CN103044542A - Serine protease inhibitor in crucian egg as well as gene and application thereof - Google Patents

Abstract

The invention relates to a serine protease inhibitor in crucian eggs as well as a gene and an application thereof and belongs to the technical field of biomedicines. The serine protease inhibitor is obtained by separating and purifying in the crucian eggs with a conventional biochemistry means, the molecular weight of the serine protease inhibitor is 42651.9Da and the isoelectric point is 5.61. The serine protease inhibitor of the crucian eggs has the characteristics of strong inhibitory activity to serine protease, and has less possibility of producing drug tolerance, so that the serine protease inhibitor can be applied to preparing medicaments of diseases such as tumor, gastritis, pancreatitis and cancers.

Description

Serpin and gene thereof and application in the crucian ovum

Technical field:

The present invention relates to serpin and gene and application in the crucian ovum, belong to field of biomedicine technology.

Background technology:

Serpin (serine protease inhibitor) general reference has a class material that suppresses the serine protease effect, extensively is present in animal, plant, microbe.In animal body, serpin is the important factor that maintains homoiostasis, once dysequilibrium causes various diseases, any its active factor that affects also can cause serious pathological conditions.Their the most basic functions are to prevent unnecessary proteolysis, regulate the hydrolysising balance of serine protease.As modulator, serpin is being played the part of important role in the physiological activity of body, as the precursor that activates proenzyme, releasing hormone, participate in organism immune response, blood coagulation, complement formation, protein folding, cell migration, cytodifferentiation, cell matrix reconstruction, blood pressure regulation, tumor suppression and virus or the pathogenic formation of parasite etc.In view of its important physiological function, serpin is extremely investigator's concern always, has separated at present and has obtained multiple natural serpin, and how it being applied to the mankind has better also become the focus of international research simultaneously.Its research and development are being contained huge clinical treatment medicine preparation and are being worth.

Human immune deficiency virus(Human Immunodeficiency Virus, HIV), as the term suggests it can cause the defect of human immunity system.1981, human immunodeficiency virus existed the U.S.find first.It is a kind of infection human immunity system cellslow virus (Lentivirus), belong to retrovirusa kind of.So far without the effective mortality transmissible disease of therapy.This virus is destroyed the immunological competence of human body, causes the immune resistibility that loses, and causes various diseases to reach cancerbe able to survive in human body, develop into finally, cause acquired immune deficiency syndrome (AIDS), from experimental results show that of Kohl in 1988 etc.: hiv protease is the indispensable enzyme that HIV infects and copies, since can be used as the target spot of anti-AIDS drugs, people are synthetic and screen nearly hundred kinds of compounds that antiviral activity is arranged.Reduce the virus of HIV positive patient vivo carrying by the combination therapy with reverse transcriptase inhibitors; Yet, even still there is very strong effect in single therapy.Hiv protease is at Phe-Pro, Phe-Leu, and the specificity of Phe-Thr is sheared, and makes the design of inhibitor must possess highly variable.At present, there are 8 proteinoid enzyme inhibitorss to treat for HIV, comprise tipranavir, indinavir, Saquinavir, rltonavir.The inhibitor of a new generation is being developed to bring into play maximum curative effect, treats sufferer.At present the s-generation proteinase inhibitor TMC-114 for the treatment of HIV has entered during the clinical III stage tests.

According to domestic and foreign literature, serpin as aprotinin except the treatment that is widely used in clinically the diseases such as gastritis, pancreatitis, also in thoracic surgery for anti-fibrinolytic, suppress contact activation, anti-inflammatory etc.The serine protease analogue is as Kallikrein, and tryptase (as rhinitis, conjunctivitis, asthma, gastro-enteritis, cardiovascular systems inflammation) in rheumatic arthritis and many inflammation plays an important role in occurring.Clinical trial proves that its inhibitor is medicine effectively.On the other hand.At present also effectively do not treat clinically the medicine of herpesvirus infection, discovered in recent years, suppressing the simplexvirus serine protease is effective treatment means.

The crucian fish-egg is as a kind of abundant aquatic resources, and its Potential Comprehensive Utilization remains further to be developed, to improve its added value.Research shows, has multiple protein enzyme inhibitors composition in fish-egg, in fish-egg, except carrying out physiological regulation function, in the causal organism defence, has also played vital role.Yet, only the proteinase inhibitor in the minority fish-egg is studied till up to now, and mostly concentrates on the research of cystatin.Therefore, it is studied and seems very necessary, both can further disclose the host defence mechanism of fish, inquire into its physiology, defense function in fish-egg, can be again its application in the food medicine and other fields basic data is provided.

The contriver falls serpin complete sequence amino acid structure in crucian ovum of the present invention and searches relatively through protein data, finds no any phase homopolypeptide.The contriver searches serpin encoding gene in crucian ovum of the present invention relatively through gene database, does not find any homologous genes.

Summary of the invention:

The objective of the invention is based on above-mentioned prior art basis, a kind of strong serpin activity that has is provided, there is stronger growth of tumour cell inhibition crucian ovum serine protease active and immunoregulatory activity simultaneously and suppress its gene and the application in pharmacy.

For realizing purpose of the present invention, the invention provides following technical scheme:

Crucian ovum serpin mature protein sequence:

Egg fish serine proteinase inhibitor , wherein a cyclic protease inhibitor isolated from the eggs of the fish , the molecular weight <u TranNum="85"> 42651.9 </ u> Da, an isoelectric point of 5. <U TranNum = "86"> 61 </ u>, non-enzymatic , <u TranNum="87"> fish eggs mature sequence of the serine protease inhibitor </ u>: Glu - Ala - histidine - proline - serine - histidine - Ser - Gly - Glu - Asp - Ala - cysteine - histidine - leucine - leucine - serine - proline - histidine - asparagine - Ala - Asp - Phe - Ala - Phe - Ser - Leu - Tyr - Lys - Lys - leucine - Ala - Leu - histidine - Pro - Asp - Ala - Gln - Gly - Lys - asparagine - isoleucine - phenylpropionate acid - phenylalanine - Ser - Pro - Val - Gly - isoleucine - Ser - Met - Ala - Leu - Ser - methionine - leucine - Ala - Val - Gly - Ala - Lys - Gly - Ser - Thr - Leu - Ser - glutamine - isoleucine - Tyr - Ser - Ser - leucine - glycine - Tyr - Ser - Gly - Leu - Lys - Ala - Gln - glutamine - valine - asparagine - glutamic acid - glycine - tyrosine acid - glutamic acid - histidine - leucine - isoleucine - histidine - methionine - leucine - glycine - histidine - serine - glutamine - Asp - Ser - methionine - glutamine - leucine - glutamic acid - Ala - Gly - Ala - Gly - Val - Ala - isoleucine - arginine - glutamic acid - glycine - phenylalanine acids - lysine - Val - Val - Asp - Gln - Phe - Leu - Lys - Asp - Val - Gln - group acid - tyrosine - tyrosine - asparagine - Ser - Glu - Ala - Phe - Ser - Val - Asp - Phe - Ser - lysyl acid - proline - glutamic acid - isoleucine - Ala - Ala - Glu - Glu - isoleucine - asparagine - glutamine - phenylalanine - exclusive leucine - Ala - Lys - Lys - Thr - asparagine - aspartic acid - lysine - isoleucine - threonine - aspartic acid - methionine - Valerian acid - lysine - Asp - Leu - Asp - Ser - aspartic acid - methionine - valine - methionine - methionine - leucine - isoleucine - asparagine - Tyr - Met - Tyr - Phe - Arg - Gly - Lys - tryptophan - days acid - Lys - Pro - Phe - Glu - Ala - Gln - Leu - Thr - histidine - Lys - Ala - Glu - Phe - Lys - Val - days acid - lysine - days acid - Thr - Thr - Val - Gln - Val - days acid - methionine - methionine - lysine - fine acid - Thr - Gly - Arg - tyrosine - day leucine - isoleucine - tyrosine - glutamine - days acid - proline - valine - asparagine - glutamine - Thr - Thr - valine - methionine - methionine - Val - Pro - Tyr - Lys - Gly - asparagine - threonine acid - serine - methionine - methionine - isoleucine - valine - leucine - proline - days acid - glutamic acid - glycine - lysine - methionine - lysine - days acid - Val - Glu - Glu - Ser - isoleucine - cysteine - arginine - histidine - histidine - leucine - lysyl acid - asparagine - tryptophan - histidine - days acid - Lys - Leu - Phe - arginine - Ser - Ser - Ala - Asp - bright acid - phenylalanine - methionine - Pro - Lys - Phe - Ser - isoleucine - Ser - Ala - Thr - Ser - Lys - bright acid - asparagine - aspartic acid - isoleucine - leucine - threonine - glutamic acid - methionine - Gly - Val - Thr - Asp - propionic acid - phenylalanine - Ser - Asp - Thr - Ala - Asp - Phe - Ser - Gly - methionine - Thr - Glu - glutamic acid - leucine - lysine - Val - Lys - Val - Ser - Gln - Val - Val - histidine - Lys - Ala - valine - leucine - Ser - Val - Asp - Glu - Lys - Gly - Thr - Glu - Ala - Ala - Ala - propionic acid - threonine - threonine - isoleucine - glutamic acid - isoleucine - methionine - proline - methionine - Ser - leucine - proline - glycine - Thr - valine - methionine - leucine - asparagine - Arg - Pro - Phe - Leu - valine - leucine - isoleucine acids - valine - Glu - Asp - Ser - Thr - Lys - Ser - isoleucine - Leu - Phe - Met - Gly - lysyl acids - isoleucine - threonine - asparagine - Pro - Thr - valine.

The serpin gene clone of crucian ovum serpin comprises:

The total RNA of crucian ovum serpin crucian ovum extracts, the RNA concentration determination, the RNA reverse transcription, design of primers and pcr amplification screening crucian ovum serpin, serpin gene 3 ' end and the 5 ' design of primers of holding etc. in RACE amplification crucian ovum.23 Nucleotide of amplimer length, its sequence is 5 ' ATGTTCACCATGAAGAAATCCCT 3 ', another amplimer of PCR is the SMART of CLONTECH company ^tM3 ' PCR Primer primer in cDNALibrary Construction Kit, its sequence is obtained positive monoclonal by 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 ' and is carried out gene nucleotide series mensuration.The gene sequencing result crucian ovum serpin gene nucleotide series that shows to encode, its feature: cDNA by 1230individual Nucleotide forms, and it from 5 ' end to 3 ' terminal sequence is:

atggcctgggccgcgcctcacgaaggtcatgaccatgacggccacccagctgatcactaccaccatctccaccac 75

gggaaggacgaagcccaccccagccacagtggggaggatgcctgccatctgctttctccacacaacgctgacttt 150

gccttctccctctacaagaaacttgcgctccatcctgatgcccagggcaagaacattttcttctccccggtcggt 225

atctcaatggctttgagcatgctggctgtaggtgccaagggtagcactctatcacaaatatacagcagtctgggt 300

tacagcgggctgaaggctcagcaggtcaatgagggctatgagcacttgatccacatgcttggccacagtcaggac 375

agcatgcagctggaggcaggtgctggtgtggccatcagagaaggcttcaaagtggttgaccagttcctgaaggac 450

gttcagcactactacaacagcgaagccttcagcgttgacttctccaagcctgaaatcgctgcagaagagattaac 525

cagttcatcgccaagaaaaccaatgataaaataaccgacatggtgaaggacctggactctgatatggtgatgatg 600

ctgattaactatatgtacttcagagggaagtgggataagccatttgaagcacaactgactcacaaagctgagttc 675

aaagtggacaaggacaccaccgtgcaagttgacatgatgaaaagaaccggccgctatgacatctatcaagaccct 750

gtcaaccaaactacggtcatgatggtgccatacaaaggcaatacttccatgatgatcgttcttcctgatgaaggg 825

aagatgaaggatgttgaagaatccatctgcaggcaccatcttaagaactggcatgataaactcttcagaagctct 900

gtggacctgttcatgcccaagttctccatctctgcaacgtccaaactgaatgacattctgactgaaatgggagtg 975

actgatgcattcagtgacacagcagatttctctgggatgacagaagagctcaaagtgaaggtgtcacaggtcgtg 1050

cataaggcagtcctcagtgtggatgagaagggcacagaggcagcggccgcaaccacaatagagatcatgcccatg 1125

tccctgccaggcactgtgatgctcaaccgacctttcttggtactgattgtggaggacagcaccaagagcatcctc 1200

ttcatgggcaagattaccaatcctacagtg 1230

In coding crucian ovum, the serpin mature sequence is 85- 1230position Nucleotide, in the crucian ovum, the serpin gene is as the application of serpin in preparation crucian ovum.

The accompanying drawing explanation:

Fig. 1: in the crucian ovum, CaSPI inhibition CaSPI is combined with trypsin than suppressing graphic representation;

Embodiment:

1, the total RNA of crucian ovum extracts:

Extract centrifuge tube used, rifle head, gun case etc. and all spend the night and the autoclaving processing through the 0.1%DEPC water soaking, mortar used, glass homogenizer, tweezers and scissors are all through 180 ℃ of pyroprocessing 2.5h.

Concrete operation step is:

Get crucian ovum sample, about 100mg, add liquid nitrogen grinding Cheng Fenshu, pours in glass homogenizer

↓ add the further ground sample of 1ml Trizol Reagent

The homogenate sample is transferred to 15-30 ℃ of 1.5mlEP pipe (DEPC pipe) and places 5min

↓ add 200 μ l chloroforms, thermal agitation 3min, 4 ℃, the centrifugal 15min of 12000 * g

Draw supernatant to new centrifuge tube and add and the isopyknic Virahol of supernatant the standing 10min of room temperature

↓ 4 ℃, the centrifugal 10min of 12000 * g

Abandon supernatant and add the ethanol washing and precipitating of 1ml 75%

↓ 4 ℃, the centrifugal 10min of 7500 * g

Abandon supernatant, room temperature is placed dry, adds DEPC water 20-50 μ l and dissolves, and-70 ℃ save backup.

2, RNA concentration determination:

The total RNA that gets the above-mentioned DEPC of the being dissolved in water of 1 μ l is placed in Nanodrop 2000c and measures RNA concentration.Adding RNA template consumption while according to surveyed RNA concentration, adjusting reverse transcription is 1 μ g.

3, RNA reverse transcription:

According to following preparation cDNA building-up reactions system and carry out reverse transcription reaction.

Reaction conditions:

42℃1h

↓

70℃15min

Reaction is stored in reaction solution-20 ℃ for pcr amplification after finishing.

4, design of primers and pcr amplification condition:

According to the carp of having announced in GenBanK, grass carp, homology species coding region conserved sequence and the N-terminal sequencing results such as zebra fish, utilize Premier 5.0 software design upstream and downstream primers.

Upstream primer: TGTAGGTGCCAAGGGTAG

Downstream primer: TGAACAGGTCCACAGAGC

Primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

The crucian ovum cDNA of take is template, carries out pcr amplification, and the pcr amplification system is as following table:

5, agarose gel electrophoresis:

According to the DNA isolation clip size, prepare 1% sepharose with 1 * TAE, when in microwave oven, heating and melting is cooled to 50 ℃ of left and right, add EB to final concentration be 0.5 μ g/ml, after fully mixing, gel is poured on the glue plate of miniature electrophoresis chamber, after cooled and solidified, gel is put into to electrophoresis chamber.The sample of getting appropriate amount mixes with 6 * electrophoresis sample-loading buffer, uses a certain size DNA Marker during loading.Electrophoretic buffer is 1 * TAE, and voltage is chosen as 120V, stops electrophoresis when the tetrabromophenol sulfonphthalein indicating strip moves to gel 2/3 position, under ultraviolet transilluminator, observes.

6, DNA gel purifying:

Use Shanghai to give birth to work SanPrep pillar DNA glue and reclaim test kit recovery purpose fragment, concrete steps are as follows:

(1) agarose gel electrophoresis detects also rubber tapping recovery purpose bar rapidly and brings to the 1.5ml centrifuge tube.

(2) add the Buffer B2 of 3 times of blob of viscose weight, 50 ℃ of water-bath 5-10min colloidal sols.

(3) sol solutions is moved in adsorption column, the centrifugal 30s of 8000 * g, outwell liquid in collection tube.

(4) add 500 μ l Wash Solution, the centrifugal 30s of 9000 * g, outwell liquid in collection tube.

(5) repeating step (4) once.

(6) the suction attached column is in the centrifugal 1min of 9000 * g.

(7) adsorption column is put into to a clean 1.5ml centrifuge tube, in adsorption film central authorities, added 15-40 μ l Elution Buffer, after the standing 1min of room temperature, centrifugal 1min.In the preservation pipe, DNA solution is standby in-20 ℃.

7, ligation:

The reaction system that connects in the 0.5ml centrifuge tube by following condition 16 ℃ of reaction 4h, connecting fluid is for transforming.10 μ l ligation systems are as follows:

8, the competence of bacillus coli DH 5 alpha preparation:

(1) get with the direct libation at an ancient wedding ceremony of aseptic platinum filament the E.coli BL21 bacterium liquid of preserving in-80 ℃ of glycerine, in the line of LB planar surface, be inverted overnight incubation for 37 ℃;

(2) picking list bacterium colony from the LB flat board, be inoculated in 5ml LB liquid nutrient medium, and 37 ℃, 200rmp shakes overnight incubation;

(3) get the bacterium liquid that 100 μ l spend the night and activate, in access 5ml LB fresh culture, 37 ℃ of vibration 2.5h left and right of 200rpm, visible slight muddy to naked eyes.

(4) nutrient solution is proceeded to the 1.5ml centrifuge tube, ice bath 10min, 4 ℃ of centrifugal 10min of 4000rpm.

(5) abandon supernatant, collect thalline, add the 1.0ml 0.1M CaCl of precooling ₂, light outstanding, ice bath 10min, 4 ℃ of centrifugal 10min of 4000rpm.

(6) abandon supernatant, add 100 μ l 0.1M CaCl ₂(precooling), light outstanding, ice bath is at least available after 4h, if think prolonged preservation, adds sterile glycerol to final concentration 15%, in-70 ℃ of preservations.

9, connecting product transforms:

(1) full dose (10 μ l) is added in 100 μ l competent cells, places 30min in ice.

After (2) 42 ℃ of heating 45s, then place 1min in ice.

(3) add 890 μ l LB liquid nutrient mediums, 37 ℃ of 200rpm shaking culture 60min.

(4) the centrifugal 1min of 4000rpm, abandon supernatant, stays bacterium liquid, and piping and druming suspends.

(5) evenly coat on the LB solid medium flat board that contains X-Gal, IPTG, Amp and cultivate,

(6) 37 ℃ of positive 1h left and right of placing of incubator, after bacterium liquid is absorbed by substratum fully, be inverted overnight incubation to forming the visible single bacterium colony of naked eyes for 37 ℃.

(7) the some single colony inoculations of random choose contain in corresponding antibiotic LB liquid nutrient medium 37 ℃ in 5ml, and the 200rmp shaking table is cultivated 4-6h and identified for bacterium liquid PCR.

10, bacterium liquid PCR identifies:

The bacterium liquid of cultivating of take is template, carries out pcr amplification, and reaction system is with step 2.5.Amplified production is identified through 1% agarose gel electrophoresis.Deliver to Shanghai Sani biotech firm and carry out DNA sequencing identifying correct bacterium liquid.

11, the design of primers of serpin gene 3 ' end and 5 ' end in RACE amplification crucian ovum:

According to the part crucian ovum serpin gene order obtained be designed for 3 '-the specificity inner primer of RACE and 5 '-RACE:

5 ' inner primer: GGGTCTTGATAGATGTCATAGCG

3 ' inner primer: CTTCAGCGTTGACTTCTCCA

Primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Primer 3 ' race outer primer (5 '-taccgtcgttccactagtgattt-3 '), 3 ' race inner primer (5 '-cgcggatcctccactagtgatttcactatagg-3 '), 5 ' race outer primer (5 '-catggctacatgctgacagccta-3 '), 5 ' race inner primer (5 '-cgcggatccacagcctactgatgatcagtcgatg-3 ') comes from respectively TaKaRa 3 '-Full RACE Core Set Ver.2.0 and 5 '-Full RACE Kit.

12、3’RACE：

Utilize that TaKaRa 3 '-Full RACE Core Set Ver.2.0 can be by known cDNA sequence, highly sensitive, the increase full length sequence of 3 ' end of cDNA with high specificity.

Concrete Examination on experimental operation is as follows:

(1) reverse transcription reaction.Reaction system and reaction conditions are as follows:

Reaction conditions:

42℃1h

↓

70℃15min

After reaction finishes for carrying out next step experiment.

(2) sleeve type PCR reaction

1) OuterPCR reaction

Experimental implementation while using TaKaRa LATaq to carry out Outer PCR reaction is as follows:

2) after the PCR reaction finishes, the PCR reaction solution of getting 5～10 μ l carries out agarose gel electrophoresis, confirms pcr amplification product.And carry out Inner PCR reaction.

3) Inner PCR reaction.Reaction system and reaction conditions are as follows:

(3) agarose gel electrophoresis

After reaction finishes, the PCR reaction solution of getting 5～10 μ l carries out agarose gel electrophoresis, confirms 3 ' RACE pcr amplification product.

(4) sequencing analysis

The purpose product cloning of pcr amplification is carried out to DNA sequencing (concrete experimental implementation step is identical with aforementioned 2.7-2.11) to the pMD-18T carrier again.

13、5’RACE：

Utilize 5 '-Full RACE Kit amplification 5 ' end DNA sequence dna.

(1) phosphatizing treatment.

Use Alkaline Phosphatase (CIAP) to carry out the dephosphorization acid-respons to 5 ' phosphate group exposed in Total RNA.

1. by following component preparation dephosphorization acid-respons liquid.

2. 50 ℃ are reacted 1h.

3. to the 3M CH that adds 20 μ l in above-mentioned reaction solution ₃cOONa (pH5.2), the RNase Free dH of 130 μ l ₂after O, fully mix.

4. phenol/chloroform/the primary isoamyl alcohol (25: 24: 1) that adds 200 μ l, the centrifugal 5min of 13000 * g room temperature after fully mixing, by the upper water phase transition in new Microtube.

5. the chloroform that adds 200 μ l, the centrifugal 5min of 13000 * g room temperature after fully mixing, by the upper water phase transition in new Microtube.

6. after adding the NA Carrier of 2 μ l, evenly mix.

7. the Virahol that adds 200 μ l, after fully mixing, cooled on ice 10min.

8. 4 ℃ of centrifugal 20min of 13000 * g, abandon supernatant.

9. 70% cold ethanol (the RNase Free dH that adds 500 μ l ₂o preparation) rinsing, 4 ℃ of centrifugal 5min of 13000 * g, abandon after supernatant dry.

10. the RNase Free dH that adds 7 μ l ₂the O dissolution precipitation, obtain CIAP-treated RNA.

(2) " removing cap " reacts.

Use Tobacco Acid Pyrophosphatase (TAP) to remove the 5 ' cap sequence of mRNA, retain a phosphate group.

1. by following component preparation " removing cap " reaction solution.

2. 37 ℃ are reacted 1 hour.

3. this reaction solution is CIAP/TAP-treated RNA.Get 5 μ l for 5 ' RACE Adaptor ligation, remaining 5 μ l are stored in-80 ℃.

The connection of (3) 5 ' RACEAdaptor.

1. at first prepare following solution.

2. 65 ℃ of insulations are placed 2 minutes after 5 minutes on ice, then add following reagent.

3. 16 ℃ are reacted 1h.

4. to the 3M CH that adds 20 μ l in above-mentioned reaction solution ₃cOONa (pH5.2), the RNase Free dH of 140 μ l ₂after O, fully mix.

5. phenol/chloroform/the primary isoamyl alcohol (25: 24: 1) that adds 200 μ l, the centrifugal 5min of 13000 * g room temperature after fully mixing, by the upper water phase transition in new Microtube.

6. the chloroform that adds 200 μ l, the centrifugal 5min of 13000 * g room temperature after fully mixing, by the upper water phase transition in new Microtube.

7. after adding the NA Carrier of 2 μ l, evenly mix.

8. the Virahol that adds 200 μ l, after fully mixing, cooled on ice 10min.

9. 4 ℃ of centrifugal 20min of 13000 * g, abandon supernatant.70% cold ethanol (the RNase Free dH that adds 500 μ l ₂o preparation) rinsing, 4 ℃ of centrifugal 5min of 13000 * g, abandon after supernatant dry.

10. the RNase Free dH that adds 6 μ l ₂the O dissolution precipitation, obtain Ligated RNA.

(4) reverse transcription reaction.

1. by following component preparation inverse transcription reaction liquid.

2. the reverse transcription reaction condition is as follows:

30℃10min

↓

42℃1h

↓

70℃15min

3. reaction can be carried out next step experiment after finishing.

(5) Outer PCR reaction.

(6) InnerPCR reaction

(7) agarose gel electrophoresis

After reaction finishes, the PCR reaction solution of getting 5～10 μ l carries out agarose gel electrophoresis, confirms 3 ' RACE pcr amplification product.

(8) sequencing analysis

The purpose product cloning of pcr amplification is carried out to DNA sequencing (concrete experimental implementation step is identical with aforementioned 2.7-2.11) to the pMD-18T carrier again.

14, serpin gene sequencing and result in the crucian ovum:

Extract plasmid DNA and measure nucleotide sequence with dideoxy method, the use instrument is the full-automatic nucleotide sequencing instrument of Applied biosystems373A.

The result of genetic testing from 5 ' end to 3 ' terminal sequence is:

atggcctgggccgcgcctcacgaaggtcatgaccatgacggccacccagctgatcactaccaccatctccaccac 75

gggaaggacgaagcccaccccagccacagtggggaggatgcctgccatctgctttctccacacaacgctgacttt 150

gccttctccctctacaagaaacttgcgctccatcctgatgcccagggcaagaacattttcttctccccggtcggt 225

atctcaatggctttgagcatgctggctgtaggtgccaagggtagcactctatcacaaatatacagcagtctgggt 300

tacagcgggctgaaggctcagcaggtcaatgagggctatgagcacttgatccacatgcttggccacagtcaggac 375

agcatgcagctggaggcaggtgctggtgtggccatcagagaaggcttcaaagtggttgaccagttcctgaaggac 450

gttcagcactactacaacagcgaagccttcagcgttgacttctccaagcctgaaatcgctgcagaagagattaac 525

cagttcatcgccaagaaaaccaatgataaaataaccgacatggtgaaggacctggactctgatatggtgatgatg 600

ctgattaactatatgtacttcagagggaagtgggataagccatttgaagcacaactgactcacaaagctgagttc 675

aaagtggacaaggacaccaccgtgcaagttgacatgatgaaaagaaccggccgctatgacatctatcaagaccct 750

gtcaaccaaactacggtcatgatggtgccatacaaaggcaatacttccatgatgatcgttcttcctgatgaaggg 825

aagatgaaggatgttgaagaatccatctgcaggcaccatcttaagaactggcatgataaactcttcagaagctct 900

gtggacctgttcatgcccaagttctccatctctgcaacgtccaaactgaatgacattctgactgaaatgggagtg 975

actgatgcattcagtgacacagcagatttctctgggatgacagaagagctcaaagtgaaggtgtcacaggtcgtg 1050

cataaggcagtcctcagtgtggatgagaagggcacagaggcagcggccgcaaccacaatagagatcatgcccatg 1125

tccctgccaggcactgtgatgctcaaccgacctttcttggtactgattgtggaggacagcaccaagagcatcctc 1200

ttcatgggcaagattaccaatcctacagtg 1230

In the crucian ovum, the sequence of serpin gene nucleotide shows as: sequence length is 1230 bases, sequence type: nucleic acid, the chain number: strand, topology: the straight chain shape, sequence kind: cDNA, source: in crucian ovum coding crucian ovum, the serpin mature sequence is 85- 1230position Nucleotide, in the crucian ovum, the serpin gene is as the application of serpin in preparation crucian ovum.

15, serpin separation and purification, molecular weight determination and Property Identification in fish-egg

1 material and reagent

1.1 experiment material

Test is collected in the creek market of farm produce, garden, Changshu City with crucian, and totally 10, body weight 0.3～0.5kg, be all the female body of sexual maturity.

1.2 biochemical reagents

Sephadex G-50 gel, Sephadex G-75 gel, be Amersham Pharmacia company product; The affine filler of conA sepharose 4B steps science and technology purchased from Beijing China; The XBP-C4 reversed-phase column is Venusil company product; High-pressure liquid phase acetonitrile and trifluoroacetic acid (chromatographic grade) are Merck company product; Trypsin trypsin) and chromophoric substrate L-Benzoyl-L-arginine-pNA (BApNA) (B-3133) all purchased from sigma company; BCA (bicinchoninic acid, bicinchoninic acid) test kit, SDS, glycine, mercaptoethanol, Xylene Brilliant Cyanine G G 250, acrylamide, methylene diacrylamide, tetrabromophenol sulfonphthalein, beta-mercaptoethanol are all purchased from Beijing Ding Guo biotech firm.The glyprotein stain test kit is given birth to work purchased from Shanghai.Albumen marker is purchased from green skies biotech company.Other reagent is analytical pure, purchased from Chemical Reagent Co., Ltd., Sinopharm Group, and all Pass Test requirements.

2 experimental techniques

The preparation of fish-egg homogenate crude extract

The preparation of fish-egg homogenate

The live body crucian is cleaned with clear water, from its intraperitoneal, takes out fish-egg, with clear water, rinses blood stains well, adds appropriate pure water, grind to form homogenate with glass homogenizer, 10000g, 4 ℃ of centrifugal 30min, collect supernatant liquor, above step repeats 3 times, merges supernatant liquor, freezing standby.

The lyophilized powder preparation

1～2ml fish-egg extracting solution is put into to culture dish, and culture dish seals with preservative film, is placed in more than-80 ℃ of refrigerator and cooled freeze 12h; Prick a little apertures on taking-up immediately the preservative film at culture dish after fully freezing, put into rapidly freeze drier, dry more than 24 hours in freeze drier; Observe effect, can not reach re-set target and repeat again step of freeze drying.

Heat treated

With 0.1M hydrophosphate buffered soln PBS (pH 6.0), lyophilized powder is dissolved, 10000g, 4 ℃ of centrifugal 30min, get supernatant liquor and be placed in the centrifuge tube of handling well, and 4 ℃ are standby.

In view of before serpin contained in fish-egg being had to stronger thermostability, therefore the supernatant liquor of collection is positioned over to incubation 10min in 80 ℃ of water-baths, taking-up is cooled to room temperature, 10000g, 4 ℃ of centrifugal 25min, get supernatant liquor and be placed in the centrifuge tube of handling well ,-20 ℃ frozen standby.

ConA Sepharose 4B affinity chromatography

(1) dress post: this medium gel after taking out from 4 ℃ of refrigerators preferably at room temperature slowly jolting return to room temperature, then refill post, in order to avoid produce the aeration post, imitate.Get the chromatography column of a 1.6 * 25cm, the vertical placement, be fixed on iron stand.

(2) balance: binding buffer liquid (Binding Buffer) is 20mM Tris-HCl damping fluid, and pH7.4, wherein containing 1mM MnCl ₂, 1mM CaCl ₂, 0.15MNaCl.Because medium preservation liquid contains 20% ethanol, the medium that therefore installs post must carry out balance.The required liquid of balance media is about 10 column volumes.A little less than lectin and glycosyl bonding strength, for promoting the glycosyl combination, in cleaning buffer solution, can not contain 0.15MNaCl.

(3) absorption: the fish-egg lyophilized powder lysate of processed mistake is carried out to upper prop absorption after the dialysis of binding buffer liquid.

(4) clean: after the pre-separation component has all entered in medium, add cleaning liquid, flow velocity is 0.15ml/min, washes away non-specific adhesion protein, approximately 5-10 times of column volume.

(5) wash-out: use 20mM Tris-HCl (pH 7.4) (containing 0.2M Alpha-Methyl-D-MANNOSE glycosides) to carry out wash-out, with automatic Fraction Collector, collect, flow velocity is 1.5ml/10min, suppress active mensuration to collecting peak as trypsin, and Peak Activity is made to the SDS-PAGE protein electrophoresis and detect.

Gel permeation chromatography

Uncertain due to molecular weight, according to the existing gelatinous material of this experiment, choose respectively Sephadex G-50 and Sephadex G-75 carries out gel permeation chromatography.

(1) gel swelling: Sephadex G-50 and the dry glue particle of Sephadex G-75 are suspended in respectively in the distilled water that 5-10 doubly measures, in boiling water bath, the wet gel slurry are warming up to closely and boil gradually, 1-2h gets final product, now gel particle abundant swelling.The cracking gel particle on upper strata is inclined to, and by swelling, good gel particle is placed in vacuum drier the gel Air is pumped, and liquid too much above gel is inclined to.

(2) dress post: get the chromatography column of a 4.6 * 100cm, be vertically fixed on support, close the lower end outlet.Xiang Zhuzhong adds pH 6.0 phosphate buffered saline buffers of 1/3 volume.Then stir on limit, and limit, by the continuous impouring post of the coagulant liquid of grout shape, makes its natural subsidence, after the about 2-3cm of isogel sedimentation, the outlet of opening post, regulate suitable flow velocity, make gel continue heavy collection, stop filling post when the glue face of heavy collection rises to from about 5cm place, the top of post, form obvious separation surface in post, put into the sizeable filter paper of one deck in the gel top, connect constant flow pump, flow velocity is 0.3ml/min, when post no longer further compresses, keeps column top damping fluid 1-2cm high.

(3) column equilibration: before using be equivalent to the column volume twice or more elutriant flow through gel column, with the compacting gel.

The Peak Activity lyophilized powder that upper step is obtained is dissolved in 0.1M, pH6.0 phosphate buffered saline buffer, 10000g, centrifugal 10min, get supernatant and be splined on the Sephadex gel-filtration column that balance is good, uses same buffer solution elution, with automatic Fraction Collector, collect, flow velocity is 2.8mL/10min.Do trypsin inhibition determination of activity to collecting peak, and Peak Activity is made to the SDS-PAGE protein electrophoresis and detect.

Reverse phase HPLC (RP-HPLC)

(3) chromatography eluant condition

Detect wavelength: 280nm; Flow velocity: 1ml/min; Column temperature: room temperature; Sample size: 20 μ l; Retention time: 25min.The Peak Activity that upper step is obtained through Sephadex G-75 gel-filtration dissolves, 12000g, and 25min, 4 ℃ are centrifugal, get supernatant liquor with 0.45 μ m membrane filtration, collect the filtrate application of sample in high performance liquid phase C ₄post, with water (containing 0.1% trifluoroacetic acid): the elution system that second fine (containing 0.1% trifluoroacetic acid) forms is carried out gradient elution, collects Peak Activity.Reversed-phase column is Venusil XBP-C ₄, 4.6 * 250mm.

Serine protease suppresses active and detects

(contain 1mM CaCl at 50mM Tris-HCl buffered soln ₂), pH 7.8, reaction system in, measure the inhibitory effect of testing samples to the trypsin hydrolysis chromogenic substrate of serine stretch protein enzyme family in 25 ℃.The testing sample of difference amount and trypsin (final concentration is 30nM), in 25 ℃ of insulation 15min, are added to the substrate initial action that final concentration is 0.3mM.Chromophoric substrate be L-Benzoyl-L-arginine-pNA (BApNA) (Sigma), the total reaction system is 500 μ l.2min is in the variation of 410nm place monitoring photoabsorption continuously ^[2].Control group only adds proteolytic enzyme and does not add sample, take the contrast vigor as 100%, and residual enzyme vigor per-cent calculates with following formula:

Residual enzyme vigor per-cent (%)=1-[(1-Ai/A0)] * 100%

Wherein Ai and A0 mean respectively to add and the light absorption value while not adding inhibitor.

Determination of protein concentration

The determination of protein concentration method is measured according to BCA determination of protein concentration test kit (Shanghai ancient cooking vessel state biology), and concrete grammar is as follows:

(1) preparation BCA working fluid: according to standard substance and sample size, by 50 volume reagent A, 1 volume reagent B dosage BCA working fluid, fully mix.

(2) protein standard substance is added in the protein standard substance hole of 96 orifice plates by 0,1,2,4,6,8,10 microlitres, adds the steaming water that goes out and supplying 10 microlitres; Get 10 microlitre testing samples and add 96 orifice plates.It is individual parallel that each mensuration will be 2-3.

(3) survey in sample well and protein standard substance hole and add 200 microlitre BCA working fluids (volume ratio that is sample and working fluid is 1: 20) to mix to band.

(4) 37 ℃ of temperature are bathed 30min.The cold room temperature that is taken to.

(5) measure absorbancy under microplate reader 562nm wavelength.

(6) production standard curve is obtained the sample degree from typical curve.

The mensuration of serpin molecular weight

The preparation of SDS-PAGE protein electrophorese gel

Carry out the SDS-PAGE electrophoresis according to the Laemmli method, according to separation gel and the concentrated glue of table preparation different concns.Concrete operation step is as follows:

Table SDS-PAGE protein electrophorese gel (unit: ml)

Annotate: preparation before 1.10% APS is used

2., after adding 10%APS and TEMED to mix, should immediately gel be poured into to electrophoresis chamber

(1) with distilled water by the sheet glass wash clean, dry, and be fixed on electrophoresis chamber;

(2) according to experiment (the about 45kD of target protein left and right) requirement, prepare 10% separation gel;

(3) separation gel solution is injected rapidly to the interlayer of two sheet glass, reserve the concentrated glue requisite space of perfusion (the long 1cm that adds again of the tooth of comb).The careful one deck water (approximately 2～3mm is high) that injects on glue liquid surface, enter gelating soln to stop oxygen again;

(4) after separation gel polymerization fully (about 30min), incline and the covering water layer, and by the filter paper residuary water that exhausts;

(5) prepare 5% concentrated glue;

(6) directly pour into concentrated glue on the separation gel of polymerization, and insert immediately clean comb.Must be careful, avoid producing bubble, room temperature is placed 30min glue polymerization to be concentrated;

(7) get 40 μ l sample solutions and 10 μ l sample-loading buffers mix;

(8) after glue polymerization to be concentrated fully, gel is fixed on electrophoresis apparatus, in groove, adds 1 * Tris-glycine electrode buffer;

(9) carefully extract comb and repeatedly blow and beat the flushing well with the rifle head, discharging the bubble between two sheet glass of gel bottom simultaneously as far as possible;

(10) press the predefined procedure application of sample, every hole application of sample amount is 40 μ l (glue thickness is 1.0mm) (the about 25-50 μ of total protein concentration g).Add albumen Marker simultaneously;

(11) electrophoresis apparatus and power supply are joined, after voltage 80V electrophoresis 20min, voltage is increased to 100V and continues the about 100min of electrophoresis, powered-down when tetrabromophenol sulfonphthalein arrives the gel bottom, stop electrophoresis;

(12) unload lower glass plate from electrophoresis apparatus, with spatula, pry open sheet glass.Cut one jiao of orientation with the mark gel near gel bottom, Far Left one hole (the first groove);

(13) gel is placed in to the Coomassie brilliant blue G250 staining fluid and soaks, on the decolorization swinging table shaken gently, room temperature dyes more than 4h;

(14) reclaim dye liquor, change destainer decolouring 3-10h, change repeatedly destainer therebetween clear to background;

(15) gel is taken pictures.

The serpin estimating of molecular weight

Two appendix VF SDS-PAGE electrophoretic method of Chinese Pharmacopoeia version in 2000 calculate determining molecular weight standard and monomeric protein molecular weight.Albumen Marker Specification Curve of Increasing is as follows:

Calculate according to the following formula relative mobility:

Relative mobility=

Molecular weight logarithm with each protein standard is mapped and is obtained typical curve its relative mobility, measures the agnoprotein relative mobility, with x, represents relative mobility R _f, y represents the logarithm of Mr, the drawing standard curve.

The glyprotein stain of serpin

The gel-colored test kit of glycoprotein that adopts Shanghai to give birth to the work purchase carries out glyprotein stain, and concrete experimental technique is as follows:

(1) carry out the 10%SDS-PAGE gel electrophoresis according to preceding method, after take out gel, add the 20ml stationary liquid, fixing 10min on decolorization swinging table.

(2) incline and stationary liquid, with 20ml washings I concussion washing blob of viscose twice, each 2min, then add the 20ml oxidizing solution, concussion 20min.

(3) incline and oxidizing solution, add 20ml washings I concussion washing blob of viscose twice, each 2min.Again with 20ml deionized water concussion washing blob of viscose twice, each 2min.

(4) incline and deionized water, add the 20ml reducing solution.Concussion 10min, incline and reducing solution.And then shake detergent block twice with the 20ml deionized water.Each 2min, then add 20ml cleaning solution II concussion washed twice, each 2min.

(5) incline and cleaning solution II, then add the Alcian blue staining fluid of one times of concentration, concussion dyeing 20min.

(6) incline and Alcian blue staining fluid, add the 20ml cleaning solution II, concussion washing three times.Each needed time is respectively 10; 20; 20min.

(7) incline and cleaning solution II, add 20ml silver to dye the quick magnificent 20min of sensitizing solution concussion.

(8) incline to silver and dye sensitizing solution, add the concussion of 20ml cleaning solution II to clean 2 times.Each time is respectively 7min and 7min.

(9) incline and cleaning solution II, add the concussion of 20ml deionized water to clean 2 times, each time is 3min.

(10) incline and deionized water, add 20ml silver to dye staining fluid, concussion dyeing 15min.

(11) incline to silver and dye staining fluid, add the concussion of 20ml deionized water to clean 4 times, each time is 1min.

(12) get 40ml silver and dye colour developing liquid storage I and 14 μ l silver and dye colour developing liquid storage II, mix, make silver and dye nitrite ion, standby.

(13) incline and deionized water, add 20ml silver to dye nitrite ion, the pre-colour developing of concussion 30s.

(14) incline to muddy silver and dye nitrite ion, add the fresh silver of 20ml to dye nitrite ion, concussion dyeing 3min, manifest to the target protein band.

Serpin is combined with trypsin

Determine the inhibition type of CaSPI with reference to the people's such as Christensen detection method.The CaSPI albumen (30nM) of a certain amount of purifying from the trypsin (0-30nM) of different amounts in 25 ℃ of 0.05M Tris-HCl, be incubated 15min in pH 7.8 (containing 0.1M NaCl) damping fluid, add 5 * reduction electrophoretic buffer termination reaction and boil 5min.CaSPI and the formed mixture of trypsin are carried out to electrophoretic analysis under the 10%SDS-PAGE reduced state.

Serpin N-terminal sequence is measured

The preparation of SDS-PAGE protein electrophorese gel

Carry out gel preparation and encapsulating according to aforementioned glue method.The gel thicknesses 1.5mm of configuration.After glue polymerization to be concentrated fully, gel is fixed on electrophoresis apparatus; Carefully extract comb and repeatedly blow and beat the flushing well with the rifle head, discharging the bubble between two sheet glass of gel bottom simultaneously as far as possible; Add 1 * electrode buffer in groove, constant voltage 50V carries out prerunning, the empty 2h that runs.

Get 60 μ l sample solutions and 15 μ l sample-loading buffers mix, get 8 parts according to same volume, the boiling water bath heat denatured.The sample of handling well carries out loading, and every hole application of sample amount is 60 μ l (glue thickness is 1.5mm).

Electrophoresis apparatus and power supply are joined, after voltage 80V electrophoresis 30min, voltage is increased to 120V and continues the about 90min of electrophoresis, until tetrabromophenol sulfonphthalein powered-down during apart from gel bottom 0.5cm, stop electrophoresis;

The PVDF transferring film

Get a pvdf membrane, wear gloves filter paper and pvdf membrane are cut according to size, the pvdf membrane of well cutting is placed in methanol solution, soak the several seconds, then put into CAPS electroblotting damping fluid.

The SDS-PAGE electrophoresis is pried open sheet glass after finishing, and will concentrate glue and scrape off gently, avoids separation gel is scratched, and carefully peels separation gel, in the CAPS damping fluid, soaks 8min.

The filter paper that to test for electroblotting and sponge are put into the electroblotting damping fluid and soak; then the order by sponge, filter paper, pvdf membrane, gel, filter paper, sponge installs the electroblotting interlayer; and put into the small electrical turn trough; carry out the electroblotting transfer in low temperature in 300mA constant current situation, be 2h transfer time.

Shift and finish the rear pvdf membrane that takes out, slightly clean with deionized water, methyl alcohol soaks the several seconds, be placed in 0.1%Coomassie R-250 dyeing 50s, with 50% methyl alcohol decolouring (the attention duty is changed destainer), and fully wash with deionized water, then can cut band to be checked order.The band to be checked order of cutting is delivered to school of life and health sciences order-checking section of Peking University and carry out protein N terminal sequence mensuration.

16, the detection of CaSPI anti-microbial activity and minimal inhibitory concentration are determined:

Test strain: intestinal bacteria Escherichia coli, subtilis Bacillus dysenteriae.

Every milliliter containing 10 ⁶the bacterium liquid of bacterium or spore is evenly coated the solid bacteria media surface, to be placed in media surface through the filter paper of the 0.5cm diameter of sterilizing, drip certain density testing sample solution, cultivate 18-20h in 37 ℃, whether observe inhibition zone forms, what have inhibition zone to form shows that anti-microbial activity is arranged, and further carries out the mensuration of minimal inhibitory concentration.

While measuring minimal inhibitory concentration, adopt doubling dilution to carry out antibiotic detection.Using Luria-Bertani (LB) liquid nutrient medium as developing medium.Reference culture, after the recovery of LB solid medium, becomes every milliliter containing 10 with sterilized water dilution bacterium colony ⁶the bacterium liquid of bacterium or spore, be inoculated in the LB liquid nutrient medium by bacterium liquid, and the bacterium ultimate density is 10 ⁵.

In the 1.9mL substratum, add sample 0.1mL through the amphibian animal skin extract that is dissolved in physiological saline of 0.22 μ m aperture membrane filtration as the first pipe, get 1mL after mixing and add the 2nd pipe, doubling dilution, discard from the 9th pipe sucking-off 1mL successively, the 10th piping control tube, as shown:

The bacterium liquid (10 of having proofreaied and correct will be added in each pipe ⁵cfu/mL) 0.05mL, mix 37 ℃ of rear placements and cultivate 18h, measures photoabsorption in 600nm wavelength place.Minimal inhibitory concentration is to cannot see the minimum sample concentration of bacterial growth.Sample protein concentration adopts following formula to be calculated: Protein concentration (mg/mL)=(A _{215 nm}-A _225nm) * 0.144.

Antibiotic detected result shows, in the crucian ovum, purifying obtains serpin CaSPI test strain is all had to anti-microbial activity, and CaSPI obviously is better than subtilis to colibacillary inhibition.

The minimal inhibitory concentration result of the serpin CaSPI that in the crucian ovum, purifying obtains as shown in Table 5-1.

Proteinase inhibitor C aSPI minimal inhibitory concentration in table 5-1 crucian ovum

Claims (4)

1. serpin in the crucian ovum, it is characterized in that in this crucian ovum, serpin separates a kind of cyclic protein enzyme inhibitors obtained from the crucian ovum, molecular weight 42651.9Da, iso-electric point is pH 5.61 ± 0.02, and in the crucian ovum, serpin protein total order is classified SEQ NO:1 as.

2. crucian ovum serpin gene, is characterized in that nucleotide sequence cDNA is comprised of 1230 Nucleotide, and its sequence is SEQ NO:2.

3. serpin gene in crucian ovum claimed in claim 2, is characterized in that, in coding crucian ovum, the serpin mature sequence is 85-1230 position Nucleotide, and its corresponding aminoacid sequence is SEQ NO:1.

4. the described crucian ovum of claim 1 serpin is in the medicinal application of the diseases such as antibacterial, the tumour of preparation, gastritis, pancreatitis and/or cancer.

Images