CN102994536A - Bicistronic mRNA coexpression gene transporter and preparation method thereof - Google Patents

Abstract

The invention relates to a bicistronic mRNA coexpression gene transporter and a preparation method thereof. The gene order of the gene transporter is SEQ ID No. 15; the gene transporter from 5' end to 3' end comprises bovine Nuclear matrix binding region MAR, artificially constructed combined promoter CAG, Profilin gene FSTN, internal ribosome entry site (IRES), green fluorescent protein AcGFP gene and Rabbit globin poly A signal region; the preparation method comprises the following steps: constructing a carrier pCAG-IRES2-AcGFP1; obtaining FSTN gene and inserting the pCAG-IRES2-AcGFP1 carrier; obtaining the sequence of MAR and inserting the pCAG-IRES2-AcGFP1 carrier; constructing a plasmid carriers so as to obtain the bicistronic mRNA coexpression gene transporter. The gene transporter is not only pure and safe gene transporter but also realizes dual-gene coexpression in any combination, achieves the purpose of multi-gene coexpression through repeated utilization of IRES, and provides new thinking and route for improving the shape of dual or multiple gene control such as economic character.

Description

The bicistronic mRNA co-expression gene shifts body and preparation method

Technical field

The invention belongs to the genetic engineering technique in the biological technical field, be specifically related to the preparation method that a kind of bicistronic mRNA co-expression gene shifts body.

Background technology

Efficiently expressing of foreign gene must rely on good expression vector in transgenic animal.It is a lot of to affect exogenous gene high-efficient expressed factor, such as promotor, methylate, this body structure of gene, insertion point, regulating and controlling sequence (enhanser, insulator, nuclear matrix land) etc.

The CAG promotor is artificial constructed combination promotor, by cytomegalovirus (the cytomegalovirus, CMV) early stage enhanser (early enhancer element) and avian beta-actin (chicken beta-actin) promotor form, the CAG promotor is nonspecific constitutive promoter, is used for driving gene at the high level expression of Mammals carrier.CMV is the promotor of commonly using, and in the application of our transgenic sheep, finds to methylate in the transgenosis individuality, causes genetically modified silence.

Nuclear matrix land (MARs) be in the eukaryote chromatin with the section of DNA sequence of nuclear matrix or nuclear skeleton specific combination.MARs participates in the multiple nuclear biological processes such as dna replication dna regulation and control and transcriptional control.

The length of MA Rs is generally 300 1 1000bp, what also have reaches several kb, keeping its active minimum length is 300bp approximately, MARs is non-coding sequence, AT content is up to 70%, different MARs sequences is different, but often contain similar structural motif, the essential characteristic of MARs sequence as discovery TM2 sequence possesses in the tobacco: its sequence total length 1001bp, AT content is 62.8%, contain a typical T-box on the sequence, two potential DNA untwist sequence (AATATT) and a potential topoisomerase II binding site (CTTTATATTGTTGAC).

Studies show that, the function of MARs sequence comprises that the component, chromosome structure anabolic action, MARS of boundary factor (boundarye lement) effect, chromatin regulating effect, the initial son of dna replication dna are to the regulating and controlling effect of transgene expression, in view of the relation between MARs and genetic expression, especially it can strengthen significantly transgene expression, overcomes position effect, eliminate transgene silencing, and it has been used as a kind of cis-regulating element and has been applied in the transgenic technology.

FSTN, full name has another name called the FSH arrestin follistatin (Follistatin, FST), is a kind of strand glycoprotein, is to separate from the liquor folliculi of ox and pig at first, thereby is known as Gonadostatin.Mode with paracrine or autocrine, many members with transforming growth factor-beta (TGF-β) superfamily, such as combinations such as Delicious peptide (BMP), muscle chalones (MSTN), wherein MSTN is the strongest Skeletal Muscle Growth inhibition known today.FST albumen can stick together with MSTN, blocks its inhibit feature, thereby promotes the growth of muscle.

The IRES sequence, internal ribosome entry site sequence, the synthetic translation initiation mode that relies on cap sequence that adopted of eukaryote most protein. but the protein synthesis of one group of RNA viruses that lacks cap sequence initial be to rely on its 5 ' end non-translational region (untranslated region, UTR), be internal ribosome entry site (IRES), this site is one section highly conserved sequence, can make before and after it gene under same promotor, transcribe a bicistronic mRNA, and make two genes translate into respectively two independently products when translating.Therefore, in the eukaryote transgene expression vector makes up, be usually used in being structured in two gene coded sequences of IRES connection under the promotor, realize the bicistronic mRNA coexpression.That can realize the bicistronic mRNA coexpression also has 1) .Fusion gene fusion 2) .cis trans Proteas is along anti-protease 3) Reintiation begins 4 again) promotor 6 in the middle of Splicing montage (design restriction enzyme site 5 between the gene) the .Internal Promoter) the sick viral 2A of brothers etc.

Utilize in recent years the expression casette (only comprising promotor, coding region and terminator) of removing the plasmid vector backbone sequences as the transgenosis body, be also referred to as cleaning DNA and transform (cleanDNAtransformation), mainly be by the via Particle Bombardment Transformation plant, application has succeeded in paddy rice, cotton, wheat, grape transform, utilize pollen tube pathway in muskmelon, also successfully to utilize rarely found structure and application in transgenic animal especially Mammals.

Summary of the invention

The object of the invention is to overcome the deficiencies in the prior art, provide a kind of bicistronic mRNA co-expression gene to shift the preparation method of body, provide to make two kinds of goal gene as the bicistronic high-efficiency coexpression, the selective markers such as plasmid-free carrier backbone sequences, non-resistant, shift body for the bicistronic mRNA co-expression gene of cleaning and security.

The present invention solves its technical problem and takes following technical scheme to realize:

A kind of bicistronic mRNA co-expression gene shifts body, and the gene order of transgenosis body is: SEQ ID NO:15.

And described transgenosis body plays 3 ＇ end from 5 ＇ end and only includes successively ox nuclear matrix land MAR, artificial constructed combination promotor CAG, arrestin gene FST N, internal ribosome entry site IRES, green fluorescent protein AcGFP gene, Rabbit globin polyA signaling zone.

And the sequence of described nuclear matrix land MAR is carried out PCR by following primer and is obtained:

MAR sequence before the CAG:

CMAF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.9;

CMAR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.10;

MAR sequence behind the PolyA:

PMF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.11;

PMR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.12.

And the sequence of described nuclear matrix land MAR is: SEQ ID No.13.

And the sequence of described arrestin gene FST N is carried out PCR by following primer and is obtained:

FMF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.7;

FMR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.8.

And the sequence of described arrestin gene FST N is: SEQ ID No.14.

A kind of bicistronic mRNA co-expression gene shifts the preparation method of body, and step is as follows:

The first step, transplant and replace pCMV-IRES2-AcGFP1 by the CAG promotor on the pCAGEN carrier, in CMV, simultaneously transplant and replace the SV40polyA among the pCMV-IRES2-AcGFP1 with Rabbit globin polyA on the pCAGEN carrier, carrier construction pCAG-IRES2-AcGFP1;

Second step, the acquisition of FSTN foreign gene and insertion pCAG-IRES2-AcGFP1 carrier;

The 3rd step, the acquisition of MAR sequence and insertion pCAG-IRES2-AcGFP1 carrier;

In the 4th step, after plasmid vector pMAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR structure is complete, with Sac I, Afl II double digestion, obtains MAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR bicistronic mRNA co-expression gene and shift body.

And, the described step the first step, further concrete steps comprise:

⑴ insert the T fragment, changes restriction enzyme site: obtain the T fragment from PMD19T-simple vector, by restriction enzyme site this fragment is connected into carrier, change the order of original restriction enzyme site on the carrier;

⑵ the insertion of CAG promotor: the CAG promotor is downcut from the pCAGEN carrier, be connected in the above-mentioned carrier;

⑶ acquisition and the insertion of Rabbit globin polyA: obtain Rabbit globin polyA sequence from the pCAGEN carrier, by two restriction enzyme sites the Rabbit globin polyA sequence that obtains is inserted among the carrier pIRES2-AcGFP1;

⑷ the excision of CMV promotor: the CMV promotor is excised from carrier pIRES2-AcGFP1;

⑸ the polishing pUC second half section: according to the gene order design primer of pUC, obtain the second half section of pUC sequence by the PCR reaction, by two 0000000000 restriction enzyme sites the fragment that obtains is connected among the carrier pIRES2-AcGFP, so far, carrier pCAG-IRES2-AcGFP1 makes up complete.

And, described step second step, further concrete steps comprise:

⑴ according to FSTNcDNA gene order design primer;

⑵ obtain the total length segment of FSTN by the PCR reaction;

⑶ order-checking: the method that reclaims by glue reclaims this fragment, is connected on the PMD19T-simple vector, transforms and be coated with flat board, chooses bacterium and shakes bacterium, and whether positive, at last positive bacteria liquid is sent to order-checking if detecting institute's bacterium colony of choosing by bacterium liquid PCR;

⑷ gene fragment is inserted the pCAG-IRES2-AcGFP1 carrier; Select the correct bacterium liquid of sequencing result to carry out the upgrading grain, institute's upgrading grain is carried out EcoR I and BamH I double digestion, the fragment that obtains is inserted in the initial carrier by EcoR I and two restriction enzyme sites of BamH I, and carries out enzyme and cut evaluation and PCR evaluation, correctly inserts to guarantee foreign gene.

And in described three steps of step the, further concrete steps comprise:

⑴ extract cow genome group DNA as the template of PCR clone MAR sequence;

⑵ basis is with report ox MAR primers;

⑶ obtain the total length segment of MAR sequence by the PCR reaction;

⑷ order-checking: the method that reclaims by glue reclaims this fragment, is connected on the PMD19T-simple vector, transforms and be coated with flat board, chooses bacterium and shakes bacterium, and whether positive, at last positive bacteria liquid is sent to order-checking if detecting institute's bacterium colony of choosing by bacterium liquid PCR;

⑸ fragment is inserted the pCAG-IRES2-AcGFP1 carrier: select the correct bacterium liquid of sequencing result to carry out the upgrading grain, institute's upgrading grain is carried out Sac I, Sal I double digestion or Pst I, Afl II double digestion, the fragment that obtains is inserted in the carrier of acquisition of upper step by these 4 restriction enzyme sites, and carries out enzyme and cut evaluation and PCR evaluation.

Advantage of the present invention and positively effect are:

The bicistronic mRNA co-expression gene transfer body MAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR that the present invention makes up preparation shifts body as separate gene, it is not only transgenosis body clean, safety, and when using the AcGFP1(marker gene verifying) when being replaced as another goal gene (with BstXI and the displacement of Not1 double digestion), can realize the double gene coexpression of arbitrary combination, and then the recycling by IRES, realize the purpose of polygene coexpression, shape such as economic characters two for improving, controlled by multiple genes provide new thinking and approach.

Description of drawings

Fig. 1 is initial carrier pCMV-IRES-AcGFP1 structural representation;

Fig. 2 is carrier pCAG-IRES2-AcGFP1 structural representation;

Fig. 3 is pMAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR plasmid structural representation;

Fig. 4 is the structural representation that MAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR bicistronic mRNA co-expression gene shifts body;

Fig. 5 is FSTN cloned plasmids PCR evaluation figure;

Fig. 6 is that the enzyme of recombinant plasmid is cut evaluation figure;

Fig. 7 is that the enzyme that inserts the MAR sequence before the CAG is cut evaluation figure;

Fig. 8 is the PCR evaluation figure that inserts the MAR sequence behind the polyA;

Fig. 9 is that the enzyme that inserts the MAR sequence behind the polyA is cut evaluation figure.

Embodiment

Below in conjunction with accompanying drawing the embodiment of the invention is further described: it is emphasized that embodiment of the present invention is illustrative, rather than determinate, can not limit protection scope of the present invention with this.

A kind of bicistronic mRNA co-expression gene shifts body, and the gene order of transgenosis body is: SEQ ID No.15.

And, as shown in Figure 4, described transgenosis body plays 3 ＇ end from 5 ＇ end and only includes successively ox nuclear matrix land MAR, artificial constructed combination promotor CAG, arrestin gene FST N, internal ribosome entry site IRES, green fluorescent protein AcGFP gene, Rabbit globin polyA signaling zone.

And the sequence of described nuclear matrix land MAR is carried out PCR by following primer and is obtained:

MAR sequence before the CAG:

CMAF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.9;

CMAR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.10;

MAR sequence behind the PolyA:

PMF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.11;

PMR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.12.

And the sequence of described nuclear matrix land MAR is: SEQ ID No.13.

And the sequence of described arrestin gene FST N is carried out PCR by following primer and is obtained:

FMF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.7;

FMR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.8.

And the sequence of described arrestin gene FST N is: SEQ ID No.14.

A kind of bicistronic mRNA co-expression gene shifts the preparation method of body, and step is as follows:

The first step, transplant and replace pCMV-IRES2-AcGFP1 by the CAG promotor on the pCAGEN carrier, as shown in Figure 1, in CMV, transplant and replace simultaneously the SV40polyA among the pCMV-IRES2-AcGFP1 with Rabbit globin polyA on the pCAGEN carrier, carrier construction pCAG-IRES2-AcGFP1, as shown in Figure 2, concrete steps are:

⑴ insert T fragment (change restriction enzyme site);

Obtain one section sequence by round pcr from PMD19T-simple vector, be called for short the T fragment, Sac I and two restriction enzyme sites of Sal I are introduced in this fragment upstream, EcoR I and two restriction enzyme sites of SAc II are introduced in the downstream, after by Sac I and two restriction enzyme sites of Sac II this fragment being connected into carrier like this, can change the order (changing Sac I-Sal I-EcoR I-Sac II into by Sac I-EcoR I-Sal I-Sac II) of original restriction enzyme site on the carrier, make things convenient for next step test.

Design of primers is as follows:

The CF25 positive-sense strand:

SEQ?ID?No.1gagctcAATCGgtcgacTATCCGCCTCCATCCAGTCT

The CR26 antisense strand:

SEQ?ID?No.2ccgcggAATCGgaattcTTCCGTGTCGCCCTTATTCC

⑵ the insertion of CAG promotor

With Sal I and EcoR I double digestion, the CAG promotor is downcut from the pCAGEN carrier, be connected in the above-mentioned carrier;

⑶ acquisition and the insertion of Rabbit globin polyA

The design primer, react by PCR, obtain Rabbit globin polyA sequence from the pCAGEN carrier, for making things convenient for the insertion of this sequence, upstream primer is introduced Not I restriction enzyme site, downstream primer is introduced Afl II restriction enzyme site, by these two restriction enzyme sites the Rabbit globin polyA sequence that obtains is inserted among the carrier pIRES2-AcGFP1

Design of primers is as follows:

The PAF7 positive-sense strand:

SEQ?ID?No.3?gcggccgcACTCCTCAGGTGCAGGCT

The PAR8 antisense strand:

SEQ?ID?No.4?CttaagCTGCAGGTCGAGGGATCT

⑷ the excision of CMV promotor

Owing to do not have suitable restriction enzyme site before the CMV, therefore can only select a restriction enzyme site ApaL I in the middle of the pUC, and the Nhe I of CMV back carries out double digestion, thereby the CMV promotor is excised from carrier pIRES2-AcGFP1.

⑸ the polishing pUC second half section

Owing to when excision CMV promotor, also cut away the second half section of pUC sequence, therefore also needed the pUC second half section sequence polishing that cuts away.Gene order design primer according to pUC, obtain the second half section of pUC sequence by the PCR reaction, for making things convenient for the insertion of this sequence, upstream primer is introduced ApaL I restriction enzyme site, and downstream primer is introduced Nhe I restriction enzyme site, the fragment that obtains can be connected among the carrier pIRES2-AcGFP by these two restriction enzyme sites, thereby with pUC sequence polishing, so far, carrier pCAG-IRES2-AcGFP1 makes up complete, as shown in Figure 2

Design of primers is as follows:

PUF1 positive-sense strand: SEQ ID No.5 gtgcacACAGCCCAGCTTGGAGCG

PUR2 antisense strand: SEQ ID No.6 gctagcATGCATGGCGGTAATACGG

Second step, the acquisition of FSTN foreign gene and insertion pCAG-IRES2-AcGFP1 carrier;

, from the recombinant vectors pIRES2-ACGFP1-FSTN that makes up, obtain take the FSTNcDNA gene order as template by round pcr.

⑴ the design of primer

According to FSTNcDNA gene order design primer, for making things convenient in the purpose segment insertion vector, upstream primer 5 ' end is introduced an EcoR I restriction enzyme site, and downstream primer is introduced a BamH I restriction enzyme site, and 5 protection bases are added respectively in the front, and are as follows:

The FMF1 positive-sense strand: 5 ＇ are to 3 ＇

SEQ?ID?No.7?AACTGgaattcTGCCCTCAGGATGGCCCGT

The FMR2 antisense strand: 5 ＇ are to 3 ＇

SEQ?ID?No.8?AACTGggatccTGAACATTGGTGGAGGGT

⑵ the system of PCR reaction

⑶ the condition of PCR reaction

①95℃?5min

②95℃?30s

③58℃?30s

④72℃?1min10s

⑤72℃?7min

2.-4. repeat 35 circulations

Can obtain the total length segment of FSTN by this reaction, the segment size is 1075bp, and sequence is: SEQ ID No.14.

⑷ order-checking

The method that reclaims by glue reclaims this fragment, connect (16 ℃ of connections of spending the night of Solution I 5 μ l+ purpose fragments 4 μ l+PMD19T-simple vector, 1 μ l) to PMD19T-simple vector, transform and be coated with flat board, choose bacterium and shake bacterium, whether detect institute's bacterium colony of choosing by bacterium liquid PCR positive, detected result is sent to order-checking with positive bacteria liquid as shown in Figure 5 at last, stays a part to protect bacterium.

⑸ gene fragment is inserted the pCAG-IRES2-AcGFP1 carrier

After sequencing result is returned, compare with former sequence, select the correct bacterium liquid of sequencing result to carry out the upgrading grain, institute's upgrading grain is carried out EcoR I and BamH I double digestion, the fragment that obtains is inserted in the initial carrier by EcoR I and two restriction enzyme sites of BamH I, and carry out enzyme and cut evaluation and PCR evaluation, correctly insert to guarantee foreign gene.

The 3rd step, the acquisition of MAR sequence and insertion pCAG-IRES2-AcGFP1 carrier;

⑴ extract the Luxi Yellow cattle cell genomic dna as the template of PCR clone MAR sequence.

⑵ design primer according to report ox MAR sequence;

Have Sac I, Sal I, Pst I, 4 restriction enzyme sites of Afl II to use before the CAG promotor and behind the polyA, by these 4 restriction enzyme sites, introduce two sections MAR sequences before the CAG promotor and behind the polyA respectively, the primer of design is as follows respectively:

MAR sequence before the CAG:

The enzyme-added site of cutting: upstream Bcl I TGATCA and Sac I GAGCTC

Downstream Sal I GTCGAC

The CMAF1 positive-sense strand: 5 ＇ are to 3 ＇

SEQ?ID?No.9?AATCGTGATCAAATCGGAGCTCAAATTGTAACAATGTATAGA

The CMAR2 antisense strand: 5 ＇ are to 3 ＇

SEQ?ID?No.10?AATCG?GTCGACTGAGTCATCCTTTCCTTG

MAR sequence behind the PolyA:

The enzyme-added site of cutting: upstream Pst I CTGCAG

Downstream Bcl I TGATCA and Afl II CTTAAG

The PMF1 positive-sense strand: 5 ＇ are to 3 ＇

SEQ?ID?No.11?AATCG?CTGCAG?AAATTGTAACAATGTATAGA

The PMR2 antisense strand: 5 ＇ are to 3 ＇

SEQ?ID?No.12?AATCGTGATCAAATCG?CTTAAG?TGAGTCATCCTTTCCTTG

⑶ the system of PCR reaction

⑷ the condition of PCR reaction

①95℃?5min

②95℃?30s

③58℃?30s

④72℃?1min20s

⑤72℃?7min

2.-4. repeat 35 circulations

Can obtain the total length segment of MAR sequence by this reaction, the segment size is 1203bp.

⑸ order-checking

The method that reclaims by glue reclaims this fragment, connect (16 ℃ of connections of spending the night of Solution I 5 μ l+ purpose fragments 4 μ l+PMD19T-simple vector, 1 μ l) to PMD19T-simple vector, transform and be coated with flat board, choose bacterium and shake bacterium, whether detect institute's bacterium colony of choosing by bacterium liquid PCR positive, at last positive bacteria liquid is sent to order-checking, stay a part to protect bacterium.

⑹ fragment is inserted the pCAG-IRES2-AcGFP1 carrier

After sequencing result is returned, compare with former sequence, select the correct bacterium liquid of sequencing result to carry out the upgrading grain, institute's upgrading grain is carried out Sac I, Sal I double digestion or Pst I, Afl II double digestion, the fragment that obtains is inserted in the carrier of acquisition of upper step by these 4 restriction enzyme sites, carry out enzyme and cut evaluation and PCR evaluation, correctly insert to guarantee foreign gene.

The 4th step, MAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR bicistronic mRNA co-expression gene shifts the final acquisition of body, after plasmid vector pMAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR structure is complete, as shown in Figure 3, with Sac I, Afl II double digestion, can obtain MAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR bicistronic mRNA co-expression gene and shift body, as shown in Figure 4, MARCAGFSTNAcGFPpolyAMAR transgenosis body complete sequence is shown in SEQ ID No.18.

MAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR bicistronic mRNA co-expression gene of the present invention shifts the integration of body and the evaluation of expression level, and its qualification process is as follows:

The evaluation of the transfection of MARCAGFSTNAcGFP1polyAMAR transgenic cell, integration and expression level;

⑴ the acquisition of transgenic cell: the method by liposome transfection obtains transgenic cell, and concrete steps are as follows:

1. the preparation of DNA: expression casette MARCAGFSTNAcGFP1polyAMAR, CAGFSTNAcGFP1polyA and linearization plasmid carrier pCAGFSTNAcGFP are cut and reclaimed to enzyme

2. the cultivation of bovine fibroblasts

3. transfection:

⑵ transfection efficiency:

1. transient transfection efficient detection method is: by the liposome transfection method three groups of DNA are imported and bovine fetal fibroblast in, after 48 hours cell dissociation is got up, detect the transfection efficiency of three groups of DNA by streaming technology, test triplicate.The results are shown in following table 1.

48 hours through three kinds of carrier transfection efficiencies of flow cytometry analysis relatively after table 1 transfection

2. stable transfection efficient detection method is: by the liposome transfection method three groups of DNA are imported and bovine fetal fibroblast in, observe fluorescence after 48 hours, cell dissociation is got up, be diluted to by suitable density in the large ware of 10CM, after 10 days, the foreign gene in the positive cell is stable integration, and cell dissociation is got up, detect the integration efficiency of three groups of DNA by streaming technology, the experiment triplicate.The results are shown in following table 2.

9 days through three kinds of carrier stable transfections of flow cytometry analysis rate (integration rate) relatively after table 2 transfection

⑶ exogenous origin gene integrator detects;

1. the cell after the transfection continues to cultivate after three days, foreign gene this moment stable integration, the cell that (is respectively MARCAGFSTNAcGFP1polyAMAR transfection group, CAGFSTNAcGFP1polyA transfection group, linearization plasmid carrier pCAGFSTNAcGFP transfection group, non-transfection negative control group) in 4 holes of dna digestion group carries out the extraction of genomic dna, take it as masterplate, detect the integration of FSTN-AcGFP1 bicistronic mRNA by the method for PCR.Upstream primer is at 5 of FSTN sequence ' end, and downstream primer is at 3 of AcGFP sequence ' end, and PCR product 2330bp conforms to expection.

2. the result of PCR shows, three groups of corresponding swimming lanes of sample all have the purpose band, does not have in water contrast and the negative control, illustrates that foreign gene is normally integrated at dna level in this transgenic cell of three groups.

⑷ the detection of exogenous gene expression level;

1. the 4th day after the transfection, cell to RNA four holes of group (being respectively MARCAGFSTNAcGFP1polyAMAR transfection group, CAGFSTNAcGFP1polyA transfection group, linearization plasmid carrier pCAGFSTNAcGFP transfection group, non-transfection negative control group) carries out total RNA extraction, immediately total RNA is carried out reverse transcription, whether the cDNA after counter-rotating carries out RT-PCR as masterplate, express at rna level thereby detect in three groups the FSTN-AcGFP1 bicistronic mRNA.Upstream primer is at 5 of FSTN sequence ' end, and downstream primer is at 3 of AcGFP sequence ' end, and PCR product 2330bp conforms to expection.

2. the result of RT-PCR shows, three corresponding swimming lanes of sample all have the purpose band, illustrates in the transgenic cell in these three holes that foreign gene is at rna level normal expression.

Above-mentioned experimental result shows, the constructed MARCAGFSTNAcGFPpolyAMAR separate gene transfer body of the present invention can be better than two kinds of contrasts effectively to carry out transfection, integrate and expresses, and without any plasmid vector backbone sequences and any selectivity resistant gene and marker gene, be that novel gene shifts body safely and effectively.

Gene order:

SEQ?ID?No.1?gagctcAATCGgtcgacTATCCGCCTCCATCCAGTCT

SEQ?ID?No.2?ccgcggAATCGgaattcTTCCGTGTCGCCCTTATTCC

SEQ?ID?No.3?gcggccgcACTCCTCAGGTGCAGGCT

SEQ?ID?No.4?CttaagCTGCAGGTCGAGGGATCT

SEQ?ID?No.5?gtgcacACAGCCCAGCTTGGAGCG

SEQ?ID?No.6?gctagcATGCATGGCGGTAATACGG

SEQ?ID?No.7?AACTGgaattcTGCCCTCAGGATGGCCCGT

SEQ?ID?No.8?AACTGggatccTGAACATTGGTGGAGGGT

SEQ?ID?No.9?AATCGTGATCAAATCGGAGCTCAAATTGTAACAATGTATAGA

SEQ?ID?No.10?AATCG?GTCGACTGAGTCATCCTTTCCTTG

SEQ?ID?No.11?AATCG?CTGCAG?AAATTGTAACAATGTATAGA

SEQ?ID?No.12?AATCGTGATCAAATCG?CTTAAG?TGAGTCATCCTTTCCTTG

SEQ?ID?No.13

Aaattgtaacaatgtatagaaataataattacattaaaaatatt (DNA helicase sequence)gagttgtgtttccatgaaagtattcacctttatatcaatgtctaaaataaagcatttccttatccaaccctagattctttctgtaagcaggatatcactcaagtaacagtttatctatctatgttgtactaacatcaccactctccttttacctccagccaaaagttcattcattttgcactaacaaggcatctacctacctaagagacttgggaaaaaatggactaaaatttaactgtgttaactaaatgctacctaatgagttctttctgaaagactgtattttggtgggtaaagagattttacctatcatgaatatctcttctgacttgacaaaatgtggttttcatgattgataaatcttcctagctctagtcattggttgtccatgtttaacagtgttaatatgaagatataat ( TATA-box ) gtatttaacatgccttactaacttcaggagatcagccctgggatttctttggaaggaatgatgctgaagctgaaactccagtactttggccacctcatgcgaagagttgactcattgggaaagagtctgatgctgggagggattgggagcaggaggagaaggggacgacagaggatgagatggctggatggcatcactgactcgatggacctgagtctgagtgaactctgggagttggtgatggacagggaggcctggtgtgctgcgattcatggggtcgcaaagagttggacacgactgagtgactgaactgaactgaactgaactaactccaggagatagtaaaggacaggaaagtctgaagtgcttcagttcacgaggtcacaaagtgtgagacatgaattaacaactgaacaacagtaacaactagctatcaaaactagctatcttatcctatcagatgggataataaaccatccttctgtagaatggaatatatgcatttattaatcaa ( T-box ) tttttatagttctttgcattgtctaaaatcttcttttaattatgaatccatttactcttcataagaattgtgtagtgaggggaaagcagaagttatactttcttttgtagataaggaaaccaaaccatctgtaagttaagtgaattacttctgtacaaggtcttgcatctgctaacaaggaaaggatgactca

SEQ?ID?No.14

TGCCCTCAGGATGGCCCGTCCTAGGCACCAGCCCGGCGGGCTTTGCCTCCTGCTGCTGCTTCTCTGCCAGTTCATGGAGGACCGCAGCGCCCAGGCTGGGAATTGCTGGCTCCGCCAAGCAAAGAACGGCCGCTGTCAGGTCCTGTACAAGACAGAACTGAGCAAGGAGGAGTGTTGCAGCACTGGCCGCCTGAGCACCTCGTGGACCGAGGAGGACGTAAATGACAACACGCTGTTCAAGTGGATGATTTTCAACGGGGGCGCCCCCAACTGCATCCCTTGTAAAGAAACGTGTGAGAACGTGGACTGTGGCCCCGGAAAAAAATGCCGAATGAACAAGAAGAATAAACCCCGCTGCGTCTGTGCCCCAGATTGTTCTAACATCACCTGGAAAGGCCCGGTGTGTGGGCTGGATGGAAAAACCTACCGCAACGAATGTGCACTCCTCAAGGCCAGATGTAAAGAGCAGCCAGAGCTGCAAGTCCAGTACCAGGGCAAATGTAAAAAGACCTGTCGGGATGTTTTCTGTCCAGGCAGCTCTACATGCGTGGTGGACCAGACTAATAATGCCTACTGTGTGACTTGTAACAGAATTTGCCCAGAGCCCACCTCCTCTGAACAGTATCTCTGTGGGAATGATGGAGTGACCTACCCCAGTGCCTGTCACCTGAGAAAAGCTACCTGCCTACTGGGCAGATCTATTGGATTGGCCTATGAGGGAAAGTGTATCAAAGCAAAGTCCTGTGACGATATCCAGTGCACTGGTGGAAAAAAGTGTTTATGGGACTTCAAGGTTGGCAGAGGCCGGTGTTCACTCTGCGGTGAGCTGTGCCCTGAGAGTAAGTCTGAGGAGCCTGTCTGTGCCAGTGACAATGCCACCTATGCTAGCGAGTGTGCCATGAAGGAAGCGGCCTGCTCCTCGGGCGTGCTGCTGGAAGTGAAGCACTCCGGATCTTGCAACTCCATTTCGGAAGACACCGAAGACGAGGAGGAAGATGAAGACCAGGACTACAGCTTTCCTATATCTTCCATTCTAGAGTGGTAAACCCTCCACCAATGTTCA

SEQ?ID?No.15

aaattgtaacaatgtatagaaataataattacattaaaaatattgagttgtgtttccatgaaagtattcacctttatatcaatgtctaaaataaagcatttccttatccaaccctagattctttctgtaagcaggatatcactcaagtaacagtttatctatctatgttgtactaacatcaccactctccttttacctccagccaaaagttcattcattttgcactaacaaggcatctacctacctaagagacttgggaaaaaatggactaaaatttaactgtgttaactaaatgctacctaatgagttctttctgaaagactgtattttggtgggtaaagagattttacctatcatgaatatctcttctgacttgacaaaatgtggttttcatgattgataaatcttcctagctctagtcattggttgtccatgtttaacagtgttaatatgaagatataatgtatttaacatgccttactaacttcaggagatcagccctgggatttctttggaaggaatgatgctgaagctgaaactccagtactttggccacctcatgcgaagagttgactcattgggaaagagtctgatgctgggagggattgggagcaggaggagaaggggacgacagaggatgagatggctggatggcatcactgactcgatggacctgagtctgagtgaactctgggagttggtgatggacagggaggcctggtgtgctgcgattcatggggtcgcaaagagttggacacgactgagtgactgaactgaactgaactaaactaactccaggagatagtaaaggacaggaaagtctgaagtgcttcagttcacgaggtcacaaagtgtgagacatgaattaacaactgaacaacagtaacaactagctatcaaaactagctatcttatcctatcagatgggataataaaccatccttctgtagaatggaatatatgcatttattaatcaatttttatagttctttgcattgtctaaaatcttcttttaattatgaatccatttactcttcataagaattgtgtagtgaggggaaagcagaagttatactttcttttgtagataaggaaaccaaaccatctgtaagttaagtgaattaacttctgtacaaggtcttgcatctgctaacaaggaaaggatgactcagtcgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatgggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgttgccttcgccccgtgccccgctccgcgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagcgcttggtttaatgacggctcgtttcttttctgtggctgcgtgaaagccttaaagggctccgggagggccctttgtgcgggggggagcggctcggggggtgcgtgcgtgtgtgtgtgcgtggggagcgccgcgtgcggcccgcgctgcccggcggctgtgagcgctgcgggcgcggcgcggggctttgtgcgctccgcgtgtgcgcgaggggagcgcggccgggggcggtgccccgcggtgcgggggggctgcgaggggaacaaaggctgcgtgcggggtgtgtgcgtgggggggtgagcagggggtgtgggcgcggcggtcgggctgtaacccccccctgcacccccctccccgagttgctgagcacggcccggcttcgggtgcggggctccgtgcggggcgtggcgcggggctcgccgtgccgggcggggggtggcggcaggtgggggtgccgggcggggcggggccgcctcgggccggggagggctcgggggaggggcgcggcggccccggagcgccggcggctgtcgaggcgcggcgagccgcagccattgccttttatggtaatcgtgcgagagggcgcagggacttcctttgtcccaaatctggcggagccgaaatctgggaggcgccgccgcaccccctctagcgggcgcgggcgaagcggtgcggcgccggcaggaaggaaatgggcggggagggccttcgtgcgtcgccgcgccgccgtccccttctccatctccagcctcggggctgccgcagggggacggctgccttcgggggggacggggcagggcggggttcggcttctggcgtgtgaccggcggctctagagcctctgctaaccatgttcatgccttcttctttttcctacagctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattctgccctcaggatggcccgtcctaggcaccagcccggcgggctttgcctcctgctgctgcttctctgccagttcatggaggaccgcagcgcccaggctgggaattgctggctccgccaagcaaagaacggccgctgtcaggtcctgtacaagacagaactgagcaaggaggagtgttgcagcactggccgcctgagcacctcgtggaccgaggaggacgtaaatgacaacacgctgttcaagtggatgattttcaacgggggcgcccccaactgcatcccttgtaaagaaacgtgtgagaacgtggactgtggccccggaaaaaaatgccgaatgaacaagaagaataaaccccgctgcgtctgtgccccagattgttctaacatcacctggaaaggcccggtgtgtgggctggatggaaaaacctaccgcaacgaatgtgcactcctcaaggccagatgtaaagagcagccagagctgcaagtccagtaccagggcaaatgtaaaaagacctgtcgggatgttttctgtccaggcagctctacatgcgtggtggaccagactaataatgcctactgtgtgacttgtaacagaatttgcccagagcccacctcctctgaacagtatctctgtgggaatgatggagtgacctaccccagtgcctgtcacctgagaaaagctacctgcctactgggcagatctattggattggcctatgagggaaagtgtatcaaagcaaagtcctgtgacgatatccagtgcactggtggaaaaaagtgtttatgggacttcaaggttggcagaggccggtgttcactctgcggtgagctgtgccctgagagtaagtctgaggagcctgtctgtgccagtgacaatgccacctatgctagcgagtgtgccatgaaggaagcggcctgctcctcgggcgtgctgctggaagtgaagcactccggatcttgcaactccatttcggaagacaccgaagacgaggaggaagatgaagaccaggactacagctttcctatatcttccattctagagtggtaaaccctccaccaatgttcaggatccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtacacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatatggccacaaccatggtgagcaagggcgccgagctgttcaccggcatcgtgcccatcctgatcgagctgaatggcgatgtgaatggccacaagttcagcgtgagcggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcctgtgccctggcccaccctggtgaccaccctgagctacggcgtgcagtgcttctcacgctaccccgatcacatgaagcagcacgacttcttcaagagcgccatgcctgagggctacatccaggagcgcaccatcttcttcgaggatgacggcaactacaagtcgcgcgccgaggtgaagttcgagggcgataccctggtgaatcgcatcgagctgaccggcaccgatttcaaggaggatggcaacatcctgggcaataagatggagtacaactacaacgcccacaatgtgtacatcatgaccgacaaggccaagaatggcatcaaggtgaacttcaagatccgccacaacatcgaggatggcagcgtgcagctggccgaccactaccagcagaatacccccatcggcgatggccctgtgctgctgcccgataaccactacctgtccacccagagcgccctgtccaaggaccccaacgagaagcgcgatcacatgatctacttcggcttcgtgaccgccgccgccatcacccacggcatggatgagctgtacaagtgagcggccgcctcctcaggtgcaggctgcctatcagaaggtggtggctggtgtggccaatgccctggctcacaaataccactgagatctttttccctctgccaaaaattatggggacatcatgaagccccttgagcatctgacttctggctaataaaggaaatttattttcattgcaatagtgtgttggaattttttgtgtctctcactcggaaggacatatgggagggcaaatcatttaaaacatcagaatgagtatttggtttagagtttggcaacatatgccatatgctggctgccatgaacaaaggtggctataaagaggtcatcagtatatgaaacagccccctgctgtccattccttattccatagaaaagccttgacttgaggttagattttttttatattttgttttgtgttatttttttctttaacatccctaaaattttccttacatgttttactagccagatttttcctcctctcctgactactcccagtcatagctgtccctcttctcttatgaagatccctcgacctgcagaaattgtaacaatgtatagaaataataattacattaaaaatattgagttgtgtttccatgaaagtattcacctttatatcaatgtctaaaataaagcatttccttatccaaccctagattctttctgtaagcaggatatcactcaagtaacagtttatctatctatgttgtactaacatcaccactctccttttacctccagccaaaagttcattcattttgcactaacaaggcatctacctacctaagagacttgggaaaaaatggactaaaatttaactgtgttaactaaatgctacctaatgagttctttctgaaagactgtattttggtgggtaaagagattttacctatcatgaatatctcttctgacttgacaaaatgtggttttcatgattgataaatcttcctagctctagtcattggttgtccatgtttaacagtgttaatatgaagatataatgtatttaacatgccttactaacttcaggagatcagccctgggatttctttggaaggaatgatgctgaagctgaaactccagtactttggccacctcatgcgaagagttgactcattgggaaagagtctgatgctgggagggattgggagcaggaggagaaggggacgacagaggatgagatggctggatggcatcactgactcgatggacctgagtctgagtgaactctgggagttggtgatggacagggaggcctggtgtgctgcgattcatggggtcgcaaagagttggacacgactgagtgactgaactgaactgaactgaactaactccaggagatagtaaaggacaggaaagtctgaagtgcttcagttcacgaggtcacaaagtgtgagacatgaattaacaactgaacaacagtaacaactagctatcaaaactagctatcttatcctatcagatgggataataaaccatccttctgtagaatggaatatatgcatttattaatcaatttttatagttctttgcattgtctaaaatcttcttttaattatgaatccatttactcttcataagaattgtgtagtgaggggaaagcagaagttatactttcttttgtagataaggaaaccaaaccatctgtaagttaagtgaattaacttctgtacaaggtcttgcatctgctaacaaggaaaggatgactca

Claims (10)

1. a bicistronic mRNA co-expression gene shifts body, and it is characterized in that: the gene order of transgenosis body is: SEQ ID No.15.

2. bicistronic mRNA co-expression gene according to claim 1 shifts body, it is characterized in that: described transgenosis body plays 3 ＇ end from 5 ＇ end and only includes successively ox nuclear matrix land MAR, artificial constructed combination promotor CAG, arrestin gene FST N, internal ribosome entry site IRES, green fluorescent protein AcGFP gene, Rabbit globin polyA signaling zone.

3. bicistronic mRNA co-expression gene according to claim 2 shifts body, it is characterized in that: the sequence of described nuclear matrix land MAR is carried out PCR by following primer and is obtained:

MAR sequence before the CAG:

CMAF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.9;

CMAR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.10;

MAR sequence behind the PolyA:

PMF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.11;

PMR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.12.

4. bicistronic mRNA co-expression gene according to claim 2 shifts body, and it is characterized in that: the sequence of described nuclear matrix land MAR is: SEQ ID No.13.

5. bicistronic mRNA co-expression gene according to claim 2 shifts body, it is characterized in that: the sequence of described arrestin gene FST N is carried out PCR by following primer and is obtained:

FMF1 positive-sense strand, 5 ＇ are to 3 ＇: SEQ ID No.7;

FMR2 antisense strand, 5 ＇ are to 3 ＇: SEQ ID No.8.

6. bicistronic mRNA co-expression gene according to claim 2 shifts body, and it is characterized in that: the sequence of described arrestin gene FST N is: SEQ ID No.14.

7. a bicistronic mRNA co-expression gene shifts the preparation method of body, it is characterized in that step is as follows:

The first step, transplant and replace pCMV-IRES2-AcGFP1 by the CAG promotor on the pCAGEN carrier, in CMV, simultaneously transplant and replace the SV40polyA among the pCMV-IRES2-AcGFP1 with Rabbit globin polyA on the pCAGEN carrier, carrier construction pCAG-IRES2-AcGFP1;

Second step, the acquisition of FSTN foreign gene and insertion pCAG-IRES2-AcGFP1 carrier;

The 3rd step, the acquisition of MAR sequence and insertion pCAG-IRES2-AcGFP1 carrier;

In the 4th step, after plasmid vector pMAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR structure is complete, with Sac I, Afl II double digestion, obtains MAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR bicistronic mRNA co-expression gene and shift body.

8. bicistronic mRNA co-expression gene according to claim 7 shifts the preparation method of body, it is characterized in that: the described step the first step, and further concrete steps comprise:

⑴ insert the T fragment, changes restriction enzyme site: obtain the T fragment from PMD19T-simple vector, by restriction enzyme site this fragment is connected into carrier, change the order of original restriction enzyme site on the carrier;

⑵ the insertion of CAG promotor: the CAG promotor is downcut from the pCAGEN carrier, be connected in the above-mentioned carrier;

⑶ acquisition and the insertion of Rabbit globin polyA: obtain Rabbit globin polyA sequence from the pCAGEN carrier, by two restriction enzyme sites the Rabbit globin polyA sequence that obtains is inserted among the carrier pIRES2-AcGFP1;

⑷ the excision of CMV promotor: the CMV promotor is excised from carrier pIRES2-AcGFP1;

⑸ the polishing pUC second half section: according to the gene order design primer of pUC, obtain the second half section of pUC sequence by the PCR reaction, by two restriction enzyme sites the fragment that obtains is connected among the carrier pIRES2-AcGFP, so far, carrier pCAG-IRES2-AcGFP1 makes up complete.

9. bicistronic mRNA co-expression gene according to claim 7 shifts the preparation method of body, it is characterized in that: described step second step, and further concrete steps comprise:

⑴ according to FSTNcDNA gene order design primer;

⑵ obtain the total length segment of FSTN by the PCR reaction;

⑶ order-checking: the method that reclaims by glue reclaims this fragment, is connected on the PMD19T-simple vector, transforms and be coated with flat board, chooses bacterium and shakes bacterium, and whether positive, at last positive bacteria liquid is sent to order-checking if detecting institute's bacterium colony of choosing by bacterium liquid PCR;

⑷ gene fragment is inserted the pCAG-IRES2-AcGFP1 carrier; Select the correct bacterium liquid of sequencing result to carry out the upgrading grain, institute's upgrading grain is carried out EcoR I and BamH I double digestion, the fragment that obtains is inserted in the initial carrier by EcoR I and two restriction enzyme sites of BamH I, and carries out enzyme and cut evaluation and PCR evaluation, correctly inserts to guarantee foreign gene.

10. bicistronic mRNA co-expression gene according to claim 7 shifts the preparation method of body, it is characterized in that: in described three steps of step the, further concrete steps comprise:

⑴ extract cow genome group DNA as the template of PCR clone MAR sequence;

⑵ basis is with report ox MAR primers;

⑶ obtain the total length segment of MAR sequence by the PCR reaction;

⑷ order-checking: the method that reclaims by glue reclaims this fragment, is connected on the PMD19T-simple vector, transforms and be coated with flat board, chooses bacterium and shakes bacterium, and whether positive, at last positive bacteria liquid is sent to order-checking if detecting institute's bacterium colony of choosing by bacterium liquid PCR;

⑸ fragment is inserted the pCAG-IRES2-AcGFP1 carrier: select the correct bacterium liquid of sequencing result to carry out the upgrading grain, institute's upgrading grain is carried out Sac I, Sal I double digestion or Pst I, Afl II double digestion, the fragment that obtains is inserted in the carrier of acquisition of upper step by these 4 restriction enzyme sites, and carries out enzyme and cut evaluation and PCR evaluation.

Images