CN103014145A - Controllable distribution method of gold nanoparticles on DNA origami chip - Google Patents
Controllable distribution method of gold nanoparticles on DNA origami chip Download PDFInfo
- Publication number
- CN103014145A CN103014145A CN2012103629001A CN201210362900A CN103014145A CN 103014145 A CN103014145 A CN 103014145A CN 2012103629001 A CN2012103629001 A CN 2012103629001A CN 201210362900 A CN201210362900 A CN 201210362900A CN 103014145 A CN103014145 A CN 103014145A
- Authority
- CN
- China
- Prior art keywords
- paper folding
- probe
- dna
- chip
- colloidal gold
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The invention relates to a controllable distribution method of gold nanoparticles on a DNA origami chip, comprising the following steps of: firstly, constructing an asymmetrical two-dimensional graph by utilizing a DNA origami technique to prepare the DNA origami chip; secondly, preparing a colloidal gold probe; thirdly, hybridizing a DNA short chain with the colloidal gold probe; fourthly, connecting a grain size colloidal gold probe with an asymmetrical two-dimensional graphic DNA origami chip; and fifthly, imaging by virtue of an atomic force microscope, wherein the asymmetric two-dimensional graph extends three staple chain end modified oligonucleotide capture probes near a specific position, and hybridizing the three staple chain end modified oligonucleotide capture probes with an end modified 5nm colloidal gold particle reporter probe chain in a three-to-one manner. The controllable distribution method provided by the invention has broad application space in the subject areas of infinitesimal biochemical detection chip development, nanometer device development, nanoparticle basic property study and the like.
Description
The application is dividing an application of Chinese invention patent application " the controlled distribution method of nm gold particles on DNA paper folding chip ", and application number is 201010503080.4, and the applying date is on October 12nd, 2010.
Technical field
What the present invention relates to is a kind of location mode of field of nanometer technology, is template based on asymmetric two-dimentional DNA paper folding art chip particularly, makes up the controlled distribution method of 5nm nano particle on DNA paper folding chip.
Background technology
Nanometer gold (nanogold) refers to the molecule of gold, and its diameter is 1 one 100nm, is generally the colloidal solution that is dispersed in water formation, therefore claim again Radioactive colloidal gold.Certain chemical substance in the nm gold particles surface adsorption, the monomer nm gold particles is very stable.The golden nanometer particle electron density is high, has quantum size effect, and small volume effect and surface effects can be passed through the multiple action modes such as electrostatic attraction, hydrophobic effect and be combined with macromole and form stable colloidal gold probe.Over more than 40 year, nm gold particles has been widely used in the biotechnologys such as immunocytochemistry and biomarker in the past.
2006, the Rothemund of California Institute of Technology proposed, designs and realized DNA paper folding art.[RothemundPw.Nature2006，440，297)。Rothemund has folded six kinds of figures in initial article, although differ from one another, be not difficult to find that they all are symmetric figures.The DNA paper folding art nanometer gold of arranging can be divided three classes substantially according to the different of methods: the first kind is oligonucleotide hybridization assay.Modify certain oligonucleotide chain (actual gold goal surface can connect a lot of chains) at nm gold particles, then it is added in the paper folding art figure, owing to can stretch out the probe with this oligonucleotide chain complementation on the staple chain, so gold goal will be attached to by the hybridization of nucleic acid chains [L on the specific position of figure.JD，PintoY，SeelllanNc，et al.Nano LetterS 2004，4，2343]。Equations of The Second Kind is the direct-assembling method.Since nanometer gold can be combined with DNA, so just might allow it participate in paper folding art figure self assembling process directly, when self-assembly is finished, these micromolecular arranging [SharmaJ, ChhabraR, Andersen CS have also just been formed, et al.J AmChem Soc 2008,130,7820].The 3rd class is additive method.Other methods that connect nanometer gold also have a lot, such as the molecule photolithography (molecular lithography) (DengZ, Mao C.Angew Chem Int Ed Engl2004,43,4068) of Chengde Mao group exploitation, etc.
Open source literature has been put down in writing Zhang Zhao etc. and has been delivered space by name addressable at advanced material and exempt to disclose DNA paper folding chip staple chain-ordering table [zhaoz in the asymmetric DNA paper folding of the liquid phase chip article of index, Yingw, et al.AdyMater 2010,22,1], the asymmetric two-dimentional DNA paper folding art of the imitative map of China shape of this article utilization is template, in template design with draw specific oligonucleotide sequence as connection site, by with the biotin-avidin systematic cross combination of having modified complementary sequence DNA short chain, nanoparticle is attached on the paper folding chip, simultaneously, also the binding site of nanoparticle is compared.
Summary of the invention
The object of the invention is to overcome deficiency of the prior art, the controlled distribution method of a kind of nano particle on DNA paper folding chip is provided.The present invention adopts the identical DNA paper folding chip staple chain-ordering table of prior art, and direction is from left to right to be 5 ' one 3 '.But, the position of design binding site and stretch out specific oligonucleotide sequence when preparation DNA paper folding chip on the template among the present invention, the staple chain that needs the staple chain that band stretch out oligonucleotide capture probe to be replaced same sequence number in the tabulation gets final product.The method of the present invention by utilizing oligonucleotide sequence to modify and hybridize at the nanometer paper folding art structure connection 5nm of imitative map of China shape particle diameter colloid gold particle, thereby realizes the controlled distribution of nano particle on DNA paper folding chip.
The present invention realizes by following three kinds of technical schemes:
Technical scheme one
Technical scheme one comprises that step is as follows:
The first step is utilized asymmetric X-Y scheme of DNA paper folding art structure, preparation DNA paper folding chip;
Described asymmetric X-Y scheme stretches out oligonucleotide capture probe at the staple chain end of specific position, allows the object chain of it and end modified 5nm particle diameter colloid gold particle hybridize one to one.
Described asymmetric X-Y scheme is the single stranded DNA that relies on the M13mp18 phage, reaches the folding formation of 7249 base scaffolding long-chain raster filling formulas, and figure is then from 229 short staple chains that are used for binding.
The preparation method of described DNA paper folding chip:
(1) all the 100 μ M staple chains that will use, comprise that forming equal-volume asymmetric X-Y scheme, that stretch out probe mixes, 20 times of redilution are for subsequent use;
It is 9 that the staple chain stretches out the oligonucleotide capture probe sequence number.
(2) mixing total amount at 96 orifice plates is the solution of 30 μ l: 0.025 μ M staple chain: 22 μ l; The M13mp18:1 μ l of 1/2 concentration; 1 * TAE-Mg2+buffer:7 μ l.
Second step, the preparation colloidal gold probe;
Colloidal gold probe preparation method described in the second step:
1. oligonucleotide adds in the 10mM phosphoric acid buffer with 5nm particle diameter Radioactive colloidal gold molar concentration rate 200 to 1, and room temperature 300rpm shook 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shook 48 hours.
3. 4 ℃, centrifugal 10 minutes of 15000rpm abandons supernatant.
4. add the 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE; 10mM Tris-HCl, 1mM EDTA, pH=8.0,4 ℃ of preservations.
6. 5nm particle diameter colloidal gold probe concentration utilizes 520nm length ultraviolet absorption peak to measure.
In the 3rd step, the particle diameter colloidal gold probe is connected with asymmetric X-Y scheme DNA paper folding chip;
Connection described in the 3rd step refers to: 5nm particle diameter colloidal gold probe mixes with asymmetric X-Y scheme DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths were hybridized 1 hour.
The 4th step, the atomic force microscope imaging;
The step of atomic force microscope imaging described in the 4th step: draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and to take imaging under the atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping of using.
The atomic force microscope imaging results shows, adopts technical scheme one described method, and nm gold particles joint efficiency on DNA paper folding art figure can reach about 10%.
Technical scheme two
Consider that the oligonucleotide probe that is connected on the gold size particle exists about 50 ℃ active temperature threshold value (meltingtemperature), be lower than this temperature oligonucleotide probe and be adsorbed on the gold size particle surface and lost the ability most of and link of capture probe chain, the result causes joint efficiency very low.When hybridization temperature was higher than 50 ℃, imitative map of China paper folding figure the localized heat degraded can occur and be connected connection, loses original pattern.So hybridization is fixed near on the oligonucleotide probe of gold grain bottom, affects joint efficiency to avoid oligonucleotide probe to be adsorbed on the gold size particle surface.
Technical scheme two comprises that step is as follows:
The first step is utilized asymmetric X-Y scheme of DNA paper folding art structure, preparation DNA paper folding chip;
Described asymmetric X-Y scheme is the single stranded DNA that relies on the M13mp18 phage, reaches the folding formation of 7249 base scaffolding long-chain raster filling formulas, and figure is then from 229 short staple chains that are used for binding.
The preparation method of described DNA paper folding chip:
(1) all the 100 μ M staple chains that will use, comprise that forming equal-volume asymmetric X-Y scheme, that stretch out probe mixes, 20 times of redilution are for subsequent use;
It is 9 that the staple chain stretches out the oligonucleotide capture probe sequence number.
(2) mixing total amount at 96 orifice plates is the solution of 30 μ l: 0.025 μ M staple chain: 22 μ l; The M13mp18:1 μ l of 1/2 concentration; 1 * TAE-Mg2+buffer:7 μ l.
Second step, the preparation colloidal gold probe;
Described colloidal gold probe, before colloidal gold probe was connected into map, first with a 10nt short chain, in the time of 50 ℃, hybridization was fixed near on the oligonucleotide probe of gold grain bottom.
Described colloidal gold probe preparation method may further comprise the steps:
1. oligonucleotide adds in the 10mM phosphoric acid buffer with 5nm particle diameter Radioactive colloidal gold molar concentration rate 200 to 1, and room temperature 300rpm shook 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shook 48 hours.
3. 4 ℃, centrifugal 10 minutes of 15000rpm abandons supernatant.
4. add the 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE; 10mM Tris-HCl, 1mM EDTA, pH=8.0,4 ℃ of preservations.
6. 5nm particle diameter colloidal gold probe concentration utilizes 520nm length ultraviolet absorption peak to measure.
The 3rd step, DNA short chain and colloidal gold probe hybridization;
Hybridization described in the 3rd step refers to: 5nm particle diameter colloidal gold probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths were hybridized 1 hour.
In the 4th step, the particle diameter colloidal gold probe is connected with asymmetric X-Y scheme DNA paper folding chip;
Connection described in the 4th step refers to: 5nm particle diameter colloidal gold probe mixes with asymmetric X-Y scheme DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths were hybridized 1 hour.
The 5th step, the atomic force microscope imaging;
The step of atomic force microscope imaging described in the 5th step: draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and to take imaging under the atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping of using.
The atomic force microscope imaging results shows, adopts technical scheme two described methods, and nm gold particles joint efficiency on DNA paper folding art figure slightly is improved, and can reach about 15%.
Technical scheme three
Technical scheme three comprises that step is as follows:
The first step is utilized asymmetric X-Y scheme of DNA paper folding art structure, preparation DNA paper folding chip;
Described asymmetric X-Y scheme stretches out three staple chain end modified oligonucleotide capture probes near specific position, allow three pairs of hybridization of reporter probe chain of they and same end modified 5nm particle diameter colloid gold particle.
Described asymmetric X-Y scheme is the single stranded DNA that relies on the M13mp18 phage, reaches the folding formation of 7249 base scaffolding long-chain raster filling formulas, and figure is then from 229 short staple chains that are used for binding.
The preparation method of described DNA paper folding chip:
(1) all the 100 μ M staple chains that will use, comprise that forming equal-volume asymmetric X-Y scheme, that stretch out probe mixes, 20 times of redilution are for subsequent use;
It is 9,10,22 that the staple chain stretches out the oligonucleotide capture probe sequence number.
(2) mixing total amount at 96 orifice plates is the solution of 30 μ l: 0.025 μ M staple chain: 22 μ l; The M13mp18:1 μ l of 1/2 concentration; 1 * TAE-Mg2+buffer:7 μ l.
Second step, the preparation colloidal gold probe;
Colloidal gold probe preparation method described in the second step:
1. oligonucleotide adds in the 10mM phosphoric acid buffer with 5nm particle diameter Radioactive colloidal gold molar concentration rate 200 to 1, and room temperature 300rpm shook 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shook 48 hours.
3. 4 ℃, centrifugal 10 minutes of 15000rpm abandons supernatant.
4. add the 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE; 10mM Tris-HCl, 1mM EDTA, pH=8.0,4 ℃ of preservations.
6. 5nm particle diameter colloidal gold probe concentration utilizes 520nm length ultraviolet absorption peak to measure.
The 3rd step, DNA short chain and colloidal gold probe hybridization;
Hybridization described in the 3rd step refers to: 5nm particle diameter colloidal gold probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths were hybridized 1 hour.
In the 4th step, the particle diameter colloidal gold probe is connected with asymmetric X-Y scheme DNA paper folding chip;
Connection described in the 4th step refers to: 5nm particle diameter colloidal gold probe mixes with asymmetric X-Y scheme DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths were hybridized 1 hour.
The 5th step, the atomic force microscope imaging;
The step of atomic force microscope imaging described in the 5th step: draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and to take imaging under the atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping of using.
Near paper folding figure specific position, stretch out three staple chain end modified oligonucleotide capture probes, allow three pairs of hybridization of reporter probe chain of they and same end modified 5nm particle diameter colloid gold particle, association schemes two again, strengthened simultaneously the stability that connects so that the gold grain locus is effectively controlled.The atomic force microscope imaging results shows, adopts technical scheme three described methods, and nm gold particles joint efficiency on DNA paper folding art figure obviously improves, and can reach more than 95%.
Embodiment
The present embodiment is implemented under take technical solution of the present invention as prerequisite, has provided detailed embodiment and process, but protection scope of the present invention is not limited to following embodiment.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, or the condition of advising according to manufacturer.
Embodiment 1
Testing conditions:
The present embodiment adopts DNA paper folding art to construct the shape of map of China, and the atomic force microscope imaging results shows approximately 150 nanometers of the strong point of resulting map of China, and the widest part is 120 nanometers approximately, highly are 2 nanometers.This figure is the folding formation that relies on scaffolding long-chain (single stranded DNA of M13mp18 phage reaches 7249 bases) raster filling formula, and the map pattern is then from 229 short staple chains that are used for binding.The characteristics of this figure are that 229 staple chains are exactly more than 200 addressable potential reaction site, and any point on the masterplate can utilize figure self as with reference to accurately locating, and need not index marker.In addition, in 229 short dna strands any one can stretch out nucleotide sequence as capture probe with hybridize with the complementary nucleotide sequence of nanoparticle label, as the tie point of nano particle on the paper folding figure.When utilizing this asymmetrical graphic to distribute for template forms nano dot, utilize the template complicacy to reduce the complicacy requirement that nano dot is distributed.Asymmetric X-Y scheme described in the present embodiment stretches out oligonucleotide capture probe at the staple chain end of specific position, allows the object chain of it and end modified 5nm particle diameter colloid gold particle hybridize one to one.
The present embodiment is take map of China as chip base, all staple chains, comprise form map, stretch out probe, all order (PAGE purifying) from Shanghai JaRa company, and unified to be diluted to 100 μ M with intermediate water for subsequent use.The scaffolding chain uses the M13mp18 virus strand of NEB company, article No. N4040S.Be total to 7249base, concentration is 0.25 μ g/ μ l, total 5 μ g.Because 1 μ g ≈ 0.42pmol, therefore the about 0.1pM/ μ l=0.1 μ M of concentration.Actual 1/2 concentration that is diluted to is used.Cut processing without enzyme, retaining ring chain state.5nm particle diameter colloid gold particle uses Sigma company, article No. G1402.Use identical reaction buffer and imaging buffer: at 1 * TAE (Tris, 40mM; Acetic acid, 20mM; EDTA, 2mM) the middle magnesium acetate powder that adds, the Mg2+ final concentration is 12.5mM, pH8.0.Use multiple-pattern atomic force microscope (Multimode AFM) observation of U.S. Veeco/Digital Instruments company.J-scanner, the NP-S needle point, resonant frequency is between 7-10kHz.
The controlled distribution implementation step of the nano particle of the present embodiment is as follows:
First: the imitative map of China shape DNA paper folding chip of preparation
1. all the staple chains that will use (100 μ M) are comprised that forming equal-volume map, that stretch out probe mixes, 20 times of redilution are for subsequent use.It is 9 that the staple chain stretches out the oligonucleotide capture probe sequence number.
On 96 orifice plates according to following system mixing solutions: (below be the system of " saving ", can be whole double during actual doing, or double the scaffolding chain separately)
Staple chain (0.025 μ M) 22 μ l
M13mp18 (1/2 concentration) 1 μ l
1×TAE-Mg2+buffer 7μl
Total 30μl
3. be placed on the upper annealing of PCR instrument (ABI 9700), 95 ℃ are cooled to 20 ℃, 0.1 ℃/10s=0.6 ℃/min=1 ℃/100s.
Second: preparation 5nm particle diameter colloidal gold probe
1. oligonucleotide adds in the 10mM phosphoric acid buffer with 5nm particle diameter colloid gold particle molar concentration rate 200 to 1, and room temperature 300rpm shook 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shook 48 hours.
3.4 ℃, centrifugal 10 minutes of 15000rpm abandons supernatant.
4. add the 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE (10mM Tris-HCl, 1mM EDTA, pH=8.0), 4 ℃ of preservations.
6.5nm particle diameter colloid gold particle concentration and probe concentration utilizes 0D260 to measure.
The 3rd: 5nm particle diameter colloid gold particle probe is connected with imitative map of China shape DNA paper folding chip
5nm particle diameter colloid gold particle probe mixes with imitative map of China shape DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths were hybridized 1 hour.
The the 4th: the atomic force microscope imaging
Draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and to take imaging under the atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping of using.
The demonstration of atomic force microscope imaging results, the present embodiment nm gold particles joint efficiency on DNA paper folding art figure can reach about 10%.
Embodiment 2
Testing conditions:
The present embodiment adopts DNA paper folding art to construct the shape of map of China, and the atomic force microscope imaging results shows approximately 150 nanometers of the strong point of resulting map of China, and the widest part is 120 nanometers approximately, highly are 2 nanometers.This figure is the folding formation that relies on scaffolding long-chain (single stranded DNA of M13mp18 phage reaches 7249 bases) raster filling formula, and the map pattern is then from 229 short staple chains that are used for binding.The characteristics of this figure are that 229 staple chains are exactly more than 200 addressable potential reaction site, and any point on the masterplate can utilize figure self as with reference to accurately locating, and need not index marker.In addition, in 229 short dna strands any one can stretch out nucleotide sequence as capture probe with hybridize with the complementary nucleotide sequence of nanoparticle label, as the tie point of nano particle on the paper folding figure.When utilizing this asymmetrical graphic to distribute for template forms nano dot, utilize the template complicacy to reduce the complicacy requirement that nano dot is distributed.Consider in the present embodiment that the oligonucleotide probe that is connected on the gold size particle exists about 50 ℃ active temperature threshold value (melting temperature), be lower than this temperature oligonucleotide probe and be adsorbed on the gold size particle surface and lost the ability most of and link of capture probe chain, the result causes joint efficiency very low.When hybridization temperature was higher than 50 ℃, imitative map of China paper folding figure the localized heat degraded can occur and be connected connection, loses original pattern.So hybridization is fixed near on the oligonucleotide probe of gold grain bottom, affects joint efficiency to avoid oligonucleotide probe to be adsorbed on the gold size particle surface.
The present embodiment is take map of China as chip base, all staple chains, comprise form map, stretch out probe, all order (PAGE purifying) from Shanghai JaRa company, and unified to be diluted to 100 μ M with intermediate water for subsequent use.The scaffolding chain uses the M13mp18 virus strand of NEB company, article No. N4040S.Be total to 7249base, concentration is 0.25 μ g/ μ l, total 5 μ g.Because 1 μ g ≈ 0.42pmol, therefore the about 0.1pM/ μ l=0.1 μ M of concentration.Actual 1/2 concentration that is diluted to is used.Cut processing without enzyme, retaining ring chain state.5nm particle diameter colloid gold particle uses Sigma company, article No. G1402.Use identical reaction buffer and imaging buffer: at 1 * TAE (Tris, 40m; Acetic acid, 20m; EDTA, 2m) the middle magnesium acetate powder that adds, the Mg2+ final concentration is 12.5mM, pH8.0.Use multiple-pattern atomic force microscope (Multimode AFM) observation of U.S. Veeco/Digital Instruments company.J-scanner, the NP-S needle point, resonant frequency is between 7-10kHz.
The controlled distribution implementation step of the nano particle of the present embodiment is as follows:
First: the imitative map of China shape DNA paper folding chip of preparation
1. all the staple chains that will use (100 μ M) are comprised that forming equal-volume map, that stretch out probe mixes, 20 times of redilution are for subsequent use.It is 9 that the staple chain stretches out the oligonucleotide capture probe sequence number.
On 96 orifice plates according to following system mixing solutions: (below be the system of " saving ", can be whole double during actual doing, or double the scaffolding chain separately)
Staple chain (0.025 μ M) 22 μ l
M13mp18 (1/2 concentration) 1 μ l
1×TAE-Mg2+buffer 7μl
Total 30μl
3. be placed on the upper annealing of PCR instrument (ABI 9700), 95 ℃ are cooled to 20 ℃, 0.1 ℃/10s=0.6 ℃/min=1 ℃/100s.
Second: preparation 5nm particle diameter colloidal gold probe
1. oligonucleotide adds in the 10mM phosphoric acid buffer with 5nm particle diameter colloid gold particle molar concentration rate 200 to 1, and room temperature 300rpm shook 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shook 48 hours.
3.4 ℃, centrifugal 10 minutes of 15000rpm abandons supernatant.
4. add the 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE (10mM Tris-HCl, 1mM EDTA, pH=8.0), 4 ℃ of preservations.
6.5nm particle diameter colloid gold particle concentration and probe concentration utilizes OD260 to measure.
The the 3rd: 10nt DNA short chain and 5nm particle diameter colloid gold particle probe hybridization
5nm particle diameter colloid gold particle probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths were hybridized 1 hour.
The 4th: 5nm particle diameter colloid gold particle probe is connected with imitative map of China shape DNA paper folding chip
5nm particle diameter colloid gold particle probe mixes with imitative map of China shape DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths were hybridized 1 hour.
The the 5th: the atomic force microscope imaging
Draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and to take imaging under the atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping of using.
The demonstration of atomic force microscope imaging results, the present embodiment nm gold particles joint efficiency on DNA paper folding art figure slightly is improved, and can reach about 15%.
Embodiment 3
Testing conditions:
The present embodiment adopts DNA paper folding art to construct the shape of map of China, and the atomic force microscope imaging results shows approximately 150 nanometers of the strong point of resulting map of China, and the widest part is 120 nanometers approximately, highly are 2 nanometers.This figure is the folding formation that relies on scaffolding long-chain (single stranded DNA of M13mp18 phage reaches 7249 bases) raster filling formula, and the map pattern is then from 229 short staple chains that are used for binding.The characteristics of this figure are that 229 staple chains are exactly more than 200 addressable potential reaction site, and any point on the masterplate can utilize figure self as with reference to accurately locating, and need not index marker.In addition, in 229 short dna strands any one can stretch out nucleotide sequence as capture probe with hybridize with the complementary nucleotide sequence of nanoparticle label, as the tie point of nano particle on the paper folding figure.When utilizing this asymmetrical graphic to distribute for template forms nano dot, utilize the template complicacy to reduce the complicacy requirement that nano dot is distributed.Near paper folding figure specific position, stretch out three staple chain end modified oligonucleotide capture probes in the present embodiment, allow three pairs of hybridization of reporter probe chain of they and same end modified 5nm particle diameter colloid gold particle, association schemes two again, strengthened simultaneously the stability that connects so that the gold grain locus is effectively controlled.
The present embodiment is take map of China as chip base, all staple chains, comprise form map, stretch out probe, all order (PAGE purifying) from Shanghai JaRa company, and unified to be diluted to 100 μ M with intermediate water for subsequent use.The scaffolding chain uses the M13mp18 virus strand of NEB company, article No. N4040S.Be total to 7249base, concentration is 0.25 μ g/ μ l, total 5 μ g.Because 1 μ g ≈ 0.42pmol, therefore the about 0.1pM/ μ l=0.1 μ M of concentration.Actual 1/2 concentration that is diluted to is used.Cut processing without enzyme, retaining ring chain state.5nm particle diameter colloid gold particle uses Sigma company, article No. G1402.Use identical reaction buffer and imaging buffer: at 1 * TAE (Tris, 40mM; Acetic acid, 20mM; EDTA, 2mM) the middle magnesium acetate powder that adds, the Mg2+ final concentration is 12.5mM, pH8.0.Use multiple-pattern atomic force microscope (Multimode AFM) observation of U.S. Veeco/Digital Instruments company.J-scanner, the NP-S needle point, resonant frequency is between 7-10kHz.
The controlled distribution implementation step of the nano particle of the present embodiment is as follows:
First: the imitative map of China shape DNA paper folding chip of preparation
1. all the staple chains that will use (100 μ M) are comprised that forming equal-volume map, that stretch out probe mixes, 20 times of redilution are for subsequent use.It is 9,10,22 that the staple chain stretches out the oligonucleotide capture probe sequence number.
On 96 orifice plates according to following system mixing solutions: (below be the system of " saving ", can be whole double during actual doing, or double the scaffolding chain separately)
Staple chain (0.025 μ M) 22 μ l
M13mp18 (1/2 concentration) 1 μ l
1×TAE-Mg2+buffer 7μl
Total 30μl
3. be placed on the upper annealing of PCR instrument (ABI 9700), 95 ℃ are cooled to 20 ℃, 0.1 ℃/10s=0.6 ℃/min=1 ℃/100s.
Second: preparation 5nm particle diameter colloidal gold probe
1. oligonucleotide adds in the 10mM phosphoric acid buffer with 5nm particle diameter colloid gold particle molar concentration rate 200 to 1, and room temperature 300rpm shook 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shook 48 hours.
3.4 ℃, centrifugal 10 minutes of 15000rpm abandons supernatant.
4. add the 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE (10mM Tris-HCl, 1mM EDTA, pH=8.0), 4 ℃ of preservations.
6.5nm particle diameter colloid gold particle concentration and probe concentration utilizes 0D260 to measure.
The the 3rd: 10nt DNA short chain and 5nm particle diameter colloid gold particle probe hybridization
5nm particle diameter colloid gold particle probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths were hybridized 1 hour.
The 4th: 5nm particle diameter colloid gold particle probe is connected with imitative map of China shape DNA paper folding chip
5nm particle diameter colloid gold particle probe mixes with imitative map of China shape DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths were hybridized 1 hour.
The the 5th: the atomic force microscope imaging
Draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and to take imaging under the atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping of using.
The demonstration of atomic force microscope imaging results, the present embodiment nm gold particles joint efficiency on DNA paper folding art figure obviously improves, and can reach more than 95%.
DNA paper folding chip staple chain stretches out the oligonucleotide capture probe sequence, and following (stretched partly is the staple chain, italicized item is to stretch out oligonucleotide capture probe, from left to right be 5 '-3 ', during preparation DNA paper folding chip, replace same sequence number staple chain):
9CGCCTAGTTGGACGGCGACACAGGAGGTAGTGCCGTCGAGAGGG (being used for technical scheme one, two, three)
10CGCCTAGTTGGACGGCGACACAGTACCAGGCGGATATTAGCGGG (being used for technical scheme three)
22CGCCTAGTTGGACGGCGACAGTTTTGCTAAGAGAAGGATTAGGAGAGGCTGA (being used for technical scheme three)
10nt DNA short chain sequence (from left to right being 5 '-3 ')
CGCCTAGTTG
Mercapto groups is modified reporter probe sequence (from left to right being 5 '-3 ')
TGTCGCCGTCCAACTAGGCG-SH
The atomic force microscope imaging results of above embodiment shows respectively: nm gold particles joint efficiency on DNA paper folding art figure can reach 10%-15%, and high energy reaches more than 95%.
Claims (6)
1. the controlled distribution method of a nano particle on DNA paper folding chip is characterized in that, comprises the steps:
The first step is utilized asymmetric X-Y scheme of DNA paper folding art structure, preparation DNA paper folding chip,
Second step, the preparation colloidal gold probe,
The 3rd step, DNA short chain and colloidal gold probe hybridization,
In the 4th step, the particle diameter colloidal gold probe is connected with asymmetric X-Y scheme DNA paper folding chip,
The 5th step, the atomic force microscope imaging,
Described asymmetric X-Y scheme stretches out three staple chain end modified oligonucleotide capture probes near specific position, allow three pairs of hybridization of reporter probe chain of they and same end modified 5nm particle diameter colloid gold particle.
2. the controlled distribution method of nano particle according to claim 1 on DNA paper folding chip is characterized in that, described DNA paper folding chip, and its preparation method is as follows:
(1) all the 100 μ M staple chains that will use, comprise that forming equal-volume asymmetric X-Y scheme, that stretch out probe mixes, 20 times of redilution are for subsequent use;
(2) mixing total amount at 96 orifice plates is the solution of 30 μ l: 0.025 μ M staple chain: 22 μ l; The M3mp18:1 μ l of 1/2 concentration; 1 * TAE-Mg2+buffer:7 μ l.
3. the controlled distribution method of nano particle according to claim 1 on DNA paper folding chip is characterized in that, described colloidal gold probe, and its preparation method:
1. oligonucleotide adds in the 10mM phosphoric acid buffer with 5nm particle diameter Radioactive colloidal gold molar concentration rate 200 to 1, and room temperature 300rpm shook 24 hours;
2. add final concentration 0.1M NaCl, room temperature 300rpm shook 48 hours;
3. 4 ℃, centrifugal 10 minutes of 15000rpm abandons supernatant;
4. add the 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice;
5. add 1 * TE; 10mM Tris-HCl, 1mM EDTA, pH=8.0,4 ℃ of preservations;
6. 5nm particle diameter colloidal gold probe concentration utilizes 520nm length ultraviolet absorption peak to measure.
4. the controlled distribution method of nano particle according to claim 1 on DNA paper folding chip is characterized in that, described hybridization refers to: 5nm particle diameter colloidal gold probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths were hybridized 1 hour.
5. the controlled distribution method of nano particle according to claim 1 on DNA paper folding chip, it is characterized in that, described connection refers to: 5nm particle diameter colloidal gold probe mixes with asymmetric X-Y scheme DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths were hybridized 1 hour.
6. the controlled distribution method of nano particle according to claim 1 on DNA paper folding chip, it is characterized in that, described atomic force microscope imaging refers to: absorption 2-5 μ l sample drips to newly cuts the cloud surface, adsorbs and can take imaging under the atomic force microscope after 2 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210362900.1A CN103014145B (en) | 2010-10-12 | 2010-10-12 | Controllable distribution method of gold nanoparticles on DNA origami chip |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210362900.1A CN103014145B (en) | 2010-10-12 | 2010-10-12 | Controllable distribution method of gold nanoparticles on DNA origami chip |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105030804A Division CN101948927A (en) | 2010-10-12 | 2010-10-12 | Controllable distribution method of gold nanoparticles on DNA origami chip |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103014145A true CN103014145A (en) | 2013-04-03 |
| CN103014145B CN103014145B (en) | 2014-06-11 |
Family
ID=47963259
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210362900.1A Expired - Fee Related CN103014145B (en) | 2010-10-12 | 2010-10-12 | Controllable distribution method of gold nanoparticles on DNA origami chip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103014145B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103760209A (en) * | 2014-01-27 | 2014-04-30 | 中国科学院电子学研究所 | Multi-parameter paper-chip electrochemical immunosensor and method for detecting lung cancer markers |
| CN107055465A (en) * | 2016-11-10 | 2017-08-18 | 中国科学院上海应用物理研究所 | A kind of preparation method of the metal nano circuit pattern based on DNA nanostructure |
| CN107437003A (en) * | 2017-07-17 | 2017-12-05 | 北京大学 | A kind of probe machine implementation method calculated based on DNA and device |
| CN109112123A (en) * | 2018-07-18 | 2019-01-01 | 南京邮电大学 | The specific method of modifying of nanogold cube |
| CN109477096A (en) * | 2017-06-02 | 2019-03-15 | 清华大学 | DNA paper folding unit substep construction from part |
| CN109557341A (en) * | 2018-11-22 | 2019-04-02 | 中国科学院上海应用物理研究所 | A kind of accurate high-throughput single molecule force spectroscopy method |
| CN114669739A (en) * | 2022-03-27 | 2022-06-28 | 南京大学 | Method for controllable growth of metal nanoparticles wrapped by DNA origami frame |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101050228A (en) * | 2007-03-22 | 2007-10-10 | 上海交通大学 | Method for constructing complicated Nano form by suing DNA molecule |
-
2010
- 2010-10-12 CN CN201210362900.1A patent/CN103014145B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101050228A (en) * | 2007-03-22 | 2007-10-10 | 上海交通大学 | Method for constructing complicated Nano form by suing DNA molecule |
Non-Patent Citations (2)
| Title |
|---|
| 张钊: "新型DNA折纸芯片系统的开发与研究", 《中国博士学位论文全文数据库》 * |
| 钱璐璐: "DNA自组装在分子计算和纳米技术等方面应用的研究", 《中国博士学位论文全文数据库》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103760209A (en) * | 2014-01-27 | 2014-04-30 | 中国科学院电子学研究所 | Multi-parameter paper-chip electrochemical immunosensor and method for detecting lung cancer markers |
| CN107055465A (en) * | 2016-11-10 | 2017-08-18 | 中国科学院上海应用物理研究所 | A kind of preparation method of the metal nano circuit pattern based on DNA nanostructure |
| CN107055465B (en) * | 2016-11-10 | 2019-04-19 | 中国科学院上海应用物理研究所 | A kind of preparation method of the metal nano circuit pattern based on DNA nanostructure |
| CN109477096A (en) * | 2017-06-02 | 2019-03-15 | 清华大学 | DNA paper folding unit substep construction from part |
| CN107437003A (en) * | 2017-07-17 | 2017-12-05 | 北京大学 | A kind of probe machine implementation method calculated based on DNA and device |
| CN109112123A (en) * | 2018-07-18 | 2019-01-01 | 南京邮电大学 | The specific method of modifying of nanogold cube |
| CN109557341A (en) * | 2018-11-22 | 2019-04-02 | 中国科学院上海应用物理研究所 | A kind of accurate high-throughput single molecule force spectroscopy method |
| CN109557341B (en) * | 2018-11-22 | 2021-05-18 | 中国科学院上海应用物理研究所 | High-throughput single-molecule force spectrum method |
| CN114669739A (en) * | 2022-03-27 | 2022-06-28 | 南京大学 | Method for controllable growth of metal nanoparticles wrapped by DNA origami frame |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103014145B (en) | 2014-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101948927A (en) | Controllable distribution method of gold nanoparticles on DNA origami chip | |
| CN103014145B (en) | Controllable distribution method of gold nanoparticles on DNA origami chip | |
| Takenaka et al. | Photoresponsive DNA nanocapsule having an open/close system for capture and release of nanomaterials | |
| Svigelj et al. | Deep eutectic solvents (DESs) and their application in biosensor development | |
| Tabet et al. | Adverse effects of industrial multiwalled carbon nanotubes on human pulmonary cells | |
| Meng et al. | Advanced technology for functionalization of carbon nanotubes | |
| Moore et al. | Individually suspended single-walled carbon nanotubes in various surfactants | |
| Becerril et al. | DNA-templated nanofabrication | |
| Reiss et al. | Biological routes to metal alloy ferromagnetic nanostructures | |
| Li et al. | DNA-directed self-assembling of carbon nanotubes | |
| Hu et al. | Imaging of Single Extended DNA Molecules on Flat (Aminopropyl) triethoxysilane− Mica by Atomic Force Microscopy | |
| US11121176B2 (en) | Nearly 2D electronic microparticles | |
| Zhang et al. | The formation of magnetite nanoparticles on the sidewalls of multi-walled carbon nanotubes | |
| CN102559891B (en) | Method related to DNA (Deoxyribose Nucleic Acid) folded paper and structure and application thereof | |
| Lu et al. | CdS quantum dots as a fluorescent sensing platform for nucleic acid detection | |
| CN102936755B (en) | Preparation method of monomolecular nucleic acid chip | |
| CN104059976B (en) | The preparation method and applications of non-sulfydryl nucleic acid-nanometer gold conjugate | |
| CN111974985B (en) | Nano particle cluster assembling method using micro magnetic beads as growth template and DNA frame as guide carrier | |
| CN101956015B (en) | Method for detecting polymorphism of single nucleotide with gold nanoparticles | |
| CN103014146B (en) | Controllable distribution method of gold nanoparticles on DNA origami chip | |
| Chen et al. | Binary hairy nanoparticles: Recent progress in theory and simulations | |
| Amoroso et al. | DNA-powered stimuli-responsive single-walled carbon nanotube junctions | |
| Sánchez-Pomales et al. | DNA-wrapped carbon nanotubes: from synthesis to applications | |
| Pan et al. | Nanomaterials-based polymerase chain reactions for DNA detection | |
| He et al. | DNA-modified carbon nanotubes for self-assembling and biosensing applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140611 Termination date: 20161012 |