CN103014146B - Controllable distribution method of gold nanoparticles on DNA origami chip - Google Patents
Controllable distribution method of gold nanoparticles on DNA origami chip Download PDFInfo
- Publication number
- CN103014146B CN103014146B CN201210362952.9A CN201210362952A CN103014146B CN 103014146 B CN103014146 B CN 103014146B CN 201210362952 A CN201210362952 A CN 201210362952A CN 103014146 B CN103014146 B CN 103014146B
- Authority
- CN
- China
- Prior art keywords
- probe
- colloidal gold
- dna
- paper folding
- chip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a controllable distribution method of nanoparticles on a DNA origami chip, comprising the following steps of: firstly, constructing an asymmetrical two-dimensional graph by utilizing a DNA origami technique to prepare the DNA origami chip; secondly, preparing a colloidal gold probe; thirdly, hybridizing a DNA short chain with the colloidal gold probe; fourthly, connecting a grain size colloidal gold probe with an asymmetrical two-dimensional graphic DNA origami chip; and fifthly, imaging by virtue of an atomic force microscope, wherein one 10nt short chain is firstly hybridized and fixed on an oligonucleotide probe close to the bottom of a gold particle at the temperature of 50 DEG C before the colloidal gold probe is connected into a map. The controllable distribution method provided by the invention has broad application space in the subject areas of infinitesimal biochemical detection chip development, nanometer device development, nanoparticle basic property study and the like.
Description
The application is the divisional application of Chinese invention patent application " the controlled distribution method of nm gold particles on DNA paper folding chip ", and application number is 201010503080.4, and the applying date is on October 12nd, 2010.
Technical field
What the present invention relates to is a kind of location mode of field of nanometer technology, is particularly template based on asymmetric two-dimentional DNA paper folding art chip, builds the controlled distribution method of 5nm nano particle on DNA paper folding chip.
Background technology
Nanometer gold (nanogold) refers to golden molecule, and its diameter is 1 one 100nm, is generally the colloidal solution that is dispersed in water formation, therefore claim again Radioactive colloidal gold.Certain chemical substance in nm gold particles surface adsorption, monomer nm gold particles is highly stable.Golden nanometer particle electron density is high, has quantum size effect, and small volume effect and surface effects can be passed through the multiple action modes such as electrostatic attraction, hydrophobic effect and be combined with macromole and form stable colloidal gold probe.Over more than 40 year, nm gold particles has been widely used in the biotechnology such as immunocytochemistry and biomarker in the past.
2006, the Rothemund of California Institute of Technology proposed, designs and realized DNA paper folding art.[RothemundPw.Nature2006，440，297)。Rothemund has folded six kinds of figures in initial article, although differ from one another, is not difficult to find that they are all symmetric figures.The DNA paper folding art nanometer gold of arranging can be divided three classes substantially according to the different of methods: the first kind is oligonucleotide hybridization assay.On nm gold particles, modify certain oligonucleotide chain (actual gold goal surface can connect a lot of chains), then it is added in paper folding art figure, owing to can stretching out on staple chain and the probe of this oligonucleotide chain complementation, so gold goal will be attached to [L on the specific position of figure by the hybridization of nucleic acid chains.JD，PintoY，SeelllanNc，et al.Nano LetterS 2004，4，2343]。Equations of The Second Kind is direct-assembling method.Since nanometer gold can be combined with DNA, so just likely allow it participate in paper folding art figure self assembling process directly, when self-assembly completes, also these micromolecular arranging [SharmaJ, ChhabraR, Andersen CS have just been formed, et al.J Am Chem Soc 2008,130,7820].The 3rd class is additive method.Other methods that connect nanometer gold also have a lot, such as the molecule photolithography (molecular lithography) (DengZ, Mao C.Angew Chem Int Ed Engl2004,43,4068) of Chengde Mao group exploitation, etc.
Open source literature has been recorded Zhang Zhao etc. and on advanced material, has been delivered space by name addressable and exempt from the asymmetric DNA paper folding of the liquid phase chip article of index to disclose DNA paper folding chip staple chain-ordering table [zhaoz, Yingw, et al.AdyMater 2010, 22, 1], the asymmetric two-dimentional DNA paper folding art of the imitative map of China shape of this article utilization is template, in template, design and draw specific oligonucleotide sequence as connection site, by with the biotin-avidin systematic cross combination of having modified complementary sequence DNA short chain, nanoparticle is attached on paper folding chip, simultaneously, also the binding site of nanoparticle is compared.
Summary of the invention
The object of the invention is to overcome deficiency of the prior art, the controlled distribution method of a kind of nano particle on DNA paper folding chip is provided.The present invention adopts the DNA paper folding chip staple chain-ordering table that prior art is identical, and direction is to be from left to right 5 ' one 3 '.But, in the present invention, in template, design the position of binding site and stretch out specific oligonucleotide sequence in the time of preparation DNA paper folding chip, band need be stretched out to the staple chain of oligonucleotide capture probe and replace the staple chain of same sequence number in list.The present invention, by the method for utilizing oligonucleotide sequence to modify and hybridize, connects 5nm particle diameter colloid gold particle, thereby realizes the controlled distribution of nano particle on DNA paper folding chip in the nanometer paper folding art structure of imitative map of China shape.
The present invention realizes by following three kinds of technical schemes:
Technical scheme one
Technical scheme one comprises that step is as follows:
The first step, utilizes an asymmetric X-Y scheme of DNA paper folding art structure, preparation DNA paper folding chip;
Described asymmetric X-Y scheme, stretches out oligonucleotide capture probe at the staple chain end of specific position, allows the object chain of it and end modified 5nm particle diameter colloid gold particle hybridize one to one.
Described asymmetric X-Y scheme is the single stranded DNA that relies on M13mp18 phage, reaches the folding formation of 7249 base scaffolding long-chain raster filling formulas, and figure is from 229 short staple chains for binding.
The preparation method of described DNA paper folding chip:
(1) all 100 μ M staple chains of using, comprise that forming equal-volume asymmetric X-Y scheme, that stretch out probe mixes, 20 times of redilution are for subsequent use;
It is 9 that staple chain stretches out oligonucleotide capture probe sequence number.
(2) on 96 orifice plates, mix the solution that total amount is 30 μ l: 0.025 μ M staple chain: 22 μ l; The M13mp18:1 μ l of 1/2 concentration; 1 × TAE-Mg2+buffer:7 μ l.
Second step, prepares colloidal gold probe;
Colloidal gold probe preparation method described in second step:
1. oligonucleotide adds in 10mM phosphoric acid buffer with 5nm particle diameter Radioactive colloidal gold molar concentration rate 200 to 1, and room temperature 300rpm shakes 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shakes 48 hours.
3. 4 ℃, centrifugal 10 minutes of 15000rpm, abandons supernatant.
4. add 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE; 10mM Tris-HCl, 1mM EDTA, pH=8.0,4 ℃ of preservations.
6. 5nm particle diameter colloidal gold probe concentration utilizes 520nm length ultraviolet absorption peak to measure.
The 3rd step, particle diameter colloidal gold probe is connected with asymmetric X-Y scheme DNA paper folding chip;
Connection described in the 3rd step refers to: 5nm particle diameter colloidal gold probe mixes with asymmetric X-Y scheme DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths are hybridized 1 hour.
The 4th step, atomic force microscope imaging;
The step of the atomic force microscope imaging described in the 4th step: draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and can take imaging under atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping that use.
Atomic force microscope imaging results shows, adopts method described in technical scheme one, and nm gold particles joint efficiency on DNA paper folding art figure can reach 10% left and right.
Technical scheme two
Consider that the oligonucleotide probe being connected on gold size particle exists the active temperature threshold value (meltingtemperature) of about 50 ℃, lost the ability most of and link of capture probe chain lower than this temperature oligonucleotide probe is adsorbed on gold size particle surface, result causes joint efficiency very low.When hybridization temperature is during higher than 50 ℃, imitative map of China paper folding figure there will be localized heat degraded and irregular connection, loses original pattern.So hybridization is fixed near on the oligonucleotide probe of gold grain bottom, affects joint efficiency to avoid oligonucleotide probe to be adsorbed on gold size particle surface.
Technical scheme two comprises that step is as follows:
The first step, utilizes an asymmetric X-Y scheme of DNA paper folding art structure, preparation DNA paper folding chip;
Described asymmetric X-Y scheme is the single stranded DNA that relies on M13mp18 phage, reaches the folding formation of 7249 base scaffolding long-chain raster filling formulas, and figure is from 229 short staple chains for binding.
The preparation method of described DNA paper folding chip:
(1) all 100 μ M staple chains of using, comprise that forming equal-volume asymmetric X-Y scheme, that stretch out probe mixes, 20 times of redilution are for subsequent use;
It is 9 that staple chain stretches out oligonucleotide capture probe sequence number.
(2) on 96 orifice plates, mix the solution that total amount is 30 μ l: 0.025 μ M staple chain: 22 μ l; The M13mp18:1 μ l of 1/2 concentration; 1 × TAE-Mg2+buffer:7 μ l.
Second step, prepares colloidal gold probe;
Described colloidal gold probe, before colloidal gold probe is connected into map, first by a 10nt short chain, in the time of 50 ℃, hybridization is fixed near on the oligonucleotide probe of gold grain bottom.
Described colloidal gold probe preparation method comprises the following steps:
1. oligonucleotide adds in 10mM phosphoric acid buffer with 5nm particle diameter Radioactive colloidal gold molar concentration rate 200 to 1, and room temperature 300rpm shakes 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shakes 48 hours.
3. 4 ℃, centrifugal 10 minutes of 15000rpm, abandons supernatant.
4. add 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE; 10mM Tris-HCl, 1mM EDTA, pH=8.0,4 ℃ of preservations.
6. 5nm particle diameter colloidal gold probe concentration utilizes 520nm length ultraviolet absorption peak to measure.
The 3rd step, DNA short chain and colloidal gold probe hybridization;
Hybridization described in the 3rd step refers to: 5nm particle diameter colloidal gold probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths are hybridized 1 hour.
The 4th step, particle diameter colloidal gold probe is connected with asymmetric X-Y scheme DNA paper folding chip;
Connection described in the 4th step refers to: 5nm particle diameter colloidal gold probe mixes with asymmetric X-Y scheme DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths are hybridized 1 hour.
The 5th step, atomic force microscope imaging;
The step of the atomic force microscope imaging described in the 5th step: draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and can take imaging under atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping that use.
Atomic force microscope imaging results shows, adopts method described in technical scheme two, and nm gold particles joint efficiency on DNA paper folding art figure is slightly improved, and can reach 15% left and right.
Technical scheme three
Technical scheme three comprises that step is as follows:
The first step, utilizes an asymmetric X-Y scheme of DNA paper folding art structure, preparation DNA paper folding chip;
Described asymmetric X-Y scheme stretches out three staple chain end modified oligonucleotide capture probes near specific position, allows the reporter probe chain three of they and same end modified 5nm particle diameter colloid gold particle to a hybridization.
Described asymmetric X-Y scheme is the single stranded DNA that relies on M13mp18 phage, reaches the folding formation of 7249 base scaffolding long-chain raster filling formulas, and figure is from 229 short staple chains for binding.
The preparation method of described DNA paper folding chip:
(1) all 100 μ M staple chains of using, comprise that forming equal-volume asymmetric X-Y scheme, that stretch out probe mixes, 20 times of redilution are for subsequent use;
It is 9,10,22 that staple chain stretches out oligonucleotide capture probe sequence number.
(2) on 96 orifice plates, mix the solution that total amount is 30 μ l: 0.025 μ M staple chain: 22 μ l; The M13mp18:1 μ l of 1/2 concentration; 1 × TAE-Mg2+buffer:7 μ l.
Second step, prepares colloidal gold probe;
Colloidal gold probe preparation method described in second step:
1. oligonucleotide adds in 10mM phosphoric acid buffer with 5nm particle diameter Radioactive colloidal gold molar concentration rate 200 to 1, and room temperature 300rpm shakes 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shakes 48 hours.
3. 4 ℃, centrifugal 10 minutes of 15000rpm, abandons supernatant.
4. add 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE; 10mM Tris-HCl, 1mM EDTA, pH=8.0,4 ℃ of preservations.
6. 5nm particle diameter colloidal gold probe concentration utilizes 520nm length ultraviolet absorption peak to measure.
The 3rd step, DNA short chain and colloidal gold probe hybridization;
Hybridization described in the 3rd step refers to: 5nm particle diameter colloidal gold probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths are hybridized 1 hour.
The 4th step, particle diameter colloidal gold probe is connected with asymmetric X-Y scheme DNA paper folding chip;
Connection described in the 4th step refers to: 5nm particle diameter colloidal gold probe mixes with asymmetric X-Y scheme DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths are hybridized 1 hour.
The 5th step, atomic force microscope imaging;
The step of the atomic force microscope imaging described in the 5th step: draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and can take imaging under atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping that use.
Near paper folding figure specific position, stretch out three staple chain end modified oligonucleotide capture probes, allow the reporter probe chain three of they and same end modified 5nm particle diameter colloid gold particle to a hybridization, association schemes two again, are effectively controlled gold grain locus and have strengthened the stability connecting simultaneously.Atomic force microscope imaging results shows, adopts method described in technical scheme three, and nm gold particles joint efficiency on DNA paper folding art figure obviously improves, and can reach more than 95%.
Embodiment
The present embodiment is implemented under take technical solution of the present invention as prerequisite, has provided detailed embodiment and process, but protection scope of the present invention is not limited to following embodiment.The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition, or the condition of advising according to manufacturer.
Embodiment 1
Testing conditions:
The present embodiment adopts DNA paper folding art to construct the shape of map of China, and atomic force microscope imaging results shows strong point approximately 150 nanometers of the map of China that obtains, and the widest part approximately 120 nanometers, are highly 2 nanometers.This figure is the folding formation that relies on scaffolding long-chain (single stranded DNA of M13mp18 phage reaches 7249 bases) raster filling formula, and map pattern is from 229 short staple chains for binding.The feature of this figure is that 229 staple chains are exactly more than 200 addressable potential reaction site, and any point on masterplate can utilize figure self as locating with reference to accurate, without index marker.In addition, any one in 229 short dna strands can be stretched out nucleotide sequence as capture probe and hybridize with the complementary nucleotide sequence of nanoparticle label, as the tie point of nano particle on paper folding figure.In the time utilizing this asymmetrical graphic to distribute for template forms nano dot, utilize template complicacy to reduce the complicacy requirement that nano dot is distributed.Asymmetric X-Y scheme described in the present embodiment, stretches out oligonucleotide capture probe at the staple chain end of specific position, allows the object chain of it and end modified 5nm particle diameter colloid gold particle hybridize one to one.
The present embodiment is take map of China as chip base, all staple chains, comprise form map, stretch out probe, all order (PAGE purifying) from Shanghai JaRa company, and unified to be diluted to 100 μ M with intermediate water for subsequent use.Scaffolding chain uses the M13mp18 virus strand of NEB company, article No. N4040S.7249base altogether, concentration is 0.25 μ g/ μ l, total 5 μ g.Due to 1 μ g ≈ 0.42pmol, therefore the about 0.1pM/ μ of concentration l=0.1 μ M.Actual 1/2 concentration that is diluted to is used.Cut processing without enzyme, retaining ring chain state.5nm particle diameter colloid gold particle uses Sigma company, article No. G1402.Use identical reaction buffer and imaging buffer: at 1 × TAE (Tris, 40mM; Acetic acid, 20mM; EDTA, 2mM) in add magnesium acetate powder, Mg2+ final concentration is 12.5mM, pH8.0.Use multiple-pattern atomic force microscope (Multimode AFM) observation of Veeco/Digital Instruments company of the U.S..J-scanner, NP-S needle point, resonant frequency is between 7-10kHz.
The controlled distribution implementation step of the nano particle of the present embodiment is as follows:
First: the imitative map of China shape DNA paper folding chip of preparation
1. all staple chains of using (100 μ M) are comprised to forming equal-volume map, that stretch out probe mixes, 20 times of redilution are for subsequent use.It is 9 that staple chain stretches out oligonucleotide capture probe sequence number.
On 96 orifice plates according to following system mixing solutions: (being the system of " saving " below, can entirety when actual doing double, or separately double scaffolding chain)
Staple chain (0.025 μ M) 22 μ l
M13mp18 (1/2 concentration) 1 μ l
1×TAE-Mg2+buffer 7μl
Total 30μl
3. be placed on the upper annealing of PCR instrument (ABI 9700), 95 ℃ are cooled to 20 ℃, 0.1 ℃/10s=0.6 ℃/min=1 ℃/100s.
Second: preparation 5nm particle diameter colloidal gold probe
1. oligonucleotide adds in 10mM phosphoric acid buffer with 5nm particle diameter colloid gold particle molar concentration rate 200 to 1, and room temperature 300rpm shakes 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shakes 48 hours.
3.4 ℃, centrifugal 10 minutes of 15000rpm, abandons supernatant.
4. add 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE (10mM Tris-HCl, 1mM EDTA, pH=8.0), 4 ℃ of preservations.
6.5nm particle diameter colloid gold particle concentration and probe concentration utilizes 0D260 to measure.
The the 3rd: 5nm particle diameter colloid gold particle probe is connected with imitative map of China shape DNA paper folding chip
5nm particle diameter colloid gold particle probe mixes with imitative map of China shape DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths are hybridized 1 hour.
The the 4th: atomic force microscope imaging
Draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and can take imaging under atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping that use.
The demonstration of atomic force microscope imaging results, the present embodiment nm gold particles joint efficiency on DNA paper folding art figure can reach 10% left and right.
Embodiment 2
Testing conditions:
The present embodiment adopts DNA paper folding art to construct the shape of map of China, and atomic force microscope imaging results shows strong point approximately 150 nanometers of the map of China that obtains, and the widest part approximately 120 nanometers, are highly 2 nanometers.This figure is the folding formation that relies on scaffolding long-chain (single stranded DNA of M13mp18 phage reaches 7249 bases) raster filling formula, and map pattern is from 229 short staple chains for binding.The feature of this figure is that 229 staple chains are exactly more than 200 addressable potential reaction site, and any point on masterplate can utilize figure self as locating with reference to accurate, without index marker.In addition, any one in 229 short dna strands can be stretched out nucleotide sequence as capture probe and hybridize with the complementary nucleotide sequence of nanoparticle label, as the tie point of nano particle on paper folding figure.In the time utilizing this asymmetrical graphic to distribute for template forms nano dot, utilize template complicacy to reduce the complicacy requirement that nano dot is distributed.In the present embodiment, consider that the oligonucleotide probe being connected on gold size particle exists the active temperature threshold value of about 50 ℃ (melting temperature), lost the ability most of and link of capture probe chain lower than this temperature oligonucleotide probe is adsorbed on gold size particle surface, result causes joint efficiency very low.When hybridization temperature is during higher than 50 ℃, imitative map of China paper folding figure there will be localized heat degraded and irregular connection, loses original pattern.So hybridization is fixed near on the oligonucleotide probe of gold grain bottom, affects joint efficiency to avoid oligonucleotide probe to be adsorbed on gold size particle surface.
The present embodiment is take map of China as chip base, all staple chains, comprise form map, stretch out probe, all order (PAGE purifying) from Shanghai JaRa company, and unified to be diluted to 100 μ M with intermediate water for subsequent use.Scaffolding chain uses the M13mp18 virus strand of NEB company, article No. N4040S.7249base altogether, concentration is 0.25 μ g/ μ l, total 5 μ g.Due to 1 μ g ≈ 0.42pmol, therefore the about 0.1pM/ μ of concentration l=0.1 μ M.Actual 1/2 concentration that is diluted to is used.Cut processing without enzyme, retaining ring chain state.5nm particle diameter colloid gold particle uses Sigma company, article No. G1402.Use identical reaction buffer and imaging buffer: at 1 × TAE (Tris, 40mM; Acetic acid, 20mM; EDTA, 2mM) in add magnesium acetate powder, Mg2+ final concentration is 12.5mM, pH8.0.Use multiple-pattern atomic force microscope (Multimode AFM) observation of Veeco/Digital Instruments company of the U.S..J-scanner, NP-S needle point, resonant frequency is between 7-10kHz.
The controlled distribution implementation step of the nano particle of the present embodiment is as follows:
First: the imitative map of China shape DNA paper folding chip of preparation
1. all staple chains of using (100 μ M) are comprised to forming equal-volume map, that stretch out probe mixes, 20 times of redilution are for subsequent use.It is 9 that staple chain stretches out oligonucleotide capture probe sequence number.
On 96 orifice plates according to following system mixing solutions: (being the system of " saving " below, can entirety when actual doing double, or separately double scaffolding chain)
Staple chain (0.025 μ M) 22 μ l
M13mp18 (1/2 concentration) 1 μ l
1×TAE-Mg2+buffer 7μl
Total 30μl
3. be placed on the upper annealing of PCR instrument (ABI 9700), 95 ℃ are cooled to 20 ℃, 0.1 ℃/10s=0.6 ℃/min=1 ℃/100s.
Second: preparation 5nm particle diameter colloidal gold probe
1. oligonucleotide adds in 10mM phosphoric acid buffer with 5nm particle diameter colloid gold particle molar concentration rate 200 to 1, and room temperature 300rpm shakes 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shakes 48 hours.
3.4 ℃, centrifugal 10 minutes of 15000rpm, abandons supernatant.
4. add 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE (10mM Tris-HCl, 1mM EDTA, pH=8.0), 4 ℃ of preservations.
6.5nm particle diameter colloid gold particle concentration and probe concentration utilizes 0D260 to measure.
The the 3rd: 10nt DNA short chain and 5nm particle diameter colloid gold particle probe hybridization
5nm particle diameter colloid gold particle probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths are hybridized 1 hour.
The the 4th: 5nm particle diameter colloid gold particle probe is connected with imitative map of China shape DNA paper folding chip
5nm particle diameter colloid gold particle probe mixes with imitative map of China shape DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths are hybridized 1 hour.
The the 5th: atomic force microscope imaging
Draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and can take imaging under atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping that use.
The demonstration of atomic force microscope imaging results, the present embodiment nm gold particles joint efficiency on DNA paper folding art figure is slightly improved, and can reach 15% left and right.
Embodiment 3
Testing conditions:
The present embodiment adopts DNA paper folding art to construct the shape of map of China, and atomic force microscope imaging results shows strong point approximately 150 nanometers of the map of China that obtains, and the widest part approximately 120 nanometers, are highly 2 nanometers.This figure is the folding formation that relies on scaffolding long-chain (single stranded DNA of M13mp18 phage reaches 7249 bases) raster filling formula, and map pattern is from 229 short staple chains for binding.The feature of this figure is that 229 staple chains are exactly more than 200 addressable potential reaction site, and any point on masterplate can utilize figure self as locating with reference to accurate, without index marker.In addition, any one in 229 short dna strands can be stretched out nucleotide sequence as capture probe and hybridize with the complementary nucleotide sequence of nanoparticle label, as the tie point of nano particle on paper folding figure.In the time utilizing this asymmetrical graphic to distribute for template forms nano dot, utilize template complicacy to reduce the complicacy requirement that nano dot is distributed.In the present embodiment, near paper folding figure specific position, stretch out three staple chain end modified oligonucleotide capture probes, allow the reporter probe chain three of they and same end modified 5nm particle diameter colloid gold particle to a hybridization, association schemes two again, are effectively controlled gold grain locus and have strengthened the stability connecting simultaneously.
The present embodiment is take map of China as chip base, all staple chains, comprise form map, stretch out probe, all order (PAGE purifying) from Shanghai JaRa company, and unified to be diluted to 100 μ M with intermediate water for subsequent use.Scaffolding chain uses the M13mp18 virus strand of NEB company, article No. N4040S.7249base altogether, concentration is 0.25 μ g/ μ l, total 5 μ g.Due to 1 μ g ≈ 0.42pmol, therefore the about 0.1pM/ μ of concentration l=0.1 μ M.Actual 1/2 concentration that is diluted to is used.Cut processing without enzyme, retaining ring chain state.5nm particle diameter colloid gold particle uses Sigma company, article No. G1402.Use identical reaction buffer and imaging buffer: at 1 × TAE (Tris, 40mM; Acetic acid, 20mM; EDTA, 2mM) in add magnesium acetate powder, Mg2+ final concentration is 12.5mM, pH8.0.Use multiple-pattern atomic force microscope (Multimode AFM) observation of Veeco/Digital Instruments company of the U.S..J-scanner, NP-S needle point, resonant frequency is between 7-10kHz.
The controlled distribution implementation step of the nano particle of the present embodiment is as follows:
First: the imitative map of China shape DNA paper folding chip of preparation
1. all staple chains of using (100 μ M) are comprised to forming equal-volume map, that stretch out probe mixes, 20 times of redilution are for subsequent use.It is 9,10,22 that staple chain stretches out oligonucleotide capture probe sequence number.
On 96 orifice plates according to following system mixing solutions: (being the system of " saving " below, can entirety when actual doing double, or separately double scaffolding chain)
Staple chain (0.025 μ M) 22 μ l
M13mp18 (1/2 concentration) 1 μ l
1×TAE-Mg2+buffer 7μl
Total 30μl
3. be placed on the upper annealing of PCR instrument (ABI 9700), 95 ℃ are cooled to 20 ℃, 0.1 ℃/10s=0.6 ℃/min=1 ℃/100s.
Second: preparation 5nm particle diameter colloidal gold probe
1. oligonucleotide adds in 10mM phosphoric acid buffer with 5nm particle diameter colloid gold particle molar concentration rate 200 to 1, and room temperature 300rpm shakes 24 hours.
2. add final concentration 0.1M NaCl, room temperature 300rpm shakes 48 hours.
3.4 ℃, centrifugal 10 minutes of 15000rpm, abandons supernatant.
4. add 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice.
5. add 1xTE (10mM Tris-HCl, 1mM EDTA, pH=8.0), 4 ℃ of preservations.
6.5nm particle diameter colloid gold particle concentration and probe concentration utilizes 0D260 to measure.
The the 3rd: 10nt DNA short chain and 5nm particle diameter colloid gold particle probe hybridization
5nm particle diameter colloid gold particle probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths are hybridized 1 hour.
The the 4th: 5nm particle diameter colloid gold particle probe is connected with imitative map of China shape DNA paper folding chip
5nm particle diameter colloid gold particle probe mixes with imitative map of China shape DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths are hybridized 1 hour.
The the 5th: atomic force microscope imaging
Draw 2.5 μ l samples (actual 2-5 μ l all can) and drip to and newly cut mica surface, adsorb and can take imaging under atomic force microscope after 2 minutes.The unified pattern, liquid phase imaging of rapping that use.
The demonstration of atomic force microscope imaging results, the present embodiment nm gold particles joint efficiency on DNA paper folding art figure obviously improves, and can reach more than 95%.
DNA paper folding chip staple chain stretches out oligonucleotide capture probe sequence, and (stretched part is staple chain as follows, italicized item is to stretch out oligonucleotide capture probe, be from left to right 5 '-3 ', when preparation DNA paper folding chip, replace same sequence number staple chain):
9CGCCTAGTTGGACGGCGACACAGGAGGTAGTGCCGTCGAGAGGG (for technical scheme one, two, three)
10CGCCTAGTTGGACGGCGACACAGTACCAGGCGGATATTAGCGGG (for technical scheme three)
22CGCCTAGTTGGACGGCGACAGTTTTGCTAAGAGAAGGATTAGGAGAGGCTGA (for technical scheme three)
10nt DNA short chain sequence (being from left to right 5 '-3 ')
CGCCTAGTTG
Mercapto groups is modified reporter probe sequence (being from left to right 5 '-3 ')
TGTCGCCGTCCAACTAGGCG-SH
The atomic force microscope imaging results of above embodiment shows respectively: nm gold particles joint efficiency on DNA paper folding art figure can reach 10%-15%, and high energy reaches more than 95%.
Claims (1)
1. the controlled distribution method of nano particle on DNA paper folding chip, is characterized in that, comprises the steps:
The first step, utilizes an asymmetric X-Y scheme of DNA paper folding art structure, preparation DNA paper folding chip,
Second step, prepares colloidal gold probe,
The 3rd step, DNA short chain and colloidal gold probe hybridization,
The 4th step, particle diameter colloidal gold probe is connected with asymmetric X-Y scheme DNA paper folding chip,
The 5th step, atomic force microscope imaging,
Described colloidal gold probe, before colloidal gold probe is connected into map, first by a 10nt short chain, in the time of 50 ℃, hybridization is fixed near on the oligonucleotide probe of gold grain bottom;
Described DNA paper folding chip, its preparation method is as follows:
(1) all 100 μ M staple chains of using, comprise that forming equal-volume asymmetric X-Y scheme, that stretch out probe mixes, 20 times of redilution are for subsequent use;
(2) on 96 orifice plates, mix the solution that total amount is 30 μ l: 0.025 μ M staple chain: 22 μ l; The M13mp18:1 μ l of 1/2 concentration; 1 × TAE-Mg2+buffer:7 μ l;
Described colloidal gold probe, its preparation method is:
1. oligonucleotide adds in 10mM phosphoric acid buffer with 5nm particle diameter Radioactive colloidal gold molar concentration rate 200 to 1, and room temperature 300rpm shakes 24 hours;
2. add final concentration 0.1M NaCl, room temperature 300rpm shakes 48 hours;
3. 4 ℃, centrifugal 10 minutes of 15000rpm, abandons supernatant;
4. add 10mM phosphoric acid buffer, final concentration 0.1M NaCl cleans twice;
5. add 1 × TE; 10mM Tris-HCl, 1mM EDTA, pH=8.0,4 ℃ of preservations;
6. 5nm particle diameter colloidal gold probe concentration utilizes 520nm length ultraviolet absorption peak to measure;
Described hybridization refers to: 5nm particle diameter colloidal gold probe mixes with 10nt DNA short chain molar concentration rate 1 to 1, and 50 ℃ of water-baths are hybridized 1 hour;
Described connection refers to: 5nm particle diameter colloidal gold probe mixes with asymmetric X-Y scheme DNA paper folding chip molar concentration rate 2 to 1, and 37 ℃ of water-baths are hybridized 1 hour;
Described atomic force microscope imaging refers to: absorption 2-5 μ l sample drips to newly cuts mica surface, adsorbs and can take imaging under atomic force microscope after 2 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210362952.9A CN103014146B (en) | 2010-10-12 | 2010-10-12 | Controllable distribution method of gold nanoparticles on DNA origami chip |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210362952.9A CN103014146B (en) | 2010-10-12 | 2010-10-12 | Controllable distribution method of gold nanoparticles on DNA origami chip |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105030804A Division CN101948927A (en) | 2010-10-12 | 2010-10-12 | Controllable distribution method of gold nanoparticles on DNA origami chip |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103014146A CN103014146A (en) | 2013-04-03 |
| CN103014146B true CN103014146B (en) | 2014-05-21 |
Family
ID=47963260
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210362952.9A Expired - Fee Related CN103014146B (en) | 2010-10-12 | 2010-10-12 | Controllable distribution method of gold nanoparticles on DNA origami chip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103014146B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107055465B (en) * | 2016-11-10 | 2019-04-19 | 中国科学院上海应用物理研究所 | A kind of preparation method of the metal nano circuit pattern based on DNA nanostructure |
| CN113417009B (en) * | 2021-05-07 | 2022-04-05 | 南京大学 | Method for guiding nano particle superlattice by using DNA origami and DNA tiles |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101050228A (en) * | 2007-03-22 | 2007-10-10 | 上海交通大学 | Method for constructing complicated Nano form by suing DNA molecule |
-
2010
- 2010-10-12 CN CN201210362952.9A patent/CN103014146B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103014146A (en) | 2013-04-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103014145B (en) | Controllable distribution method of gold nanoparticles on DNA origami chip | |
| CN101948927A (en) | Controllable distribution method of gold nanoparticles on DNA origami chip | |
| Martins et al. | Femtomolar limit of detection with a magnetoresistive biochip | |
| Hu et al. | Imaging of Single Extended DNA Molecules on Flat (Aminopropyl) triethoxysilane− Mica by Atomic Force Microscopy | |
| Li et al. | DNA-directed self-assembling of carbon nanotubes | |
| Becerril et al. | DNA-templated nanofabrication | |
| Ma et al. | Magnetic nanoparticles-based extraction and verification of nucleic acids from different sources | |
| Zhang et al. | The formation of magnetite nanoparticles on the sidewalls of multi-walled carbon nanotubes | |
| CN102559891B (en) | Method related to DNA (Deoxyribose Nucleic Acid) folded paper and structure and application thereof | |
| Liu et al. | Label-free dsDNA-Cu NPs-based fluorescent probe for highly sensitive detection of L-histidine | |
| Lu et al. | CdS quantum dots as a fluorescent sensing platform for nucleic acid detection | |
| US20120141797A1 (en) | Zwitterion-Linker Coatings for Nano-objects in Solutions of Multivalent Counterions | |
| CN104059976B (en) | The preparation method and applications of non-sulfydryl nucleic acid-nanometer gold conjugate | |
| CN102936755A (en) | Preparation method of monomolecular nucleic acid chip | |
| CN103014146B (en) | Controllable distribution method of gold nanoparticles on DNA origami chip | |
| CN108025910A (en) | Programmable, the tool patch nano particle of self assembly and relevant apparatus, system and method | |
| CN101956015B (en) | Method for detecting polymorphism of single nucleotide with gold nanoparticles | |
| Liu et al. | Surface-functionalized silica-coated gold nanoparticles and their bioapplications | |
| Sánchez-Pomales et al. | DNA-wrapped carbon nanotubes: from synthesis to applications | |
| Wu et al. | Atomic force microscope investigation of large-circle DNA molecules | |
| Liu et al. | Atomic force microscopy imaging study of aligning DNA by dumbbell-like Au–Fe3O4 magnetic nanoparticles | |
| He et al. | DNA-modified carbon nanotubes for self-assembling and biosensing applications | |
| Gambhir et al. | pH-responsive glycine functionalized magnetic iron oxide nanoparticles for SARS-CoV-2 RNA extraction from clinical sample | |
| Chan et al. | In-vitro nanodiagnostic platform through nanoparticles and DNA-RNA nanotechnology | |
| JP2007290929A (en) | Nanostructure and method of manufacturing the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140521 Termination date: 20161012 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |