai Hua Da genetic engineering Co., Ltd, acquired results through the analysis splicing of DNAMAN softwares obtain hanging razor clam I types lysozyme- 2 full length gene sequences.
What is finally obtained hangs -2 gene cDNA sequence of razor clam I types lysozyme as shown in SEQIDNO.1, the sequence 1558 Bp includes the open reading frame of 426 bp, encodes 141 amino acid, 5 ' the non-coding head of district, 375 bp, 3 ' the non-coding heads of district 757 Bp has polyadenosine acid signal, and typical poly A tails are contained in sequence end.The amino of -2 protein of razor clam I types of hanging lysozyme Acid sequence is as shown in SEQIDNO.2, which is 17.33965 KDa, isoelectric point 7.90, wherein coded sequence 1-16 is signal peptide sequence, and ripe peptide amino acid sequence is as shown in SEQIDNO.3.
Specific embodiment two
The construction and expression of -2 genetic engineering bacterium of I types lysozyme
A. Total RNAs extraction：Take the hepatic tissue for razor clam of hanging（0.2 g-1 g）In 1.5 mL RNA free centrifuge tubes, add in Trizol reagents（It is purchased from Takara companies）1.0 mL are fully homogenized with homogenizer.4 DEG C, 12000 g, 5 min are centrifuged, Supernatant is taken, adds 0.2 mL chloroforms, shakes mixing, is stored at room temperature 5 min, 4 DEG C, 12000 g, centrifuges 15 min, in absorption Clearly into centrifuge tube, the isometric isopropanol of the supernatant is added in, mixing is stored at room temperature 5 min, 4 DEG C, 12000 rpm, centrifuges 5 Min removes supernatant, and 1 mL of ethyl alcohol that mass percentage concentration is 75% is added in precipitation, 4 DEG C, 12000 rpm, 5 min is centrifuged, abandons 1 mL of ethyl alcohol that mass percentage concentration is 75% is added in precipitation after supernatant and precipitation is resuspended, 4 DEG C, 12000 rpm, centrifuge 5 min , supernatant is removed, precipitation stands 5-10 min, 20 μ L is added to obtain RNA extracting solutions without RNase water；
B, cDNA is synthesized：By above-mentioned RNA extracting solutions cDNA synthetic agent box（Takara）Transcribe cDNA, specific synthetic method according to CDNA kit specifications operate, and the cDNA then synthesized with the primer pair with restriction enzyme site carries out PCR amplification, i.e., following institute Show：
ContainBamH- 2 upstream amplification primer of I site I types lysozyme：GGATCCCAGTTTCCTCCCGGACCTGTTGA；
ContainXho- 2 downstream amplification primer of I site I types lysozyme：CTCGAGTTAAACAAGATGCCCACATCCGG；
C, PCR amplification：1.0 μ L, 10 × PCR buffer solutions of cDNA（Containing Mg2+）The 2.0 μ L of dNTP of 2.5 μ L, 10 mM of concentration, The 1.0 μ L of sense primer that 10 μM of concentration, the 0.2 μ L of archaeal dna polymerase of anti-sense primer 1.0 μ L, concentration 5U/ the μ L of concentration surpass Pure water：17.3 μL ；Amplification condition：94 DEG C of 5min, 94 DEG C of 30 s, 55 DEG C of 45 s, 72 DEG C of 1 min, totally 35 are followed Ring, 10 min of last 72 DEG C of extensions；
D, PCR positive colony plasmids：After amplified reaction, plastic recovery kit is used（BioTeke）PCR product is recycled, is then recycled Product and carrier pMD19-T（Takara companies）Connection, converts to Escherichia coliEscherichia coliDH5α（Takara Company）Afterwards, the LB that ammonia benzyl concentration is 50 ug/mL is being contained（10 g/L of tryptone, 5 g/L, NaCl 10 of yeast extract G/L, agar powder 15g/L）8-12 h are cultivated in plating medium, picking positive colony bacterium colony carries out PCR verifications and sequencing mirror It is fixed, obtain correct positive colony plasmid；
E, recombinant plasmid：PCR positive colony plasmids are usedBmHI andXhoI（New England Biolabs, NEB）It is restricted Enzymes double zyme cutting, with the pET28 through similary digestion（a）Prokaryotic expression carrier connects, conversionEscherichia coli DH5 α, PCR screening positive clone obtain the correct expression vector pET28 of encoder block through sequencing identification（a）- I types lysozyme -2, by sun Property recombinant plasmid pET28（a）- I types lysozyme -2 is transformed into competence expressive host BL21（DE3）（Novagen companies）, then connect Kind arrives the LB culture solutions that kanamycins concentration is 50 μ g/mL（10 g/L of tryptone, 5 g/L, NaCl 10 of yeast extract G/L, 15 g/L of agar powder）In, 37 DEG C, 200 r/min shaken cultivations to bacterium solution OD600Value be 0.4-0.6 when, add in isopropyl Base-β-D- Thiogalactopyranosides（IPTG）Make its final concentration of 1 mmol/L, 37 DEG C of induced expression 3-7 h, collect bacterium Liquid through 10000 g, 4 DEG C, centrifuges 5 min, abandons supernatant, obtain bacterial precipitation object.SDS-PAGE detects recombination engineering bacteria The expression-form of inducible protein, as shown in Figure 1.
Specific embodiment three
The purifying of recombinant protein
A, cellular lysate：By 100 mL bacterial precipitations objects with 10 mL lysis buffer（5 mM of imidazole concentration）Thalline is resuspended to sink It forms sediment, adds in the lysozyme of 1 mg/mL, be incubated 30 min, ultrasonication thalline on ice（Surpass 5 s, stop 10 s, totally 6 times, power 30 W, 2 min）, 10000 g, 4 DEG C, 20 min of centrifugation collect supernatant.
B, protein purification：Draw 1 mL Ni-NTA SefinoseTMResin upper props with sterile washing twice, then are used lysis buffer（Imidazole concentration 5mM）Balance is once；By the Ni-NTA Sefinose of supernatant and upper prop beforeTMResin is mixed It closes, 4 DEG C of 2 h of mixing, efflux is collected, with wash buffer（40 mM of imidazole concentration）, 10 mL, elutes 2 times every time, respectively Efflux is collected, adds in 1.25 mL elution buffer（250 mM of imidazole concentration）, elute 4 times, collect efflux respectively. The efflux that the elution buffer collected every time are eluted is taken to carry out SDS-PAGE electroresis appraisals（The results are shown in Figure 2）, return Receive purpose band（It is destination protein shown in Fig. 2 arrows）, obtain and recombinate -2 albumen of razor clam I types lysozyme of hanging.In above-mentioned steps,
The lysis buffer（5 mM of imidazole concentration）Formula：50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazoles, pH=8.0；
The wash buffer（Imidazole concentration 40mM）Formula：50 mM NaH2PO4, 300 mM NaCl, 40 mM imidazoles, pH=8.0；
The elution buffer（250 mM of imidazole concentration）Formula：50 mM NaH2PO4, 300 mM NaCl, 250 mM Imidazoles, pH=8.0.
Specific embodiment four
（1）By 3 kinds of tested negative bacterium vibrio parahaemolytious（Vibrio parahaemolyticus）, Vibrio harveyi（Vibrio harveyi）, Vibrio splindidus（Vibrio splendidus）It is inoculated in 2216E fluid nutrient mediums（5 g/L of tryptone, yeast 1 g/L of extract, pH=7.6）In 28 DEG C, 150 r/min are cultivated to OD600=0.5,10 uL bacterium solutions is taken to apply tablet（Agar 12 g/mL）；
（2）By tested positive bacteria micrococcus luteus（Micrococcus luteus）And staphylococcus aureus （Staphylococcus aureus）It is inoculated in nutrient agar fluid nutrient medium（10 g/L of tryptone, 3 g/L of beef extract, NaCl 5g/L, pH=7.3 ± 0.1）In 35 DEG C, 150 r/min are cultivated, by bacterium solution and nutrient agar solid medium（Agar 15 g/L）Mixing is down flat plate, bacterial concentration 1 × 107 cfu/mL；
（3）Using improvement lysoplate assay（Oxford cup）- 2 albumen bacteriostatic activity of restructuring I types lysozyme is measured, each is tested Bacterium sets negative control group 1（Aseptic culture medium）, negative control group 2（PBS）With recombinant protein experimental group, in tablet described above It is middle to place sterile Oxford cup（0.8 cm of diameter）, added in successively into each Oxford cup 20 μ g/ Oxford cups of different quality concentration, The restructuring of 50 μ g/ Oxford cups, 100 μ g/ Oxford cups specific embodiments three structure gained is hung -2 genetic engineering bacterium of razor clam I types lysozyme And equal volume negative control group 1（Aseptic culture medium）, negative control group 2（PBS）, micrococcus luteus and Staphylococcus aureus Bacterium experimental group cultivates 24 h in 35 DEG C, other tested bacterium experimental groups cultivate 24 h in 28 DEG C, the results show that specific embodiment three The restructuring of structure gained hangs -2 genetic engineering bacterium of razor clam I types lysozyme to 3 plants of tested aquatic pathogenic bacterium Vibrio splindidus, Vibrio harveyis （Fig. 3, Fig. 4）And vibrio parahaemolytious（Fig. 5）With more apparent inhibitory action, and to positive bacteria micrococcus luteus（Fig. 6）With Staphylococcus aureus（Fig. 7）There is no bacteriostasis.Wherein, recombinant proteins concentration is 100 μ g/ Oxford cups to magnificent arc The bacteriostatic diameter of bacterium is 2.39 ± 0.23 cm, and recombinant proteins concentration is 50 μ g/ Oxford cups to the antibacterial of Vibrio splindidus A diameter of 1.92 ± 0.17 cm, recombinant proteins concentration are that 20 μ g/ Oxford cups are to the bacteriostatic diameter of Vibrio splindidus 0.92 ± 0.04 cm；Recombinant proteins concentration is that 100 μ g/ Oxford cups are 1.93 to the bacteriostatic diameter of Vibrio harveyi ± 0.15 cm, recombinant proteins concentration are that 50 μ g/ Oxford cups are 1.43 ± 0.14 to the bacteriostatic diameter of Vibrio harveyi cm；Recombinant proteins concentration is that 20 μ g/ Oxford cups are 0.98 ± 0.02 cm to the bacteriostatic diameter of Vibrio harveyi；Restructuring Albumen quality concentration is that 100 μ g/ Oxford cups are 1.92 ± 0.22 cm to the bacteriostatic diameter of vibrio parahaemolytious, recombinant protein Amount concentration is that 50 μ g/ Oxford cups are 1.40 ± 0.19 cm to the bacteriostatic diameter of vibrio parahaemolytious, recombinant proteins concentration It is not notable to the inhibition zone of vibrio parahaemolytious for 20 μ g/ Oxford cups.
Above description is not limitation of the present invention, and the present invention is also not limited to the example above.The art it is common Technical staff is in the essential scope of the present invention, the variations, modifications, additions or substitutions made, should also belong to the protection of the present invention Scope, protection scope of the present invention are subject to claims.
Sequence table
<110>University Of Ningbo
<120>- 2 gene of razor clam I types of hanging lysozyme, encoding proteins and the structure side for recombinating -2 genetic engineering bacterium of razor clam I types lysozyme of hanging Method
<160> 8
<170> PatentIn version 3.3
<210> 1
<211>1558
<212> DNA
<213>- 2 full length gene of razor clam I types of hanging lysozyme
<400> 1
ACTTCTCGCT AGTTATGTAA ACAGCTTACA CTTATTTACG AAGAACCTCA TTTAACCACT 60
TACACACTTA CATCATTGGT CCTTTCTTAT AGTTTGACCT TGATAATGAG TAATAATAGA 120
ATACAAATAC TTTGCAAGAT AGGTTTGTAT CTGTAAATAA ACGGAAGTAC CTACTAGTAC 180
GGACGGAAAT CCGCCATTTT TTGGGAATAT AATGGTTTTA TAGTAGAAAC AATTGTTATT 240
TCTAGGAATA ACTGGATACA TTGCATTACA TATCCTACAA CAACACACCG CCAACGTTTT 300
GAAATAAGCT ACGCCCATCT TTGAGACAAC CGAAGACAGA AGATAGTTTA CACTAGTGTT 360
TGATTCCGCT CCAGGATGTT GTTTATTGCC GTGTTTCTGG CAGTGGTGGC CATAGCTGGC 420
GGTCAGTTTC CTCCCGGACC TGTTGAAGAC GACTGTATGA GTTGTATCTG CACGATGGAA 480
TCCGGATGTA ATCCATTAGA CTGTCGAATG GATGTAGGGT CCCTTTCCTG TGGATATTTC 540
CAGATCAAGC TGCCATACTA TCAAGACTGC GGTCAACCAC GCTCAGATCT GGGCTGGAAG 600
GGTTGTTCGA ATGACTTGAC GTGTGCAGCA ACTTGTGTTC AAAATTACAT GAGACGTTAT 660
GTTGGGCGGT CAGGCTGCAG TCCAACATGC CAGACGTACG CTAGGGAACA CAACGGTGGA 720
CCCATTGGAT GCCGCCGGAG CTCGACGCTG AAATACTGGG AGGCTCTGAA GAAAATCCCC 780
GGATGTGGGC ATCTTGTTTA AGGACATAAC GTCGTCTTGC GCTAGTTGTA ATCAAATCCA 840
GTGCTAACTG TTTTATTTAC TTTCTTGATA TGCAATACTT TGTTATGATT GACAGTCTTA 900
AATATTAAGG TGACCTGAAC GTCTGTTGAT CTGTGTTTGC TGTCTAATGT AATACGAAAC 960
AGACGTCACC TAACGTAACA TAAAATCATT ACGTCGCCAT CCGTTAGCGG ATCCATTACT 1020
AATGTAAGCA GTTTTAAGAA TTGTTATTAA TTTTTGTTTG AATATCCGAC CACCAGTACA 1080
ATAAACATGG CTTGAACATT TAACTTTTAT GCCACTCGAA ATGCACTTTT ACTGTTGGGA 1140
TACTGCGCAA TATGCTATAC TGTTTATTTG TAATCTTATT ATAAATAGTC TCGCGAACAT 1200
ATGTTTTTTA TCGGCTTACC AAATTAAATA GATACCCTTT CTAATATTCC TCAAGTAGAT 1260
ATCATATGAT AATTTAGCGT GGCTATTTCC TTTCTTTTTT CTTTGTTTTT GTTTGAATTA 1320
CTGTCGATGC AAACTGAAAA ATACTATTAT TACCGTCAGT CTATTTGTGT TACAATCAAT 1380
CTATTTGTGA ATATTAGAAT TTAATATACC GAAGGTGAAA GATGGACTAA CAAATTCTTT 1440
TACATATATC AGTGGGGAAT TAGAACGATT CTTGTTTTTA TTGTGTTTGT ATGAAAGACG 1500
ATGCTGAATC TATAACTTAAA TAAACGACTT TATTCGTCGA AACTGAAAAA AAAAAAA 1558
<210> 2
<211> 141
<212> PRT
<213>- 2 gene coded protein of razor clam I types of hanging lysozyme
<400> 2
Met Leu Phe Ile Ala Val Phe Leu Ala Val Val Ala Ile Ala Gly
1 5 10 15
Gly Gln Phe Pro Pro Gly Pro Val Glu Asp Asp Cys Met Ser Cys
20 25 30
Ile Cys Thr Met Glu Ser Gly Cys Asn Pro Leu Asp Cys Arg Met
35 40 45
Asp Val Gly Ser Leu Ser Cys Gly Tyr Phe Gln Ile Lys Leu Pro
50 55 60
Tyr Tyr Gln Asp Cys Gly Gln Pro Arg Ser Asp Leu Gly Trp Lys
65 70 75
Gly Cys Ser Asn Asp Leu Thr Cys Ala Ala Thr Cys Val Gln Asn
80 85 90
Tyr Met Arg Arg Tyr Val Gly Arg Ser Gly Cys Ser Pro Thr Cys
95 100 105
Gln Thr Tyr Ala Arg Glu His Asn Gly Gly Pro Ile Gly Cys Arg
110 115 120
Arg Ser Ser Thr Leu Lys Tyr Trp Glu Ala Leu Lys Lys Ile Pro
125 130 135
Gly Cys Gly His Leu Val
140
<210> 3
<211> 125
<212> PRT
<213>The mature peptide of -2 gene coded protein of razor clam I types of hanging lysozyme
<400> 3
Gln Phe Pro Pro Gly Pro Val Glu Asp Asp Cys Met Ser Cys Ile
1 5 10 15
Cys Thr Met Glu Ser Gly Cys Asn Pro Leu Asp Cys Arg Met Asp
20 25 30
Val Gly Ser Leu Ser Cys Gly Tyr Phe Gln Ile Lys Leu Pro Tyr
35 40 45
Tyr Gln Asp Cys Gly Gln Pro Arg Ser Asp Leu Gly Trp Lys Gly
50 55 60
Cys Ser Asn Asp Leu Thr Cys Ala Ala Thr Cys Val Gln Asn Tyr
65 70 75
Met Arg Arg Tyr Val Gly Arg Ser Gly Cys Ser Pro Thr Cys Gln
80 85 90
Thr Tyr Ala Arg Glu His Asn Gly Gly Pro Ile Gly Cys Arg Arg
95 100 105
Ser Ser Thr Leu Lys Tyr Trp Glu Ala Leu Lys Lys Ile Pro Gly
110 115 120
Cys Gly His Leu Val
125
<210> 4
<211> 23
<212> DNA
<213>3 ' upstream specificity amplification primers 1
<400> 4
CAGTTTCCTC CCGGACCTGT TGA 23
<210> 5
<211> 23
<212> DNA
<213>3 ' upstream specificity amplification primers 2
<400> 5
GCCAGACGTA CGCTAGGGAA CAC 23
<210> 6
<211> 22
<212> DNA
<213>Expand 3 ' adapter-primers
<400> 6
GGCCACGCGTCGACTAGTACTT 22
<210> 7
<211> 29
<212> DNA
<213>- 2 upstream amplification primer of the I types of I site containing BamH lysozyme
<400> 7
GGATCCCAGT TTCCTCCCGG ACCTGTTGA 29
<210> 8
<211> 29
<212> DNA
<213>Contain -2 downstream amplification primer of Not I site I types lysozyme
<400> 8
CTCGAGTTAA ACAAGATGCC CACATCCGG 29

Claims (8)

  1. - 2 gene of razor clam I types lysozyme 1. one kind is hung, it is characterised in that：The gene has the gene order shown in SEQID NO.1.
  2. 2. a kind of cloning process of razor clam I types lysozyme -2 gene described in claim 1 of hanging, it is characterised in that：According to molten with I types The nested primer of the EST est sequence design RACE of -2 DNA homolog of bacterium enzyme is complete using RACE technology amplification genes It is long, it is as follows：
    （1）By the way that the razor clam hepatic tissue high throughput transcript profile of hanging that vibrio parahaemolytious infects is sequenced, it was found that 1 encoding Type I The est sequence of lysozyme gene carries out full length gene clone with this est sequence segment；
    （2）RACE design of primers：According to 3 ' RACE of the EST for the Partial Fragment for encoding -2 gene of razor clam I types lysozyme of hanging clone's designs Nested primer：3 ' upstream specificity amplification primers 1：CAGTTTCCTCCCGGACCTGTTGA, 3 ' upstream specificity amplification primers 2：GCCAGACGTACGCTAGGGAACAC expands 3 ' adapter-primer Adaptor3：GGCCACGCGTCGACTAGTACTT；
    （3）3 ' RACE amplifications obtain -2 full length gene sequence of razor clam I types lysozyme of hanging, and are as follows：
    A. Total RNAs extraction：Take the hepatic tissue for razor clam of hanging that RNA extracting solutions are prepared；
    B.3 '-RACE is expanded：By above-mentioned RNA extracting solutions with 3 '-Full RACE Core Set with PrimeScript The template of RTase kits reverse transcription synthesis amplification 3 ' as template, is connect using 3 ' upstream specific primers 1 and amplification 3 ' Head primer carries out PCR amplifications, and PCR product is as template after taking dilution, then with 3 ' upstream specific primers 2 and expands 3 ' connectors Primer carries out PCR amplification, obtains 3 ' end purpose bands；
    C. the end of amplified production 3 ' purpose band being recycled using gel reclaims kit, recovery product is connected with carrier pMD19-T, It converts to Escherichia coliEscherichia coliAfter DH5 α, containing the LB plating mediums that ammonia benzyl concentration is 50 μ g/mL Middle culture 8-12 h, picking positive colony bacterium colony carry out PCR verifications and send to Shanghai Hua Da gene biological Engineering Co., Ltd to survey Sequence, acquired results obtain -2 full length gene sequence of razor clam I types lysozyme of hanging through the analysis splicing of DNAMAN softwares, and gene order is such as Shown in SEQIDNO.1.
  3. 3. a kind of -2 gene coded protein of razor clam I types lysozyme of hanging described in claim 1 or 2, it is characterised in that：The encoding proteins With the amino acid sequence shown in SEQIDNO.2.
  4. - 2 gene coded protein of razor clam I types lysozyme 4. one kind according to claim 3 is hung, it is characterised in that：The coding egg White mature peptide has the amino acid sequence shown in SEQIDNO.3.
  5. The razor clam I type bacteriolyzes 5. a kind of -2 gene coded protein of razor clam I types lysozyme structure restructuring of hanging using described in claim 4 is hung The method of -2 genetic engineering bacterium of enzyme, it is characterised in that step is as follows：
    （1）PCR primer is designed, with containing respectivelyBamHI site andXhoThe primer amplification of I site hang razor clam I types lysozyme -2 coding The ripe peptide sequence of albumen；
    （2）Obtained target gene insertion pET28 will be cloned（a）Carrier obtains recombinant plasmid pET28（a）- I types lysozyme -2；
    （3）To recombinant plasmid pET28（a）- I types lysozyme -2 carries out induced expression, then is purified to obtain and recombinate razor clam I types of hanging - 2 genetic engineering bacterium of lysozyme.
  6. The construction method of -2 genetic engineering bacterium of razor clam I types lysozyme 6. restructuring according to claim 5 is hung, it is characterised in that tool Body step is as follows：
    （1）- 2 full length gene of I types lysozyme is cloned and the construction and expression of recombinant protein
    A.PCR is expanded：Take the hepatic tissue for razor clam of hanging that RNA extracting solutions are prepared；By RNA extracting solutions cDNA synthetic agent box Reverse transcription synthesizes cDNA, then using the cDNA of synthesis as template, with containing respectivelyBamHI site andXhoThe primer amplification of I site The ripe peptide sequence of -2 encoding proteins of razor clam I types of hanging lysozyme, wherein containingBamH- 2 upstream amplification primer of I site I types lysozyme：GGATCCCAGTTTCCTCCCGGACCTGTTGA；ContainXho- 2 downstream amplification primer of I site I types lysozyme：CTCGAGTTAAACAAGATGCCCACATCCGG；
    B.PCR positive colony plasmids：After amplified reaction, PCR product is recycled with plastic recovery kit, then recovery product and carrier PMD19-T connections, convert to Escherichia coliEscherichia coliAfter DH5 α, containing the LB that ammonia benzyl concentration is 50 μ g/mL 8-12 h are cultivated in plating medium, picking positive colony bacterium colony carries out PCR verifications and sequencing identification, obtains correct PCR sun Property cloned plasmids；
    C. recombinant plasmid：PCR positive colony plasmids are usedBamHI andXhoI restriction enzymes double zyme cuttings, Ago-Gel electricity Swimming recycling purpose band, with the pET28 through similary digestion（a）Prokaryotic expression carrier digestion products connect, conversionEscherichia coliDH5 α, PCR screening positive clones obtain the correct expression vector pET28 of encoder block through sequencing identification（a）- I type bacteriolyzes - 2 recombinant plasmid of enzyme；
    D. the expression of recombinant protein：By positive recombinant plasmid pET28（a）- I types lysozyme -2 is transformed into competence expressive host BL21（DE3）, inoculate kanamycins concentration be 50 μ g/mL LB culture solutions in, 37 DEG C, 200r/min shaken cultivations extremely Bacterium solution OD600Value be 0.4-0.6 when, add in isopropyl-beta D-thio galactopyranoside make its final concentration of 1 mmol/L, 37 DEG C of 7 h of induced expression collect bacterium solution, through 10000g, 4 DEG C, centrifuge 5 min, abandon supernatant, obtain bacterial precipitation object；
    （2）The purifying of recombinant protein
    A, cellular lysate：Bacterial sediment is resuspended in 100 mL bacterial precipitations objects, 10 mL lysis buffer, adds in 1 mg/mL Lysozyme, be incubated 30 min on ice, ultrasonication thalline, 10000 g, centrifuge 20 min, collect supernatant by 4 DEG C；
    B, protein purification：Draw 1 mL Ni-NTA SefinoseTMResin upper props with sterile washing twice, then use lysis Buffer is balanced once；By the Ni-NTA Sefinose of supernatant and upper prop beforeTMResin is mixed, 4 DEG C of 2 h of mixing, is collected Efflux is eluted, every time 10 mL with wash buffer, is eluted 2 times, is then added in 1.25 mL elution buffer, wash It is 4 times de-, efflux is collected respectively；The efflux that the elution buffer collected every time are eluted is taken to carry out SDS-PAGE electrophoresis mirror It is fixed, it obtains and recombinates -2 genetic engineering bacterium of razor clam I types lysozyme of hanging.
  7. The construction method of -2 genetic engineering bacterium of razor clam I types lysozyme 7. restructuring according to claim 6 is hung, it is characterised in that on State step（2）In,
    The lysis buffer formulas are 50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazoles, pH=8.0；
    The wash buffer formulas are 50 mM NaH2PO4, 300 mM NaCl, 40 mM imidazoles, pH=8.0；
    The elution buffer formulas are 50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazoles, pH=8.0.
  8. The application of -2 genetic engineering bacterium of razor clam I types lysozyme 8. the restructuring any one of a kind of claim 5-7 is hung, feature It is：- 2 albumen of I types lysozyme that it is expressed is in terms of Vibrio harveyi, vibrio parahaemolytious and Vibrio splindidus inhibitor is prepared Effect.
CN201711363480.8A 2017-12-18 2017-12-18 Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria Active CN108048475B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711363480.8A CN108048475B (en) 2017-12-18 2017-12-18 Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711363480.8A CN108048475B (en) 2017-12-18 2017-12-18 Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria

Publications (2)

Publication Number Publication Date
CN108048475A true CN108048475A (en) 2018-05-18
CN108048475B CN108048475B (en) 2021-03-23

Family

ID=62133452

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711363480.8A Active CN108048475B (en) 2017-12-18 2017-12-18 Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria

Country Status (1)

Country Link
CN (1) CN108048475B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110791571A (en) * 2019-11-15 2020-02-14 中国科学院南海海洋研究所 SNP marker for distinguishing Vibrio harveyi infection resistance of litopenaeus vannamei, and detection method and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103045604A (en) * 2012-12-17 2013-04-17 淮海工学院 Method for preparing antibacterial peptide by carrying out PCR recombination on sinonovacula antibacterial peptide gene and application of antibacterial peptide
CN107267519A (en) * 2017-05-10 2017-10-20 宁波大学 Hang razor clam C1q genes, encoding proteins and its cloning process and restructuring is hung razor clam C1q construction of genetic engineering methods

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103045604A (en) * 2012-12-17 2013-04-17 淮海工学院 Method for preparing antibacterial peptide by carrying out PCR recombination on sinonovacula antibacterial peptide gene and application of antibacterial peptide
CN107267519A (en) * 2017-05-10 2017-10-20 宁波大学 Hang razor clam C1q genes, encoding proteins and its cloning process and restructuring is hung razor clam C1q construction of genetic engineering methods

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FAN CHEN等: "Molecular characteristics, expression, and antimicrobial activities of i-type lysozyme from the razor clam Sinonovacula constricta", 《FISH AND SHELLFISH IMMUNOLOGY》 *
MING GUO等: "Gene identification and antimicrobial activity analysis of a novel lysozyme from razor clam Sinonovacula constricta", 《FISH AND SHELLFISH IMMUNOLOGY》 *
XUELIN ZHAO等: "Comparative transcriptome analysis of Sinonovacula constricta in gills and hepatopancreas in response to Vibrio parahaemolyticus infection", 《FISH & SHELLFISH IMMUNOLOGY》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110791571A (en) * 2019-11-15 2020-02-14 中国科学院南海海洋研究所 SNP marker for distinguishing Vibrio harveyi infection resistance of litopenaeus vannamei, and detection method and application thereof
CN110791571B (en) * 2019-11-15 2021-06-29 中国科学院南海海洋研究所 SNP marker for distinguishing Vibrio harveyi infection resistance of litopenaeus vannamei, and detection method and application thereof

Also Published As

Publication number Publication date
CN108048475B (en) 2021-03-23

Similar Documents

Publication Publication Date Title
CN110643612B (en) Trachinotus ovatus antimicrobial peptide NK-lysin gene and application thereof
CN104745595B (en) Stichopus japonicus BPI genes, encoding proteins and its cloning process and restructuring stichopus japonicus BPI construction of genetic engineering methods
Sun et al. A novel cathelicidin from Bufo bufo gargarizans Cantor showed specific activity to its habitat bacteria
CN111690054B (en) Pinctada martensii Kunitz type serine protease inhibitor gene, encoded protein and application
CN110551732A (en) Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof
CN109797155A (en) Portunus trituberculatus Miers mannose binding lectin PtMBL gene and its coding albumen and application
CN107267519A (en) Hang razor clam C1q genes, encoding proteins and its cloning process and restructuring is hung razor clam C1q construction of genetic engineering methods
CN103789317A (en) Scylla paramamosain antibacterial peptide hyastatin gene clone, encoding protein recombination and application
CN108048475A (en) - 2 gene of razor clam I types of hanging lysozyme, encoding proteins and the construction method for recombinating -2 genetic engineering bacterium of razor clam I types lysozyme of hanging
CN104474557B (en) Application of Pacific oyster C-type lectin-2(CgCLec-2) recombinant protein with antibacterial activity
CN1936000A (en) Fennero penaeus chinensis antibacterial protein gene and recombinant expression and use
CN106749588A (en) A kind of imitative stichopus japonicus peptidoglycan recognition protein with bactericidal activity and its preparation method and application
CN108794613A (en) It is a kind of with the Hong Kong oyster LysM albumen and its encoding gene of bacteriostatic activity and application
CN104117059B (en) The application of Portunus trituberculatus Miers serine protease gene
CN111690636B (en) Trypsin-like serine protease gene, encoded protein and application
CN108251440A (en) Hang razor clam lysozyme gene, coding albumen and recombination hang razor clam lysozyme gene engineering bacteria construction method and application
CN105713907B (en) Stichopus japonicus ITGB gene, coding albumen and its cloning process and recombination stichopus japonicus ITGB construction of genetic engineering method
CN102229659A (en) Rana nigromaculata antibacterial peptide and gene and application thereof
CN101705231A (en) Apis cerana royal jelly antibacterial peptide AccRoyalisin gene and encoded polypeptide thereof and application thereof
CN102241756B (en) High expression of tenebrio molitor antibacterial peptide TmAMP3m in escherichia coli and application of TmAMP3m
CN104910266A (en) Amolops wuyiensis antibacterial peptide as well as encoding gene and application thereof
CN102051363A (en) Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same
CN101565462B (en) Large yellow croaker BPI-BN protein, primer and applications thereof in preparing antibiotic drugs
CN102816232A (en) Peanut 2s-4b protein and production method thereof
CN104910265A (en) Paa robertingeri cathelicidin antibacterial peptide cathelicidin-PR1 as well as gene of coding sequence and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant