CN103044542B - Serpin and gene thereof and application in crucian ovum - Google Patents
Serpin and gene thereof and application in crucian ovum Download PDFInfo
- Publication number
- CN103044542B CN103044542B CN201210296513.2A CN201210296513A CN103044542B CN 103044542 B CN103044542 B CN 103044542B CN 201210296513 A CN201210296513 A CN 201210296513A CN 103044542 B CN103044542 B CN 103044542B
- Authority
- CN
- China
- Prior art keywords
- serpin
- gel
- crucian
- add
- ovum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
To the present invention relates in crucian ovum serpin and gene thereof and application, belong to field of biomedicine technology.The present invention is by conventional biological chemistry means, from crucian ovum, separation and purification obtains serpin, molecular weight 42651.9Da, iso-electric point 5.61, crucian ovum serpin has the feature to the strong inhibit activities of serine protease, and not easily produce resistance, can be the medicinal application of the diseases such as preparation tumour, gastritis, pancreatitis, cancer.
Description
Technical field:
To the present invention relates in crucian ovum serpin and gene thereof and application, belong to field of biomedicine technology.
Background technology:
Serpin (serine protease inhibitor) general reference has the class material suppressing serine protease effect, is extensively present in animal, plant, microbe.In animal body, serpin is the important factor maintaining homoiostasis, once namely dysequilibrium causes various diseases, any factor affecting its activity also can cause serious pathological conditions.Their the most basic functions prevent unnecessary proteolysis, regulates the hydrolysising balance of serine protease.As modulator, serpin plays important role in the physiological activity of body, as activate proenzyme, releasing hormone precursor, participate in organism immune response, blood coagulation, complement is formationed, protein folding, cell migration, cytodifferentiation, cell matrix reconstruction, blood pressure regulation, tumor suppression and viral or that parasite is pathogenic formation etc.In view of the physiological function that it is important, the concern of serpin extremely investigator always, has been separated at present and has obtained multiple natural serpin, how it has been applied to the focus that the mankind have also become international research better simultaneously.Huge clinical treatment medicine preparation value is then contained in its research and development.
Human immune deficiency
virus(Human Immunodeficiency Virus, HIV), as the term suggests it can cause the defect of human immune system.1981, human immunodeficiency virus existed
the U.S.late Cambrian.It is a kind of infection human immune system
cellslow virus (Lentivirus), belong to
retrovirusone.So far without the fatal infectious disease complex of effective therapy.The immunological competence of this viral subversive human body, causes immunely losing resistibility, and cause various disease and
cancerbe able to survive in human body, develop into last, cause acquired immune deficiency syndrome (AIDS), prove from the experiment of Kohl in 1988 etc.: the indispensable enzyme that hiv protease is HIV and copies, can as since the target spot of anti-AIDS drugs, people have synthesized and have screened the compound that nearly hundred kinds have antiviral activity.By reducing the virus of HIV positive patient vivo carrying with the combination therapy of reverse transcriptase inhibitors; But, even if still there is very strong effect in single therapy.Hiv protease, at the specific cleavage of Phe-Pro, Phe-Leu, Phe-Thr, makes the design of inhibitor to possess highly variable.At present, there are 8 proteinoid enzyme inhibitorss for HIV therapy, comprise tipranavir, indinavir, Saquinavir, rltonavir.The inhibitor of a new generation is being developed to play maximum curative effect, treats sufferer.The s-generation proteinase inhibitor TMC-114 of current treatment HIV has entered during the clinical III stage tests.
According to domestic and foreign literature, serpin if aprotinin is except being widely used in the treatment of the disease such as gastritis, pancreatitis clinically, also in thoracic surgery for anti-fibrinolytic, suppress contact activation, anti-inflammatory etc.Serine protease analogue such as Kallikrein, tryptase in rheumatic arthritis and many inflammation (as rhinitis, conjunctivitis, asthma, gastro-enteritis, cardiovascular systems inflammation) play an important role in occurring.Clinical trial proves that its inhibitor is medicine effectively.On the other hand.Also effectively do not treat the medicine of herpesvirus infection at present clinically, discovered in recent years, suppress simplexvirus serine protease to be effective treatment means.
Crucian fish-egg is as a kind of abundant aquatic resources, and its Potential Comprehensive Utilization needs to be developed further, to improve its added value.Research shows, there is multiple protein enzyme inhibitors composition in fish-egg, in fish-egg except execution physiological regulation function, in causal organism defence, also serves vital role.But, only the proteinase inhibitor in minority fish-egg is studied up to now, and mostly concentrates on the research of cystatin.Therefore, research is carried out to it and seems very necessary, both can disclose the host defence mechanism of fish further, inquire into its physiology, defense function in fish-egg, can be again it and provide basic data in the application of food medicine and other fields.
Contriver falls serpin complete sequence amino acid structure in crucian ovum of the present invention and carries out search through protein data and compare, and finds no any phase homopolypeptide.Serpin encoding gene in crucian ovum of the present invention is carried out search through gene database and compares by contriver, does not find any homologous genes.
Summary of the invention:
The object of the invention is based on above-mentioned prior art basis, there is provided a kind of and there is strong serpin activity, there is crucian ovum serine stretch protein its gene of enzyme level of stronger growth of tumour cell inhibit activities and immunoregulatory activity and the application in pharmacy simultaneously.
For realizing object of the present invention, the invention provides following technical scheme:
Crucian ovum serpin
mature protein sequence:
Serine protease inhibitors in crucian carp eggs, its characteristics is isolated from crucian carp eggs have a ring of protease inhibitors, molecular weight < u TranNum = "101" > 42651.9 < / u > Da, isoelectric point 5. < u TranNum = "102" > 61 < / u >, enzyme activity, < u TranNum = "103" > serine protease inhibitors in crucian carp eggs mature sequence for < / u > :Glutamic acid - alanine - histidine - proline - serine - histidine - serine, glycine, glutamic acid, aspartic acid, alanine - cysteine - histidine - leucine leucine - serine - proline - histidine - asparagine - alanine - aspartate - phenylalanine - alanine - phenylalanine - serine - leucine - tyrosine - lysine - lysine, leucine - alanine - leucine - histidine - proline - aspartic acid, alanine - glutamine - glycine - lysine - asparagine - isoleucine - phenylalanine - phenylalanine - serine - proline - valine - glycine - isoleucine - serine - methionine - alanine - leucine - serine - methionine leucine - alanine - valine -Glycine and alanine - lysine - glycine, serine, threonine, leucine - serine - glutamine - isoleucine - tyrosine - serine - serine - leucine - glycine - tyrosine - serine - glycine - leucine, lysine - alanine - glutamine - glutamine - valine - asparagine - glutamic acid glycine - tyrosine - glutamate - histidine - leucine, isoleucine, histidine, methionine, leucine, glycine, histidine and serine - glutamine - aspartate - serine - methionine - glutamic acid leucine - glutamine - alanine - glycine and alanine - glycine - valine - alanine - isoleucine - arginine, glutamic acid, glycine - phenylalanine- lysine - valine - valine - aspartate - glutamine - phenylalanine - - valine, leucine, lysine, aspartic acid - glutamine - histidine - tyrosine - tyrosine - asparagine - serine - glutamate - alanine - phenylalanine - serine - valine - aspartate - phenylalanine - serine - lysine - proline - glutamate - isoleucine - alanine - alanine - glutamic acid, glutamate - isoleucine - asparagine - glutamine - phenylalanine - isoleucine - alanine - lysine - lysine, threonine - asparagine - aspartate - lysine - isoleucine - threonine - aspartate - methionine - valine - lysine - aspartic acid leucine - aspartate - serine - aspartate - methionine - - methionine - methionine - leucine, isoleucine, valine - asparagine - tyrosine - methionine - tyrosine - phenylalanine- arginine - glycine - lysine - the amino acid tryptophan - day - lysine - proline - phenylalanine - glutamate - alanine - glutamine, leucine - threonine - histidine - lysine - alanine - glutamate - phenylalanine acid - lysine - valine - day - the amino acid lysine - day - threonine - threonine, valine amino acid - glutamine - valine - day - methionine - methionine, lysine, arginine - threonine - glycine - arginine - the amino acid tyrosine - day - isoleucine - tyrosine - glutamine - day - proline - valine amino acid asparagine - glutamine - threonine - threonine, valine, methionine - methionine - valine - proline - tyrosine - lysine - glycine - asparagine - threonine - serine - methionine - methionine - isoleucine - valine, leucine, proline - day glycine, glutamic acid, glycine - lysine- methionine, lysine - day - valine amino - glutamate - glutamic acid serine - isoleucine - cysteine - arginine - histidine - histidine - leucine, lysine - asparagine - the amino acid tryptophan, histidine - day - lysine - leucine, phenylalanine - pure ammonia acid - serine - serine - alanine - aspartic acid leucine, phenylalanine - methionine - proline - lysine, phenylalanine, serine - isoleucine - serine - alanine, threonine, serine - lysine leucine - asparagine - aspartate - isoleucine, leucine - threonine - glutamate - methionine - glycine, valine - threonine - aspartate - alanine - phenylalanine - serine, aspartic acid- threonine - alanine - aspartate - phenylalanine - serine - glycine - methionine, threonine - glutamate - glutamic acid leucine, lysine - valine - lysine - valine serine - glutamine - valine - valine - histidine, lysine - alanine, valine, leucine - serine - valine - aspartic acid, glutamic acid, lysine - glycine - threonine - glutamate - alanine - alanine - alanine - alanine, threonine - threonine - isoleucine - glutamate - isoleucine - methionine - proline - methionine - serine - leucine, proline - glycine - threonine, valine, methionine, leucine, proline - asparagine - arginine - - phenylalanine - leucine, valine, leucine, isoleucine, valine, glutamic acid, aspartic acid, serine, threonine - lysine - serine - isoleucine, leucine - phenylalanine - methionine - glycine - lysine - isoleucine - threonine - asparagine - proline - threonine - valine.
The serpin gene clone of crucian ovum serpin comprises:
Crucian ovum serpin crucian ovum Total RNAs extraction, RNA concentration determination, RNA reverse transcription, design of primers and pcr amplification screening crucian ovum serpin, serpin gene 3 ' end and the 5 ' design of primers etc. of holding in RACE amplification crucian ovum.Amplimer length 23 Nucleotide, its sequence is 5 ' another amplimer of ATGTTCACCATGAAGAAATCCCT 3 ', PCR is CLONTECH company SMART
tM3 ' PCR Primer primer in cDNALibrary Construction Kit, its sequence is carried out gene nucleotide series mensuration by 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 ' obtains positive monoclonal.Gene sequencing result shows coding crucian ovum serpin gene nucleotide series, its feature: cDNA by
1230individual Nucleotide composition, it from 5 ' end to 3 ' terminal sequence is:
atggcctgggccgcgcctcacgaaggtcatgaccatgacggccacccagctgatcactaccaccatctccaccac 75
gggaaggacgaagcccaccccagccacagtggggaggatgcctgccatctgctttctccacacaacgctgacttt 150
gccttctccctctacaagaaacttgcgctccatcctgatgcccagggcaagaacattttcttctccccggtcggt 225
atctcaatggctttgagcatgctggctgtaggtgccaagggtagcactctatcacaaatatacagcagtctgggt 300
tacagcgggctgaaggctcagcaggtcaatgagggctatgagcacttgatccacatgcttggccacagtcaggac 375
agcatgcagctggaggcaggtgctggtgtggccatcagagaaggcttcaaagtggttgaccagttcctgaaggac 450
gttcagcactactacaacagcgaagccttcagcgttgacttctccaagcctgaaatcgctgcagaagagattaac 525
cagttcatcgccaagaaaaccaatgataaaataaccgacatggtgaaggacctggactctgatatggtgatgatg 600
ctgattaactatatgtacttcagagggaagtgggataagccatttgaagcacaactgactcacaaagctgagttc 675
aaagtggacaaggacaccaccgtgcaagttgacatgatgaaaagaaccggccgctatgacatctatcaagaccct 750
gtcaaccaaactacggtcatgatggtgccatacaaaggcaatacttccatgatgatcgttcttcctgatgaaggg 825
aagatgaaggatgttgaagaatccatctgcaggcaccatcttaagaactggcatgataaactcttcagaagctct 900
gtggacctgttcatgcccaagttctccatctctgcaacgtccaaactgaatgacattctgactgaaatgggagtg 975
actgatgcattcagtgacacagcagatttctctgggatgacagaagagctcaaagtgaaggtgtcacaggtcgtg 1050
cataaggcagtcctcagtgtggatgagaagggcacagaggcagcggccgcaaccacaatagagatcatgcccatg 1125
tccctgccaggcactgtgatgctcaaccgacctttcttggtactgattgtggaggacagcaccaagagcatcctc 1200
ttcatgggcaagattaccaatcctacagtg 1230
In coding crucian ovum, serpin mature sequence is
85-
1230position Nucleotide, in crucian ovum, serpin gene is as the application of serpin in preparation crucian ovum.
Accompanying drawing illustrates:
Fig. 1: in crucian ovum, CaSPI suppresses CaSPI and trypsin to combine than suppressing graphic representation;
Embodiment:
1, crucian ovum Total RNAs extraction:
Extract centrifuge tube used, rifle head, gun case etc. all to spend the night and autoclaving process through 0.1%DEPC water soaking, mortar used, glass homogenizer, tweezers and scissors are all through 180 DEG C of pyroprocessing 2.5h.
Concrete operation step is:
Get crucian ovum sample, about 100mg, adds liquid nitrogen grinding Cheng Fenshu, pours in glass homogenizer
↓ add the further ground sample of 1ml Trizol Reagent
Homogenised sample is transferred to 1.5mlEP and manages (DEPC pipe) 15-30 DEG C placement 5min
↓ add 200 μ l chloroforms, thermal agitation 3min, 4 DEG C, the centrifugal 15min of 12000 × g
Draw supernatant to new centrifuge tube add isopyknic Virahol with supernatant, room temperature leaves standstill 10min
↓ 4 DEG C, the centrifugal 10min of 12000 × g
Abandon supernatant and add 1ml 75% ethanol purge precipitation
↓ 4 DEG C, the centrifugal 10min of 7500 × g
Abandon supernatant, room temperature is placed dry, and add DEPC water 20-50 μ l and dissolve ,-70 DEG C save backup.
2, RNA concentration determination:
The total serum IgE getting the above-mentioned DEPC of the being dissolved in water of 1 μ l is placed in Nanodrop 2000c and measures RNA concentration.Be 1 μ g according to added RNA template consumption during surveyed RNA concentration adjustment reverse transcription.
3, RNA reverse transcription:
Prepare cDNA building-up reactions system according to following and carry out reverse transcription reaction.
Reaction conditions:
42℃1h
↓
70℃15min
After reaction terminates, reaction solution is stored in-20 DEG C and is used for pcr amplification.
4, design of primers and pcr amplification condition:
According to the carp of having announced in GenBanK, grass carp, homology species encodes district's conserved sequence and the N-terminal sequencing results such as zebra fish, utilize Premier 5.0 software design upstream and downstream primer.
Upstream primer: TGTAGGTGCCAAGGGTAG
Downstream primer: TGAACAGGTCCACAGAGC
Primer is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
With crucian ovum cDNA for template, carry out pcr amplification, PCR amplification system is as following table:
5, agarose gel electrophoresis:
According to isolation of DNA fragments size, prepare 1% sepharose with 1 × TAE, adding EB when heating and melting is cooled to about 50 DEG C in microwave oven to final concentration is 0.5 μ g/ml, fully pours on the glue plate of miniature electrophoresis chamber by gel after mixing, after cooled and solidified, gel is put into electrophoresis chamber.The sample getting appropriate amount mixes with 6 × electrophoresis sample-loading buffer, uses a certain size DNA Marker during loading.Electrophoretic buffer is 1 × TAE, and voltage is chosen as 120V, stops electrophoresis, observe under ultraviolet transilluminator when tetrabromophenol sulfonphthalein indicating strip moves to gel 2/3 position.
6, DNA gel purifying:
Use Shanghai raw work SanPrep pillar DNA glue to reclaim test kit and reclaim object fragment, concrete steps are as follows:
(1) agarose gel electrophoresis detects also rubber tapping recovery object bar rapidly and brings to 1.5ml centrifuge tube.
(2) the Buffer B2 of blob of viscose weight 3 times is added, 50 DEG C of water-bath 5-10min colloidal sols.
(3) move in adsorption column by sol solutions, the centrifugal 30s of 8000 × g, outwells liquid in collection tube.
(4) add 500 μ l Wash Solution, the centrifugal 30s of 9000 × g, outwells liquid in collection tube.
(5) repeating step (4) once.
(6) suction attached column is in the centrifugal 1min of 9000 × g.
(7) adsorption column is put into a clean 1.5ml centrifuge tube, add 15-40 μ l Elution Buffer in adsorption film central authorities, after room temperature leaves standstill 1min, centrifugal 1min.Preserve DNA solution in pipe for subsequent use in-20 DEG C.
7, ligation:
By following condition connect in 0.5ml centrifuge tube reaction system and 16 DEG C reaction 4h, connecting fluid be used for transform.10 μ l ligation systems are as follows:
8, the competence preparation of bacillus coli DH 5 alpha:
(1) get the E.coli BL21 bacterium liquid preserved in-80 DEG C of glycerine with the direct libation at an ancient wedding ceremony of aseptic platinum filament, in the line of LB planar surface, be inverted overnight incubation for 37 DEG C;
(2) from picking list bacterium colony LB flat board, be inoculated in 5ml LB liquid nutrient medium, 37 DEG C, 200rmp shakes overnight incubation;
(3) get the bacterium liquid of 100 μ l activated overnight, in access 5ml LB fresh culture, 200rpm 37 DEG C vibrate about 2.5h, to the visible muddiness slightly of naked eyes.
(4) nutrient solution is proceeded to 1.5ml centrifuge tube, ice bath 10min, 4 DEG C of centrifugal 10min of 4000rpm.
(5) abandon supernatant, collect thalline, add the 1.0ml 0.1M CaCl of precooling
2, gently hang, ice bath 10min, 4 DEG C of centrifugal 10min of 4000rpm.
(6) abandon supernatant, add 100 μ l 0.1M CaCl
2(precooling), gently hangs, and ice bath is at least available after 4h, if think long-term preservation, add sterile glycerol to final concentration 15%, in-70 DEG C of preservations.
9, product conversion is connected:
(1) full dose (10 μ l) is added in 100 μ l competent cells, places 30min in ice.
After (2) 42 DEG C of heating 45s, then place 1min in ice.
(3) 890 μ l LB liquid nutrient mediums are added, 37 DEG C of 200rpm shaking culture 60min.
(4) the centrifugal 1min of 4000rpm, abandons supernatant, stays bacterium liquid, and piping and druming suspends.
(5) be spread evenly across on the LB solid medium flat board containing X-Gal, IPTG, Amp and cultivate,
About 1h is placed in (6) 37 DEG C of incubator fronts, after bacterium liquid is absorbed by substratum completely, is inverted overnight incubation to forming the visible single bacterium colony of naked eyes for 37 DEG C.
(7) the some single colony inoculations of random choose to contain in corresponding antibiotic LB liquid nutrient medium 37 DEG C in 5ml, and 200rmp shaking table is cultivated 4-6h and is used for bacterium liquid PCR and identifies.
10, bacterium liquid PCR identifies:
With the bacterium liquid cultivated for template, carry out pcr amplification, reaction system is with step 2.5.Amplified production is identified through 1% agarose gel electrophoresis.The correct bacterium liquid of qualification is delivered to Shanghai Sani biotech firm and carries out DNA sequencing.
11, serpin gene 3 ' end and the 5 ' design of primers of holding in RACE amplification crucian ovum:
The specificity inner primer of 3 '-RACE and 5 '-RACE is designed for according to the part crucian ovum serpin gene order obtained:
5 ' inner primer: GGGTCTTGATAGATGTCATAGCG
3 ' inner primer: CTTCAGCGTTGACTTCTCCA
Primer is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Primer 3 ' race outer primer (5 '-taccgtcgttccactagtgattt-3 '), 3 ' race inner primer (5 '-cgcggatcctccactagtgatttcactatagg-3 '), 5 ' race outer primer (5 '-catggctacatgctgacagccta-3 '), 5 ' race inner primer (5 '-cgcggatccacagcctactgatgatcagtcgatg-3 ') come from TaKaRa 3 '-Full RACE Core Set Ver.2.0 and 5 '-Full RACE Kit respectively.
12、3’RACE：
Utilize TaKaRa 3 '-Full RACE Core Set Ver.2.0 can by known cDNA sequence, highly sensitive, to increase the full length sequence of 3 ' end of cDNA with high specificity.
Specific experiment working method is as follows:
(1) reverse transcription reaction.Reaction system and reaction conditions as follows:
Reaction conditions:
42℃1h
↓
70℃15min
For carrying out next step experiment after reaction terminates.
(2) sleeve type PCR reaction
1) OuterPCR reaction
The experimental implementation using TaKaRa LATaq to carry out when Outer PCR reacts is as follows:
2) after PCR reaction terminates, the PCR reaction solution getting 5 ~ 10 μ l carries out agarose gel electrophoresis, confirms pcr amplification product.And carry out Inner PCR reaction.
3) Inner PCR reacts.Reaction system and reaction conditions as follows:
(3) agarose gel electrophoresis
After reaction terminates, the PCR reaction solution getting 5 ~ 10 μ l carries out agarose gel electrophoresis, confirms 3 ' RACE pcr amplification product.
(4) sequencing analysis
DNA sequencing (specific experiment operation steps is identical with aforementioned 2.7-2.11) will be carried out again after the object product cloning of pcr amplification to pMD-18T carrier.
13、5’RACE：
Utilize 5 '-Full RACE Kit amplification 5 ' end DNA sequence dna.
(1) phosphatizing treatment.
Alkaline Phosphatase (CIAP) is used to carry out dephosphorization acid-respons to 5 ' phosphate group exposed in Total RNA.
1. by following component preparation dephosphorization acid-respons liquid.
2. 50 DEG C of reaction 1h.
3. in above-mentioned reaction solution, add the 3M CH of 20 μ l
3the RNase Free dH of COONa (pH5.2), 130 μ l
2after O, fully mix.
4. phenol/chloroform/the primary isoamyl alcohol (25: 24: 1) of 200 μ l is added, fully the centrifugal 5min of 13000 × g room temperature after mixing, by upper water phase transition in new Microtube.
5. the chloroform of 200 μ l is added, fully the centrifugal 5min of 13000 × g room temperature after mixing, by upper water phase transition in new Microtube.
6. Homogeneous phase mixing after the NA Carrier of 2 μ l is added.
7. the Virahol of 200 μ l is added, fully after mixing, cooled on ice 10min.
8. 13000 × g, 4 DEG C of centrifugal 20min, abandon supernatant.
9. 70% cold ethanol (the RNase Free dH of 500 μ l is added
2o prepares) rinsing, 13000 × g, 4 DEG C of centrifugal 5min are dry after abandoning supernatant.
10. the RNase Free dH of 7 μ l is added
2o dissolution precipitation, obtains CIAP-treated RNA.
(2) " remove cap " to react.
Use Tobacco Acid Pyrophosphatase (TAP) to remove the 5 ' cap sequence of mRNA, retain a phosphate group.
1. by following component preparation " removing cap " reaction solution.
2. 37 DEG C are reacted 1 hour.
3. this reaction solution is CIAP/TAP-treated RNA.Get 5 μ l for 5 ' RACE Adaptor ligation, remaining 5 μ l are stored in-80 DEG C.
The connection of (3) 5 ' RACEAdaptor.
1. first following solutions is prepared.
2. 65 DEG C of insulations placed 2 minutes on ice after 5 minutes, then added following reagent.
3. 16 DEG C of reaction 1h.
4. in above-mentioned reaction solution, add the 3M CH of 20 μ l
3the RNase Free dH of COONa (pH5.2), 140 μ l
2after O, fully mix.
5. phenol/chloroform/the primary isoamyl alcohol (25: 24: 1) of 200 μ l is added, fully the centrifugal 5min of 13000 × g room temperature after mixing, by upper water phase transition in new Microtube.
6. the chloroform of 200 μ l is added, fully the centrifugal 5min of 13000 × g room temperature after mixing, by upper water phase transition in new Microtube.
7. Homogeneous phase mixing after the NA Carrier of 2 μ l is added.
8. the Virahol of 200 μ l is added, fully after mixing, cooled on ice 10min.
9. 13000 × g, 4 DEG C of centrifugal 20min, abandon supernatant.Add 70% cold ethanol (the RNase Free dH of 500 μ l
2o prepares) rinsing, 13000 × g, 4 DEG C of centrifugal 5min are dry after abandoning supernatant.
10. the RNase Free dH of 6 μ l is added
2o dissolution precipitation, obtains Ligated RNA.
(4) reverse transcription reaction.
1. by following component preparation inverse transcription reaction liquid.
2. reverse transcription reaction condition is as follows:
30℃10min
↓
42℃1h
↓
70℃15min
3. reaction can carry out next step experiment after terminating.
(5) Outer PCR reacts.
(6) InnerPCR reaction
(7) agarose gel electrophoresis
After reaction terminates, the PCR reaction solution getting 5 ~ 10 μ l carries out agarose gel electrophoresis, confirms 3 ' RACE pcr amplification product.
(8) sequencing analysis
DNA sequencing (specific experiment operation steps is identical with aforementioned 2.7-2.11) will be carried out again after the object product cloning of pcr amplification to pMD-18T carrier.
14, serpin gene sequencing and result in crucian ovum:
Extract plasmid DNA dideoxy method and measure nucleotide sequence, use instrument is the full-automatic nucleotide sequencing instrument of Applied biosystems373A.
The result of genetic testing from 5 ' end to 3 ' terminal sequence is:
atggcctgggccgcgcctcacgaaggtcatgaccatgacggccacccagctgatcactaccaccatctccaccac 75
gggaaggacgaagcccaccccagccacagtggggaggatgcctgccatctgctttctccacacaacgctgacttt 150
gccttctccctctacaagaaacttgcgctccatcctgatgcccagggcaagaacattttcttctccccggtcggt 225
atctcaatggctttgagcatgctggctgtaggtgccaagggtagcactctatcacaaatatacagcagtctgggt 300
tacagcgggctgaaggctcagcaggtcaatgagggctatgagcacttgatccacatgcttggccacagtcaggac 375
agcatgcagctggaggcaggtgctggtgtggccatcagagaaggcttcaaagtggttgaccagttcctgaaggac 450
gttcagcactactacaacagcgaagccttcagcgttgacttctccaagcctgaaatcgctgcagaagagattaac 525
cagttcatcgccaagaaaaccaatgataaaataaccgacatggtgaaggacctggactctgatatggtgatgatg 600
ctgattaactatatgtacttcagagggaagtgggataagccatttgaagcacaactgactcacaaagctgagttc 675
aaagtggacaaggacaccaccgtgcaagttgacatgatgaaaagaaccggccgctatgacatctatcaagaccct 750
gtcaaccaaactacggtcatgatggtgccatacaaaggcaatacttccatgatgatcgttcttcctgatgaaggg 825
aagatgaaggatgttgaagaatccatctgcaggcaccatcttaagaactggcatgataaactcttcagaagctct 900
gtggacctgttcatgcccaagttctccatctctgcaacgtccaaactgaatgacattctgactgaaatgggagtg 975
actgatgcattcagtgacacagcagatttctctgggatgacagaagagctcaaagtgaaggtgtcacaggtcgtg 1050
cataaggcagtcctcagtgtggatgagaagggcacagaggcagcggccgcaaccacaatagagatcatgcccatg 1125
tccctgccaggcactgtgatgctcaaccgacctttcttggtactgattgtggaggacagcaccaagagcatcctc 1200
ttcatgggcaagattaccaatcctacagtg 1230
In crucian ovum, the sequence of serpin gene nucleotide shows as: sequence length is
1230 bases, sequence type: nucleic acid, chain number: strand, topology: straight-chain, sequence kind: cDNA, source: in crucian ovum coding crucian ovum, serpin mature sequence is
85-
1230position Nucleotide, in crucian ovum, serpin gene is as the application of serpin in preparation crucian ovum.
15, serpin separation and purification, molecular weight determination and Property Identification in fish-egg
1 material and reagent
1.1 experiment material
Test is collected in the creek market of farm produce, garden, Changshu City with crucian, totally 10, body weight 0.3 ~ 0.5kg, is all the female body of sexual maturity.
1.2 biochemical reagents
Sephadex G-50 gel, Sephadex G-75 gel, be Amersham Pharmacia Products; ConA sepharose 4B is affine, and filler steps science and technology purchased from Beijing China; XBP-C4 reversed-phase column is Venusil Products; High-pressure liquid phase acetonitrile and trifluoroacetic acid (chromatographic grade) are Merck Products; Trypsin trypsin) and chromophoric substrate L-Benzoyl-L-arginine-pNA (BApNA) (B-3133) all purchased from sigma company; BCA (bicinchoninic acid, bicinchoninic acid) test kit, SDS, glycine, mercaptoethanol, Xylene Brilliant Cyanine G G 250, acrylamide, methylene diacrylamide, tetrabromophenol sulfonphthalein, beta-mercaptoethanol are all purchased from Beijing Ding Guo biotech firm.Glyprotein stain test kit is purchased from the raw work in Shanghai.Albumen marker is purchased from green skies biotech company.Other reagent is analytical pure, purchased from Chemical Reagent Co., Ltd., Sinopharm Group, and all Pass Test requirements.
2 experimental techniques
Prepared by fish-egg homogenate crude extract
Prepared by fish-egg homogenate
Live body crucian clear water is cleaned, and takes out fish-egg, rinse blood stains well, add appropriate pure water with clear water from its intraperitoneal, grind to form homogenate with glass homogenizer, 10000g, 4 DEG C of centrifugal 30min, collect supernatant liquor, above step repeats 3 times, merges supernatant liquor, freezing for subsequent use.
Prepared by lyophilized powder
1 ~ 2ml fish-egg extracting solution is put into culture dish, and culture dish preservative film seals, and is placed in-80 DEG C of refrigerator and cooled and freezes more than 12h; Take out immediately after completely freezing and prick a little aperture on the preservative film of culture dish, putting into freeze drier rapidly, drying more than 24 hours in freeze drier; Observe effect, re-set target can not be reached and repeat step of freeze drying again.
Heat treated
With 0.1M hydrophosphate buffered soln PBS (pH 6.0), dissolved by lyophilized powder, 10000g, 4 DEG C of centrifugal 30min, get supernatant liquor and be placed in the centrifuge tube handled well, and 4 DEG C for subsequent use.
In view of to serpin contained in fish-egg, there is stronger thermostability before, therefore the supernatant liquor of collection is positioned over incubation 10min in 80 DEG C of water-baths, taking-up is cooled to room temperature, 10000g, 4 DEG C of centrifugal 25min, get supernatant liquor and be placed in the centrifuge tube handled well ,-20 DEG C frozen for subsequent use.
ConA Sepharose 4B affinity chromatography
(1) fill post: this media gel after taking out from 4 DEG C of refrigerators preferably at room temperature slowly jolting return to room temperature, then refill post, imitate in order to avoid produce aeration post.Get the chromatography column of a 1.6 × 25cm, vertically place, be fixed on iron stand.
(2) balance: binding buffer liquid (Binding Buffer) is 20mM Tris-HCl damping fluid, pH7.4, wherein containing 1mM MnCl
2, 1mM CaCl
2, 0.15MNaCl.Because medium conserving liquid contains 20% ethanol, the medium therefore installing post must balance.Liquid needed for balance media is about 10 column volumes.Due to lectin and glycosyl bonding strength weak, be promote glycosyl combine, can not 0.15MNaCl be contained in cleaning buffer solution.
(3) adsorb: processed fish-egg lyophilized powder lysate is carried out upper prop absorption after the dialysis of binding buffer liquid.
(4) clean: all entered after in medium until pre-separation component, add cleaning liquid, flow velocity is 0.15ml/min, washes away non-specific adsorption albumen, about 5-10 times column volume.
(5) wash-out: use 20mM Tris-HCl (pH 7.4) (containing 0.2M Alpha-Methyl-D-MANNOSE glycosides) to carry out wash-out, collect with automatic Fraction Collector, flow velocity is 1.5ml/10min, collection peak is made to the mensuration of trypsin inhibit activities, and the detection of SDS-PAGE protein electrophoresis is done to Peak Activity.
Gel permeation chromatography
Uncertain due to molecular weight, according to the existing gelatinous material of this experiment, chooses Sephadex G-50 and Sephadex G-75 carries out gel permeation chromatography respectively.
(1) gel swelling: be suspended in the distilled water of 5-10 times amount respectively by dry for Sephadex G-50 and Sephadex G-75 glue particle, be warming up to gradually by wet gel slurry in boiling water bath and closely boil, 1-2h, now gel particle is fully swelling.The cracking gel particle on upper strata is inclined to, swelling good gel particle is placed in vacuum drier gel air is pumped, and liquid too much above gel is inclined to.
(2) fill post: the chromatography column getting a 4.6 × 100cm, is vertically fixed on support, close lower end outlet.Xiang Zhuzhong adds pH 6.0 phosphate buffered saline buffer of 1/3 volume.Then limit is stirred, while by continuous for the coagulant liquid of grout shape impouring post, make its natural subsidence, after isogel sedimentation is about 2-3cm, open the outlet of post, regulate suitable flow velocity, gel is made to continue heavy collection, stopping filling post when the top risen to from post, the glue face of heavy collection is about 5cm place, when forming obvious separation surface in post, putting into the sizeable filter paper of one deck in gel top, connect constant flow pump, flow velocity is 0.3ml/min, when post compresses no longer further, keeps column top damping fluid 1-2cm high.
(3) column equilibration: flow through gel column with the elutriant being equivalent to column volume twice or more, with compacting gel before using.
The Peak Activity lyophilized powder upper step obtained is dissolved in 0.1M, pH6.0 phosphate buffered saline buffer, 10000g, centrifugal 10min, gets supernatant and is splined on the Sephadex gel-filtration column balanced, use same buffer solution elution, collect with automatic Fraction Collector, flow velocity is 2.8mL/10min.Make trypsin inhibit activities to collection peak to measure, and the detection of SDS-PAGE protein electrophoresis is done to Peak Activity.
Reverse phase HPLC (RP-HPLC)
(3) chromatographic elution conditions
Determined wavelength: 280nm; Flow velocity: 1ml/min; Column temperature: room temperature; Sample size: 20 μ l; Retention time: 25min.Dissolved by the Peak Activity that upper step obtains through Sephadex G-75 gel-filtration, 12000g, 25min, 4 DEG C centrifugal, gets supernatant liquor with 0.45 μm of membrane filtration, collects filtrate application of sample in high performance liquid phase C
4post, with water (containing 0.1% trifluoroacetic acid): the elution system that second fine (containing 0.1% trifluoroacetic acid) is formed carries out gradient elution, collects Peak Activity.Reversed-phase column is Venusil XBP-C
4, 4.6 × 250mm.
Serine stretch protein enzyme inhibition activity detects
At 50mM Tris-HCl buffered soln (containing 1mM CaCl
2), pH 7.8, reaction system in, measure in 25 DEG C testing samples to be hydrolyzed chromogenic substrate inhibitory effect to the trypsin of serine stretch protein enzyme family.The testing sample of difference amount and trypsin (final concentration is 30nM) are incubated 15min in 25 DEG C, add the substrate initial action that final concentration is 0.3mM.Chromophoric substrate is L-Benzoyl-L-arginine-pNA (BApNA) (Sigma), and total reaction system is 500 μ l.Continuous 2min is in the change of 410nm place monitoring photoabsorption
[2].Control group only adds proteolytic enzyme and does not add sample, to contrast vigor for 100%, and the following formulae discovery of residual enzyme percent viability:
Residual enzyme percent viability (%)=1-[(1-Ai/A0)] × 100%
Wherein Ai and A0 represents light absorption value when adding and do not add inhibitor respectively.
Determination of protein concentration
Determination of protein concentration method measures according to BCA determination of protein concentration test kit (Shanghai ancient cooking vessel state is biological), and concrete grammar is as follows:
(1) BCA working fluid is prepared: according to standard substance and sample size, by 50 volume reagent A, 1 volume reagent B dosage BCA working fluid, fully mixes.
(2) protein standard substance is pressed 0,1,2,4,6,8,10 microlitres are added in the protein standard sample wells of 96 orifice plates, adding the steaming water that goes out and supplying 10 microlitres; Get 10 microlitre testing samples and add 96 orifice plates.It is individual parallel that each mensuration will be 2-3.
(3) in band test sample sample wells and protein standard sample wells, add 200 microlitre BCA working fluids (namely the volume ratio of sample and working fluid is 1: 20) to mix.
(4) 37 DEG C of temperature bath 30min.Coldly be taken to room temperature.
(5) absorbancy is measured under microplate reader 562nm wavelength.
(6) production standard curve, obtains sample degree from typical curve.
The mensuration of serpin molecular weight
The preparation of SDS-PAGE protein electrophorese gel
SDS-PAGE electrophoresis is carried out, according to separation gel and the concentrated glue of table preparation different concns according to Laemmli method.Concrete operation step is as follows:
Table SDS-PAGE protein electrophorese gel (unit: ml)
Note: the APS of 1.10% uses front preparation
2., after adding 10%APS and TEMED mixing, immediately gel should be poured into electrophoresis chamber
(1) with distilled water by sheet glass wash clean, dry, and be fixed on electrophoresis chamber;
(2) according to experiment (target protein is about about 45kD) requirement, the separation gel of preparation 10%;
(3) separation gel solution is injected rapidly the interlayer of two sheet glass, reserve the concentrated glue requisite space of perfusion (tooth of comb is long adds 1cm again).Careful injection one deck water (about 2 ~ 3mm is high) on glue liquid surface, enters gelating soln to stop oxygen again;
(4) after separation gel polymerization completely (about 30min), inclines and covering water layer, and to exhaust residuary water with filter paper;
(5) the concentrated glue of 5% is prepared;
(6) on the separation gel of polymerization, directly perfusion concentrates glue, and inserts clean comb immediately.Must be careful, avoid producing bubble, room temperature places 30min glue polymerization to be concentrated;
(7) 40 μ l sample solutions are got and 10 μ l sample-loading buffers mix;
(8), after glue polymerization completely to be concentrated, gel is fixed on electrophoresis apparatus, in groove, adds 1 × Tris-glycine electrode buffer;
(9) carefully extract comb and repeatedly blow and beat flushing well with rifle head, discharging the bubble bottom gel between two sheet glass simultaneously as far as possible;
(10) application of sample in a predetermined order, every hole application of sample amount is 40 μ l (glue thickness is 1.0mm) (total protein concentration is about 25-50 μ g).Add albumen Marker simultaneously;
(11) electrophoresis apparatus is connected with power supply, after voltage 80V electrophoresis 20min, voltage is increased to 100V continuation electrophoresis and is about 100min, powered-down when tetrabromophenol sulfonphthalein arrives bottom gel, stop electrophoresis;
(12) unload lower glass plate from electrophoresis apparatus, pry open sheet glass with spatula.One jiao is cut to mark the orientation of gel near Far Left one hole (the first groove) gel bottom;
(13) gel is placed in Coomassie brilliant blue G250 staining fluid to soak, room temperature dyeing more than 4h on the decolorization swinging table of mild shake;
(14) reclaim dye liquor, change destainer decolouring 3-10h, change repeatedly destainer therebetween to clear background;
(15) gel is taken pictures.
Serpin estimating of molecular weight
Chinese Pharmacopoeia version in 2000 two annex VF SDS-PAGE electrophoretic method calculate determining molecular weight standard and monomeric protein molecular weight.Albumen Marker Specification Curve of Increasing is as follows:
Calculate relative mobility according to the following formula:
Relative mobility=
Obtain typical curve with the relative mobility mapping of the molecular weight logarithm of each protein standards to it, measure agnoprotein relative mobility, represent relative mobility R with x
f, y represents the logarithm of Mr, drawing standard curve.
The glyprotein stain of serpin
The glycoprotein gel staining reagent box adopting the raw work in Shanghai to buy carries out glyprotein stain, and specific experiment method is as follows:
(1) carry out 10%SDS-PAGE gel electrophoresis according to preceding method, after take out gel, add 20ml stationary liquid, decolorization swinging table fix 10min.
(2) incline and stationary liquid, shake washing blob of viscose twice with 20ml washings I, each 2min, then add 20ml oxidizing solution, concussion 20min.
(3) incline and oxidizing solution, add 20ml washings I and shake washing blob of viscose twice, each 2min.Again with 20ml deionized water concussion washing blob of viscose twice, each 2min.
(4) incline and deionized water, add 20ml reducing solution.Concussion 10min, inclines and reducing solution.And then shake detergent block twice with 20ml deionized water.Each 2min, then add 20ml cleaning solution II concussion wash twice, each 2min.
(5) incline and cleaning solution II, then add the Alcian blue staining fluid of one times of concentration, concussion dyeing 20min.
(6) incline and Alcian blue staining fluid, add 20ml cleaning solution II, concussion washing three times.Each required time is respectively 10; 20; 20min.
(7) incline and cleaning solution II, add the quick magnificent 20min of 20ml silver dye sensitizing solution concussion.
(8) incline and silver dye sensitizing solution, add 20ml cleaning solution II concussion cleaning 2 times.Each time is respectively 7min and 7min.
The glycoprotein gel staining reagent box adopting the raw work in Shanghai to buy carries out glyprotein stain, and specific experiment method is as follows:
(1) carry out 10%SDS-PAGE gel electrophoresis according to preceding method, after take out gel, add 20ml stationary liquid, decolorization swinging table fix 10min.
(2) incline and stationary liquid, shake washing blob of viscose twice with 20ml washings I, each 2min, then add 20ml oxidizing solution, concussion 20min.
(3) incline and oxidizing solution, add 20ml washings I and shake washing blob of viscose twice, each 2min.Again with 20ml deionized water concussion washing blob of viscose twice, each 2min.
(4) incline and deionized water, add 20ml reducing solution.Concussion 10min, inclines and reducing solution.And then shake detergent block twice with 20ml deionized water.Each 2min, then add 20ml cleaning solution II concussion wash twice, each 2min.
(5) incline and cleaning solution II, then add the Alcian blue staining fluid of one times of concentration, concussion dyeing 20min.
(6) incline and Alcian blue staining fluid, add 20ml cleaning solution II, concussion washing three times.Each required time is respectively 10; 20; 20min.
(7) incline and cleaning solution II, add the quick magnificent 20min of 20ml silver dye sensitizing solution concussion.
(8) incline and silver dye sensitizing solution, add 20ml cleaning solution II concussion cleaning 2 times.Each time is respectively 7min and 7min.
(9) incline and cleaning solution II, add 20ml deionized water concussion cleaning 2 times, each time is 3min.
(10) incline and deionized water, add 20ml silver dye staining fluid, concussion dyeing 15min.
(11) incline and silver dye staining fluid, add 20ml deionized water concussion cleaning 4 times, each time is 1min.
(12) 40ml silver dye colour developing liquid storage I and 14 μ l silver dye colour developing liquid storage II is got, mixing, obtained silver dye nitrite ion, for subsequent use.
(13) incline and deionized water, add 20ml silver dye nitrite ion, concussion develops the color 30s in advance.
(14) incline the silver dye nitrite ion muddiness, adds 20ml fresh silver dye nitrite ion, shake the 3min that dyes, manifest to target protein band.
Serpin is combined with trypsin
Detection method with reference to people such as Christensen determines the suppression type of CaSPI.The CaSPI albumen (30nM) of a certain amount of purifying and the trypsin (0-30nM) of different amount are in 25 DEG C of 0.05M Tris-HCl, be incubated 15min in pH 7.8 (containing 0.1M NaCl) damping fluid, add 5 × reduction electrophoretic buffer termination reaction and boil 5min.Under 10%SDS-PAGE reduced state, electrophoretic analysis is carried out to the mixture that CaSPI and trypsin is formed.
Serpin N-terminal sequence measures
The preparation of SDS-PAGE protein electrophorese gel
Gel preparation and encapsulating is carried out according to aforementioned glue method.The gel thicknesses 1.5mm of configuration.After glue polymerization completely to be concentrated, gel is fixed on electrophoresis apparatus; Carefully extract comb and repeatedly blow and beat flushing well with rifle head, discharging the bubble bottom gel between two sheet glass simultaneously as far as possible; In groove, add 1 × electrode buffer, constant voltage 50V carries out prerunning, empty race 2h.
Get 60 μ l sample solutions and 15 μ l sample-loading buffers mix, get 8 parts according to same volume, boiling water bath heat denatured.The sample handled well carries out loading, and every hole application of sample amount is 60 μ l (glue thickness is 1.5mm).
Connected with power supply by electrophoresis apparatus, after voltage 80V electrophoresis 30min, voltage is increased to 120V continuation electrophoresis and is about 90min, bottom tetrabromophenol sulfonphthalein distance gel, powered-down during 0.5cm, stops electrophoresis;
PVDF transferring film
Get a pvdf membrane, wear gloves and filter paper and pvdf membrane are cut according to size, the pvdf membrane of well cutting is placed in methanol solution, soak the several seconds, then put into CAPS electroblotting damping fluid.
After SDS-PAGE electrophoresis terminates, pry open sheet glass, concentrated glue is scraped off gently, avoid separation gel to scratch, carefully peel separation gel, in CAPS damping fluid, soak 8min.
The filter paper and sponge that are used for electroblotting experiment are put into electroblotting damping fluid to be soaked; then by the order of sponge, filter paper, pvdf membrane, gel, filter paper, sponge, electroblotting interlayer is installed; and put into small electrical turn trough; in 300mA constant current situation, carry out electroblotting transfer in low temperature, transfer time is 2h.
Transfer terminates rear taking-up pvdf membrane, slightly cleans with deionized water, and methyl alcohol soaks the several seconds, be placed in 0.1%Coomassie R-250 dyeing 50s, with 50% methyl alcohol decolouring (noticing that duty changes destainer), and fully wash with deionized water, then can cut band to be checked order.Treat that order-checking band is delivered to school of life and health sciences order-checking portion of Peking University and carried out protein N terminal sequence mensuration by what cut.
16, the detection of CaSPI anti-microbial activity and minimal inhibitory concentration are determined:
Test strain: intestinal bacteria Escherichia coli, subtilis Bacillus dysenteriae.
Every milliliter containing 10
6the bacterium liquid of bacterium or spore is spread evenly across solid bacteria media surface, the filter paper of the 0.5cm diameter through sterilizing is placed in media surface, drip certain density testing sample solution, 18-20h is cultivated in 37 DEG C, observe inhibition zone whether to be formed, what have inhibition zone to be formed shows there is anti-microbial activity, carries out the mensuration of minimal inhibitory concentration further.
When measuring minimal inhibitory concentration, doubling dilution is adopted to carry out antibacterial detection.Using Luria-Bertani (LB) liquid nutrient medium as developing medium.Reference culture, after the recovery of LB solid medium, becomes every milliliter containing 10 with sterilized water dilution bacterium colony
6the bacterium liquid of bacterium or spore, is inoculated in LB liquid nutrient medium by bacterium liquid, and bacterium ultimate density is 10
5.
Add in 1.9mL substratum and manage as first through the sample 0.1mL being dissolved in the amphibian animal skin extract of physiological saline of 0.22 μm of aperture membrane filtration, get 1mL after mixing and add the 2nd pipe, doubling dilution successively, discards from the 9th pipe sucking-off 1mL, 10th piping control tube, as table:
The bacterium liquid (10 corrected will be added in each pipe
5cfu/mL) 0.05mL, places 37 DEG C and cultivates 18h, measure photoabsorption in 600nm wavelength place after mixing.Minimal inhibitory concentration is cannot see the minimum sample concentration of bacterial growth.Sample protein concentration adopts following formula to calculate: Protein concentration (mg/mL)=(A
215 nm-A
225nm) × 0.144.
Antibacterial detected result shows, in crucian ovum, purifying obtains serpin CaSPI and all has anti-microbial activity to test strain, and CaSPI is obviously better than subtilis to colibacillary suppression.
In crucian ovum, the minimal inhibitory concentration result of the serpin CaSPI that purifying obtains as shown in Table 5-1.
Proteinase inhibitor C aSPI minimal inhibitory concentration in table 5-1 crucian ovum
Claims (3)
1. serpin in crucian ovum, it is characterized in that in this crucian ovum, serpin is separated a kind of cyclic protein enzyme inhibitors obtained from crucian ovum, molecular weight 42651.9Da, iso-electric point is pH 5.61 ± 0.02, and in crucian ovum, serpin matter total order is classified as SEQ NO:1.
2. crucian ovum serpin gene, it is characterized in that nucleotide sequence cDNA is made up of 1230 Nucleotide, its sequence is SEQ NO:2.
3. crucian ovum serpin described in claim 1 is preparing antibacterial medicines application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210296513.2A CN103044542B (en) | 2012-08-17 | 2012-08-17 | Serpin and gene thereof and application in crucian ovum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210296513.2A CN103044542B (en) | 2012-08-17 | 2012-08-17 | Serpin and gene thereof and application in crucian ovum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103044542A CN103044542A (en) | 2013-04-17 |
| CN103044542B true CN103044542B (en) | 2015-08-19 |
Family
ID=48057424
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210296513.2A Expired - Fee Related CN103044542B (en) | 2012-08-17 | 2012-08-17 | Serpin and gene thereof and application in crucian ovum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103044542B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3051449A1 (en) * | 2015-01-29 | 2016-08-03 | Bayer Technology Services GmbH | Computer-implemented method for creating a fermentation model |
| CN109942701A (en) * | 2019-04-18 | 2019-06-28 | 常熟理工学院 | A kind of isolation and purification method of Chinese ring-necked pheasant egg white serpin |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102372777A (en) * | 2011-11-01 | 2012-03-14 | 特菲(天津)生物医药科技有限公司 | Method for purifying natural serine protease inhibitors |
| CN102574909A (en) * | 2009-05-05 | 2012-07-11 | 自然环境研究会 | Method of modifying serine protease inhibitors |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2004225718B2 (en) * | 2003-04-04 | 2009-11-05 | Universite De Lausanne | Inhibitor proteins of a protease and use thereof |
-
2012
- 2012-08-17 CN CN201210296513.2A patent/CN103044542B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102574909A (en) * | 2009-05-05 | 2012-07-11 | 自然环境研究会 | Method of modifying serine protease inhibitors |
| CN102372777A (en) * | 2011-11-01 | 2012-03-14 | 特菲(天津)生物医药科技有限公司 | Method for purifying natural serine protease inhibitors |
Non-Patent Citations (2)
| Title |
|---|
| Q90323;Chang-Jen Huang et al;《Uniprot》;19961101;第2页序列部分 * |
| 四种常见鱼卵对丝氨酸蛋白酶抑制活性的比较;郭强等;《水产科学》;20120131;第31卷(第1期);第41页左栏第1段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103044542A (en) | 2013-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103102407B (en) | Genetic recombinant human-like collagen | |
| JPH04502143A (en) | Autocrine motility factors in cancer diagnosis and management | |
| CN102379838B (en) | Method for preparing relaxing and face-cleansing cosmetics and application | |
| CN106279429A (en) | The stroma cell derivative factor being combined with collagen specificity and application thereof | |
| CN106279439A (en) | A kind of oligopeptide 1 fusion protein containing cell-penetrating peptide and preparation method thereof | |
| CN107344959A (en) | One kind promotees skin repair ultrashort peptide Purin WH, its preparation method and application | |
| CN103044542B (en) | Serpin and gene thereof and application in crucian ovum | |
| CN108484747A (en) | Japan frog skin repair peptide cathelicidin-NV and its gene and application | |
| CN103656630A (en) | Method for purifying plasmin in animal medicine and preparing traditional Chinese medicine composition | |
| CN101434651A (en) | Recombinant thymosin beta 4 two repeat protein and preparation thereof | |
| CN100334108C (en) | Recombinant akabane virus capsid protein, its preparation method and uses | |
| CN108822196A (en) | A kind of rush blood coagulation polypeptide LGTX-F2 and its application | |
| CN104159599B (en) | Peptide bifonctionnel | |
| JP6383721B2 (en) | Wound healing agent | |
| CN101838324A (en) | Novel process for preparing transfer factors | |
| CN109722421B (en) | Adipocyte endogenous polypeptide and application thereof | |
| CN105597150A (en) | Skin patch for repairing skin burn and preparing method of skin patch | |
| CN106749498A (en) | A kind of CORNU CERVI disk antibacterial peptide/albumen and its application with antibacterial effect | |
| CN101870974A (en) | Preparation method of proteinase activated receptors agonist and use thereof | |
| CN108160043A (en) | A kind of preparation method of antibiont support type collagen fiber adsorption material | |
| CN101671684A (en) | Phytophthora capsici pectin methylesterase Pcpme l gene as well as preparation method of protein and application thereof | |
| CN107987147A (en) | A kind of MG53 polymers preparation method and its usage | |
| CN104447977A (en) | Purification production method for recombinant human bone morphogenetic protein-2 | |
| CN111471715A (en) | Adenovirus vector and construction method and application thereof | |
| CN102887949B (en) | Recombinant human prion protein (hPrP), and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150819 Termination date: 20190817 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |