CN101928727A

CN101928727A - Newcastle disease virus Italien strain auxiliary expression plasmid systems, micro genome for detecting system and application thereof

Info

Publication number: CN101928727A
Application number: CN201010179881XA
Authority: CN
Inventors: 边惠洁; 尉丁; 冯浩; 南刚; 陈志南
Original assignee: Individual
Current assignee: Individual
Priority date: 2010-09-22
Filing date: 2010-09-22
Publication date: 2010-12-29

Abstract

The invention relates to different transcript promoter-based newcastle disease virus (NDV) Italien strain auxiliary expression plasmid systems, a micro genome for detecting the systems and application thereof. The system has the advantage that: the obtained auxiliary expression plasmid systems of two sets of NDV Italien strains NP, P and L genes promoted by eukaryotic transcript promoters CMV and T7 respectively can efficiently express virus proteins in eukaryotic cells and eukaryotic cells expressing T7RNA polymerase. Meanwhile, the micro genome, which carries different tag proteins and is used for detecting the auxiliary expression plasmid system for NDV Italien strains, is obtained; and the micro genome can be used for detecting the functions of the constructed three auxiliary protein expression plasmid systems, and meanwhile can be used for research on virus genome functions and recombinant virus preparation.

Description

The micro genome and the application thereof of newcastle disease virus Italien strain auxiliary expression pUC pUC and this system of detection

Technical field

The present invention relates to genetically engineered and biological technical field, particularly make up the micro genome and the application thereof of newcastle disease virus Italien strain auxiliary expression pUC pUC and this system of detection.

Background technology

(Newcastle disease virus NDV) is a kind of strand RNA paramyxovirus that can cause symptoms such as poultry respiratory infection to Avian pneumo-encephalitis virus.The about 15kb of rna gene group total length of NDV, amerism, comprise 6 genes, encode respectively nucleocapsid protein (nucleocapsid protein, NP), phosphorprotein (phosphoprotein, P), stromatin (matrix protein, M), fusion rotein (fusion protein, F), hemagglutinin-neuraminidase (hemagglutinin-neuraminidase, HN) and the RNA polymerase that relies on of RNA (large polymerase, L).Wherein, NP, P and L albumen and virus genomic duplicate and transcribe closely related.Virus nucleocapsid mainly is made of NP albumen, secondly the P and the L albumen that also include some amount, in the process of virus infection host cell, NP, P and L albumen form ribonucleoprotein mixture (RNP) with virus genome RNA, this mixture is exercised the function of the RNA polymerase of RNA dependence, is responsible for transcribing and duplicating of virus genome RNA.

Except that the encoding sequence that contains the 6 kinds of viral proteins of encoding, also comprise being positioned at opening beginning sequence (GS), terminator sequence (GE) and being positioned between the two intermediate sequence (IG) of encoding sequence upstream and downstream in the NDV genome.Wherein, GS and GE sequence are respectively the initial sum termination recognition sites of viral protein genetic transcription.The binding site of regulating and controlling sequence that viral genome is duplicated and viral RNP mixture then is positioned at initial tens of viral genome 5 ' and 3 ' end to the dozens of base, in all NDV strains that GenBank announces, 12 nucleotide sequence high conservatives that above-mentioned base is especially initial.

At present NDV relevant research work be mainly reflected in two aspects: on the one hand, as a kind of important bird virus, NDV can cause the poultry newcastle disease and poultry farming is caused heavy losses, therefore needs the NDV vaccine of research high-efficiency broad spectrum; On the other hand, NDV is a kind of natural oncolytic virus, have that natural selectivity is duplicated and the characteristic of final kill tumor cell in human body tumour cell, and human normal cell and tissue are not had pathogenic, so NDV is considered to a kind of potential antineoplaston preparation.People's expectation can be by carrying out modified recombinant to NDV, and acquisition can be used for the reorganization NDV of clinical therapy of tumor.

Above-mentioned two research directions all relate to the utilization reverse genetic and learn a skill virus is carried out vitro recombination and resurrection.In the NDV resurrection process, except that needs viral genome itself, also three viral protein actings in conjunction of pattern of wants RNP mixture simultaneously just can be finished and genomicly duplicate and transcribe, therefore, the auxiliary expression plasmid of structure NP, P and L gene is necessary in the resurrection process.

Want the eukaryotic expression product of clear and definite NP, P and three kinds of genes of L correctly to express, and can correctly be assembled into the RNP mixture and then exercise normal function, then need to make up a viral micro genome that has label protein and carry out functional verification.The virus micro genome carries the non-coding region and the regulating and controlling sequence at viral genome two ends, the sequence of carrying code tag albumen (as DsRed, luciferase etc.) simultaneously.By the proteic expression of detection label, can verify with viral genome and duplicate and transcribe the proteic function of relevant NP, P and L that therefore, the micro genome of virus also is needed in the vitro recombination virus rescue process simultaneously.Simultaneously, viral micro genome also can be used as a kind of research tool that research viral genome regulating and controlling sequence and non-coding sequence act in the regulation and control viral protein expression.

Summary of the invention

The objective of the invention is for the NP, the P that obtain the Avian pneumo-encephalitis virus virulent strain Italien under two kinds of different transcripting promoters (CMV promotor and the T7 promotor) regulation and control and 6 kinds of eukaryon expression plasmid systems of three genes of L, and the NDV micro genome and the application thereof of carrying different label proteins that are used to detect these three gene expression product functions.

The technical solution adopted in the present invention is:

By the internet database sequence, design can be used for the increasing primer of NDV Italien strain NP, P and L albumen complete encoding sequence.

By the internet database sequence alignment, confirm NDV genome 3 ' and 5 ' conservative region, design simultaneously can be used for NDVItalien strain genome 3 ' and the amplimer of the non-coding region of 5 ' both sides.

By RT-PCR, adopt the corresponding fragment of above-mentioned primer amplification, and check order, confirm corresponding sequence.

Based on pcDNA3.1 (+) eukaryon expression plasmid (CMV promotor), NP, P and L gene cloned respectively to enter corresponding site and carry out the eucaryon transient expression, plasmid is called after pcDNA-NP, pcDNA-P and pcDNA-L respectively.Wherein NP gene expression plasmid pcDNA-NP comprises the sequence of SEQ No 1, its expression product comprises the aminoacid sequence of SEQ No 4, P gene expression plasmid pcDNA-P comprises the sequence of SEQ No 2, its expression product comprises the aminoacid sequence of SEQ No 5, L gene expression plasmid pcDNA-L comprises the sequence of SEQ No 3, its expression product comprises the aminoacid sequence of SEQ No 6, and above-mentioned plasmid is expressed newcastle disease virus Italien strain NP albumen, P albumen and L albumen respectively in eukaryotic cell.

Go up amplification internal ribosome entry site (IRES) sequence by pIRES2-EGFP, and add the t7 rna polymerase promoter sequence at its upstream, the amplification fragment of gained and NP, P and L gene fragment are connected in the pMD-19T carrier successively, and transient expression in can the eukaryotic cell of stably express T7 RNA polymerase, formation is distinguished called after T7-NP, T7-P and T7-L based on NP, P and the L expression of gene plasmid of T7 promotor.Wherein NP gene expression plasmid T7-NP comprises the sequence of SEQ No 1, its expression product comprises the aminoacid sequence of SEQ No 4, P gene expression plasmid T7-P comprises the sequence of SEQ No 2, its expression product comprises the aminoacid sequence of SEQ No 5, L gene expression plasmid T7-L comprises the sequence of SEQ No 3, its expression product comprises the aminoacid sequence of SEQ No 6, and above-mentioned plasmid is expressed newcastle disease virus Italien strain NP albumen, P albumen and L albumen respectively in the eukaryotic cell that contains the T7 RNA polymerase.

The method that adopts overlap PCR successively with NDV Italien pnca gene group 3 ' and 5 ' end non-coding sequence and label protein complete encoding sequence oppositely be inserted between sub and hepatitis D virus autocatalysis ribozyme (HDV ribozyme) sequence of phage t7 rna polymerase promoter and connect into cloned plasmids, wherein viral genome 3 ' non-coding region cDNA sequence comprises the sequence of SEQ No 7, viral genome 5 ' non-coding region cDNA sequence comprises the sequence of SEQ No 8, makes up to obtain NDV Italien micro genome.Wherein label protein adopts red fluorescent protein DsRed and Photinus pyralis LUC respectively, corresponding plasmid called after MG-R and MG-L.

Respectively based on NP, P and the L expression plasmid cotransfection of CMV promotor and T7 promotor, the function of NP, P and L expression plasmid and micro genome is confirmed in the proteic expression of detection label with resulting two kinds of micro genome and two covers.

At last, resulting two plasmids that comprise NDV Italien plasmid full-length gene group cDNA sequence that overlap NP, P and L expression plasmid system and structure are carried out cotransfection, successfully in the external resurrection of carrying out recombinant virus.

Described newcastle disease virus Italien strain auxiliary expression pUC pUC is as external preparation recombinant virus or as the application for preparing viral micro genome.

The micro genome of described detection newcastle disease virus Italien strain auxiliary expression pUC pUC is as external preparation recombinant virus or as the application in newcastle disease virus Italien strain NP albumen, P albumen and proteic preparation of L or the Function Identification.

The invention has the beneficial effects as follows: adopted two cover NDV Italien strain NP, the P of eukaryotic transcription promotor CMV promotor and T7 promotor startup and the auxiliary expression pUC pUC of L gene respectively, can and can in the eukaryotic cell of expressing the T7 RNA polymerase, efficiently express viral protein at eukaryotic cell.Two kinds of micro genome of carrying the detection newcastle disease virus Italien strain auxiliary expression pUC pUC of different reporter genes have been obtained simultaneously, can be used for detecting the function of three kinds of constructed accessory protein expression plasmid systems, also can be used for the research of viral genome function and recombinant virus simultaneously.

Description of drawings

Fig. 1 is the pcDNA-NP plasmid map.

Fig. 2 is the pcDNA-P plasmid map.

Fig. 3 is the pcDNA-L plasmid map.

Fig. 4 is pcDNA-NP transfection BSR-T7/5 cell transient expression NP protein immunization fluoroscopic examination result (400 *), and one is anti-: the anti-NDV polyclonal antibody of rabbit; Two is anti-: goat anti-rabbit igg-Cy3 antibody.

Fig. 5 is pcDNA-P transfection BSR-T7/5 cell transient expression P protein immunization fluoroscopic examination result (400 *), and one is anti-: the anti-NDV polyclonal antibody of rabbit; Two is anti-: goat anti-rabbit igg-Cy3 antibody.

Fig. 6 is the T7-NP plasmid map.

Fig. 7 is the T7-P plasmid map.

Fig. 8 is the T7-L plasmid map.

Fig. 9 is T7-NP transfection BSR-T7/5 cell transient expression NP protein immunization fluoroscopic examination result (200 *).One is anti-: the anti-NDV polyclonal antibody of rabbit; Two is anti-: goat anti-rabbit igg-FITC antibody.

Figure 10 is T7-P transfection BSR-T7/5 cell transient expression P protein immunization fluoroscopic examination result (200 *), and one is anti-: the anti-NDV polyclonal antibody of rabbit; Two is anti-: goat anti-rabbit igg-Cy3 antibody.

Figure 11 is the MG-R plasmid map.

Figure 12 is the expression of results that cell pyrolysis liquid detects DsRed behind MG-R and pcDNA-NP, pcDNA-P and the pcDNA-L cotransfection BSR-T7/5 cell by western blot.

A: transfection micro genome plasmid MG-R;

B: cotransfection helper plasmid pcDNA-NP, pcDNA-P and pcDNA-L;

C: cotransfection helper plasmid pcDNA-NP, pcDNA-P and pcDNA-L and micro genome plasmid MG-R.

Figure 13 is the MG-L plasmid map.

Figure 14 is the expression of results that cell pyrolysis liquid detects Photinus pyralis LUC behind MG-L and T7-NP, T7-P and the T7-L cotransfection BSR-T7/5 cell by the Photinus pyralis LUC reporting system.

Embodiment

1. experiment material

1.1 virus and clone

Virulent strain NDV Italien is by Volker Schirrmacher (Division of Cellular Immunology, German Cancer Research Center, Germany) present;

The BSR-T7/5 cell is by Karl-Klaus Conzelmann (Ludwig-Maximilians-UnivercityMunich, Germany) present;

The SMMC-7721 cell strain is available from Shanghai Chinese Academy of Sciences cell bank.

1.2 bacterial classification and plasmid

PIRES2-EGFP and pDsRed1-N1 plasmid are available from Clontech company;

PcDNA-3.1 (+) plasmid is available from Invitrogen company;

The pGL3-Basic plasmid is available from Promega company;

PMD-19T simple vector T carrier is available from TaKaRa company;

E.coli DH5 α provides for oneself in the laboratory.

1.3 main agents

DMEM high glucose medium (Hyclone company);

Foetal calf serum (Hangzhou folium ilicis chinensis biotech company);

Viral RNA/DNA fast purifying test kit (TaKaRa company);

RT reverse transcription test kit (TaKaRa company);

Restriction enzyme,

HS DNA enzyme, T4DNA ligase enzyme (TaKaRa company);

Plasmid extraction test kit, dna gel purification kit (OMEGA company);

Lipofectamine 2000 (Invitrogen company);

4% Paraformaldehyde 96 stationary liquid;

0.5%Triton solution;

The anti-NDV serum of rabbit is by Volker Schirrmacher (Division of Cellular Immunology, GermanCancer Research Center, Germany) present;

Goat anti-rabbit igg-Cy3 monoclonal antibody (Sigma company);

Pathogen-free domestic chicken kind egg is available from the logical laboratory animal technology company limited of Beijing Cimmeria dimension.

2. method

2.1 design of primers

Based on the GenBank database, choose NP, P and L albumen coded sequence two ends design primer, add Kozak sequence and two sections corresponding restriction enzyme sites simultaneously, primer sequence such as following table (underscore is represented restriction enzyme site):

The primer title	Primer sequence (5 ' to 3 ' direction)
		NP-F1	tataagcttgccaccatgtcttccgtattcgac
NP-F2	tatccatgggccaccatgtcttccgtattcgac
		NP-R	taattctagagtcctgtggaggcagactgggt
P-F1	ggaccttaagcagcggattagggtgaag
		P-F2	attccatgggccaccatggccacctttacagat
P-R	ggcgtctagatgtgacactgaaaagga

L-F1	taatgcggccgccacggctaaacaactcac
		L-F2	taaccatgggccaccatggcaagctccggtcc
L-R	gcattctagatgaatccgaatacgagtctt
		IRES-F	agtaatacgactcactatagggtctcgagctcaagcttcg
IRES-R	aattctagaaatccatggttacttgtacagctcgtc

In the above-mentioned primer, NP-F1 and NP-R, P-F1 and P-R, L-F1 and L-R increase respectively NDV Italien strain NP, P and L gene coded sequence, called after NP1, P1 and L1 are inserted into respectively in the corresponding restriction enzyme site of pcDNA3.1 (+) respectively.

In the above-mentioned primer, NP-F2 and NP-R, P-F2 and P-R, L-F2 and L-R increase respectively NDV Italien strain NP, P and L gene coded sequence, called after NP2 respectively, P2 and L2 are inserted into respectively in the expression plasmid that only carries the T7 promotor.

In the above-mentioned primer, IRES-F and IRES-R are used for from the pIERS2-EGFP plasmid amplification IRES complete sequence, products therefrom called after IRES.

By the internet database sequence alignment, confirm NDV genome 3 ' and 5 ' conservative region and design primer, synthetic NDV Italien pnca gene group 3 ' and the amplimer of the conservative region of 5 ' both sides that can be used for.Primer sequence such as following table:

The primer title	Primer sequence (5 ' to 3 ' direction)
		Tailer-F	gccaccacctgttcctgtagtaaaggcaatcacatatt
Tailer-R	tatctagagtaatacgactcactatagggaccaaacaaagatttggt
		Leader-F	ttcggaccgcgaggaggtggagatgccatgccgacccaccaaacagagattctgtga
Leader-R	gaggagcgcaccatggtggcgtcagcagaaggctctct
		DsRed-F	gccaccatggtgcgctcctc
DsRed-R	ctacaggaacaggtggtggc
		PairA-F	agtaatacgactcactat
PairA-R	aggcaatcacatattaa
		Luci-F	agagccttctgctgacaaagccaccatggaagacgcc

Luci-R	taatatgtgattgcctttacacggcgatctttcc
		PairB-F	gtcagcagaaggctctct
PairB-R	ttataagctaatcggccg

That Tailer-F and Tailer-R, Leader-F and Leader-R are respectively applied for amplification NDV Italien is genomic 3 ' and 5 ' non-coding region, and add T7 promoter sequence and section H DV ribozyme sequence respectively at two ends, products therefrom is called after TS and LS respectively.DsRed-F and DsRed-R are used for from the encoding sequence of plasmid pDsRed1-N1 amplification DsRed, products therefrom called after DS.

PairA-F and PairA-R, PairB-F and PairB-R are respectively applied for by 3 of amplification NDV Italien pnca gene group among the micro genome plasmid MG-R (seeing 2.7) ' and the T7 promotor and the HDV ribozyme sequence of 5 ' non-coding region and both sides thereof, and products therefrom is called after PairA and PairB respectively.Luci-F and Luci-R are used for from the encoding sequence of plasmid pGL3-Basic amplification Photinus pyralis LUC, products therefrom called after Luci.

2.2 virus culture and purifying

NDV Italien strain is inoculated in the allantoic cavity of pathogen-free domestic chicken embryo of 9 ages in days.Select chicken embryo dead after 48 hours, collect allantoic fluid.By the low temperature ultracentrifugation to obtain spissated viral suspension.

2.3 the acquisition of encoding hiv protease sequence and genome two ends non-coding sequence

Extracting the geneome RNA of gained virus in 2.2, by segmentation RT-PCR, adopt primer designed in 2.1 to obtain the cDNA subfragment, is respectively the encoding sequence of NDV Italien strain NP, P and L and genome 3 ' and 5 ' end non-coding sequence.The fragment of gained all reclaims test kit by gel and carries out purifying, is connected in the T carrier and checks order, and confirms the segmental exactness of gained.

2.4 the acquisition of IRES sequence, DsRed encoding sequence and Photinus pyralis LUC encoding sequence

Utilize institute's synthetic primer in 2.1, amplification IRES fragment from plasmid pIRES2-EGFP, amplification DsRed complete encoding sequence from plasmid pDsRed1-N1, amplification Photinus pyralis LUC complete encoding sequence from plasmid pGL3-Basic.The PCR product of gained is connected in the T carrier and checks order, and confirms the segmental exactness of gained.

2.5 structure and checking based on virus N P, P and the L gene expression plasmid of CMV transcripting promoter

Gained fragment NP1, P1 in 2.3 and L1 (name sees 2.1) are cut by corresponding enzyme respectively, insert in pcDNA3.1 (+) multiple clone site, the plasmid that is constituted is through order-checking, after confirming that connection and fragment sequence are correct, difference called after pcDNA-NP (Fig. 1), pcDNA-P (Fig. 2) and pcDNA-L (Fig. 3).

With plasmid pcDNA-NP and the pcDNA-P that obtains, by liposome Lipofectamine 2000 transfection BSR-T7/5 cells, transfection detected NP and the proteic expression of P by indirect immunofluorescence method after 36 hours, the result all detects the expression of corresponding viral protein product as shown in Figure 4 and Figure 5.

2.6 structure and checking based on virus N P, P and the L gene expression plasmid of T7 promotor

Resulting IRES sequence in 2.4 directly is connected into the T carrier, adopt enzyme butt formula to be cloned into carrier respectively resulting fragment NP2, P2 in 2.3 and L2 (name sees 2.1) again, the fragment of gained is at last through order-checking, after determining that connection and insertion fragment are correct, difference called after T7-NP (Fig. 6), T7-P (Fig. 7) and T7-L (Fig. 8).

T7-NP and T7-P are utilized liposome Lipofectamine 2000 transfection BSR-T7/5 cells respectively, after the transfection 36 hours, detect NP and the proteic expression of P by indirect immunofluorescence method, result such as Fig. 9 and shown in Figure 10 all detect the expression of viral protein product.

2.7 carry the structure of the viral micro genome of DsRed encoding sequence

With resulting fragment TS, LS in 2.3 and 2.4 and DS (name sees 2.1) method by overlap PCR, utilize the overlapping complementary region between the primer to connect, again resulting junction fragment is connected in the T carrier, plasmid with gained checks order subsequently, after confirming that connection and fragment sequence are correct, with the plasmid called after MG-R (Figure 11) of gained.

2.8 carry the DsRed encoding sequence viral micro genome and based on virus N P, the P of CMV promotor and the detection of L gene eucaryon expression plasmid function

With pcDNA-NP, pcDNA-P constructed among the MG-R and 2.5 constructed in 2.7 and pcDNA-L plasmid by liposome Lipofectamine 2000 cotransfection BSR-T7/5 cells, lysing cell after 24 hours, western blot method detects DsRed and expresses, the result shows that DsRed successfully expresses as shown in figure 12.Verified also that simultaneously the constructed pcDNA-NP of the present invention, pcDNA-P and pcDNA-L plasmid can express and have the function of assembling the RNP mixture in eukaryotic cell.

2.9 carry the structure of the viral micro genome of Photinus pyralis LUC

With resulting fragment PairA, PairB in 2.3 and 2.4 and Luci (name sees 2.1) method by overlap PCR, utilize the overlapping complementary region between the primer to connect, resulting junction fragment is connected in the T carrier, plasmid with gained checks order subsequently, after confirming that connection and fragment sequence are correct, with the plasmid called after MG-L (Figure 13) of gained.

2.10 carry the viral micro genome of Photinus pyralis LUC and based on virus N P, the P of T7 promotor and the detection of L gene expression plasmid function

2.9 resulting MG-L are passed through liposome Lipofectamine 2000, with 2.6 in resulting plasmid T7-NP, T7-P and the common transfection BSR-T7/5 of T7-L cell, after the transfection 24 hours, lysing cell, cell pyrolysis liquid is added the Photinus pyralis LUC reaction substrate, detect luciferase expression intensity, gained data credit are by statistics analysed, the result shows Photinus pyralis LUC successful expression among the MG-L as shown in figure 14.Verified also that simultaneously the constructed T7-NP of the present invention, T7-P and T7-L plasmid can express and have the function that is assembled into the RNP mixture in eukaryotic cell.

2.11 T7-NP, T7-P and the T7-L plasmid application in preparation NDV Italien recombinant virus

The plasmid co-transfection BSR-T7/5 cell that comprises NDVItalien full-length gene group cDNA sequence that the T7-NP, the T7-P that make up in 2.6 and T7-L expression plasmid and the inventor were made up in the past, after the transfection 7 days, observe the cytopathy that virus causes, and do not observe this phenomenon at control group.By multigelation experimental group cell, the collecting cell lysate, lysate is infected the BSR-T7/5 cell once more with the amplification recombinant virus, detect specific fragment of recombinant virus genomes and order-checking by the RT-PCR method, sequencing result shows inserted one section distinctive exogenous genetic fragment between viral genome HN and F gene, confirmed that resulting virus is the recombinant virus of external structure, shown external resurrection recombinant virus success.This experiment shows that simultaneously T7-NP, T7-P and T7-L expression plasmid system can prepare recombinant virus with comprising the acting in conjunction of viral genome plasmid external.

Sequence table

＜110〉Chen Zhinan

＜120〉micro genome and the application thereof of newcastle disease virus Italien strain auxiliary expression pUC pUC and this system of detection

<160>8

<210>1

<211>1747

<212>DNA

＜213〉newcastle disease virus Italien strain (Newcastle disease virus Italien strain)

<220>

<221>CDS

<222>(67)..(1536)

＜223〉newcastle disease virus Italien strain NP gene

<400>1

acgggtagaa?ggtgtgaatc?tcgagtgcga?ggccgaagct?caaactcgag 50

agagccttct?gctgacatgt?cttccgtatt?cgacgaatat?gagcagctcc 100

tcgcggctca?gactcgccct?aatggagctc?acggaggagg?agaaaagggg 150

agcactttaa?aagttgaggt?cccggtattc?actcttaaca?gtgatgatcc 200

agaagacaga?tggaattttg?cggtattctg?tcttcggatt?gctgttagcg 250

aggatgccaa?caaaccactc?aggcaaggtg?ctctcatatc?tctcttatgc 300

tcccactctc?aagtgatgag?gaaccatgtt?gcccttgcag?ggaaacagaa 350

tgaggccaca?ctggctgttc?ttgagatcga?tggttttacc?aacagtgtgc 400

cccagttcaa?caacaggagt?ggagtgtctg?aagagagagc?acagagattc 450

ttgatgatag?caggatctct?ccctcgagca?tgcagcaatg?gtactccgtt 500

cgtcacagct?ggggttgaag?atgatgcacc?agaagatatc?actgatactc 550

tggaaagaat?cctatctatc?caggctcaag?tatgggtcac?ggtagcaaag 600

gccatgactg?catatgagac?agcagatgag?tcggaaacaa?gaagaatcaa 650

taaatatatg?cagcaaggca?gagtccagaa?gaagtacatc?ctccaccccg 700

tatgcaggag?tgcaattcaa?ctcacgatca?gacattccct?ggcagtccgc 750

attttcttag?ttagcgagct?taagagaggc?cgcaacacgg?caggtgggag 800

ctccacctat?tacaacttgg?taggggatgt?agactcatac?atcaggaaca 850

ccgggcttac?tgcattcttc?ctgacactca?aatatgggat?taataccaag 900

acatcagccc?ttgcactcag?cagcctcaca?ggcgatatcc?aaaaaatgaa 950

gcagctcatg?cgtttatatc?ggataaaagg?agaaaatgcg?ccatacatga 1000

cattgctagg?tgacagtgac?cagatgagct?ttgcaccagc?tgagtatgca 1050

caactttact?ctttcgccat?gggcatggca?tcagtcctag?ataaaggaac 1100

tggcaaatac?caatttgcca?gagactttat?gagcacatca?ttttggagac 1150

ttggagtaga?gtatgctcag?gctcagggaa?gtagcatcaa?tgaggatatg 1200

gctgccgagc?taaaactaac?cccagcagca?aggaggggcc?tggcagctgc 1250

tgcccaacga?gtgtctgagg?agaccggcag?catggatatt?cctactcaac 1300

aagccggggt?cctcaccggg?ctcagcgacg?gaggccctcg?agccccacaa 1350

ggtggatcaa?acaggccgca?agggcaaccg?gatgccggag?atggggagac 1400

ccaattcctg?gatttgatga?gagcggtggc?aaatagcatg?cgagaagcgc 1450

caaactccgc?acagagcacc?acccaaccgg?agcctccttc?aactcctggg 1500

ccgtcccaag?gcaatgacac?cgactgggggtactgaccga?caatacccag 1550

cctgcctcca?caggaccacc?ccaacccctc?tgcccgcacc?ccaccccctg 1600

atccgcagcc?ccgcatggcc?aaacccacaa?aagaaccccc?ccatctcccc 1650

tcctccctcc?agctgcacga?ccccacccgc?ccaaggcaac?ataggcacag 1700

cccgacccac?caacagtcta?tacagagcca?aagatattag?aaaaaaa 1747

<210>2

<211>1451

<212>DNA

<220>

<221>CDS

<222>(84)..(1271)

＜223〉newcastle disease virus Italien strain P gene

<400>2

acgggtagaa?gagaggcatt?cagagaccaa?gacgagtcac?tagggtctct?50

gttctccctt?ctacccagcg?gattagggtg?aagatggcca?cctttacaga?100

tgcggagatc?gacgatatat?ttgagaccag?cggaactgtc?attgacagca?150

taattacggc?ccagggtaaa?tcagcagaga?ctgtcgggag?gagcgcaatc?200

ccacaaggca?agaccaaagc?gttaagcgca?gcatgggaga?agcatgggag?250

catccaacca?ccggccagcc?aagataccct?tgaccaacag?gatagatcag?300

acaagcagcc?atccacacct?gaacaggcga?ctccacataa?cagcccgcca?350

gccacatcca?ccgaccagcc?ccccacccag?gccgcaggcg?aggccggcga?400

cacacagctc?aagaccggag?caagcaactc?acttttgtcg?atgctcgaca?450

agcttagcaa?taaatcgtct?aatgctaaaa?agggcccatg?ggcgagtccc?500

caggaagggc?atcatcaacc?tccggcccaa?cagcagggga?gtcaaccgag?550

ccgcgggaac?aatcaggaaa?gaccgcagaa?ccaggccaag?gccgcccctg?600

gagaccgggg?cacagacgcg?aacacagcat?atcctggaca?atggaaggag?650

tcacaactat?cagctggtgt?aacccctcat?gcgctccggt?cagggcagag?700

ccaagacaat?actcctgcac?ctgtggatca?tgtccagcta?cctgtcgact?750

ttgtgcaggc?gatgatgtct?atgatggagg?cgttatcaca?gagggtaagt?800

aaagttgact?atcagctaga?cctagtttta?aaacagacat?cctccatccc?850

catgatgcgg?tctgaaatcc?aacagctaaa?aacatccgtt?gcggtcatgg?900

aagccaattt?gggcatgatg?aaaattctgg?accctggttg?tgctaacgtt?950

tcatctctaa?gtgatttacg?ggcagtcgcc?cgatcccacc?cagttttaat?1000

ttcaggtccc?ggagatccat?ctccttatgt?gacgcaaggg?ggcgaaatga?1050

cactcaataa?actttcacaa?ccagtgctac?atccgtctga?gttaattaaa?1100

cctgccacgg?caagcgggcc?tgacatggga?gtggagaagg?acactgtccg?1150

tgcattgatc?acctcacgtc?cgatgcatcc?gagctcctca?gctaagctcc?1200

tgagtaagct?ggatgcagcc?gggtcgattg?aagagatcag?gaaaatcaag?1250

cgccttgcgc?tgaatggctg?atcactatca?caacctacaa?caggttcccg?1300

ccttttcagt?gtcacaagga?ctctgccctg?agctttcccc?cataaaccca?1350

agcttcaaca?ctttaggtga?taaccccttc?tcacctcccc?taccccattg?1400

agtgatcgcg?caactgcaat?taatctagca?gcattaaaga?ttaagaaaaa?1450

a 1451

<210>3

<211>6703

<212>DNA

<220>

<221>CDS

<222>(12)..(6626)

＜223〉newcastle disease virus Italien strain L gene

<400>3

acgggtagga?catggcaagc?tccggtcccg?aaagggcaga?gcatcagatc?50

atcctaccag?agtcacacct?atcctcacca?ttggtcaagc?acaaactgct?100

ctattactgg?aaattgactg?ggctaccgct?tcctgacgaa?tgtgacttcg?150

accacctcat?tatcagccga?caatggaaga?aaatacttga?atcggccact?200

cctgacactg?agaggatgat?aaaactcggg?cgggcagtac?accagactct?250

caaccacagt?tccaggataa?ccggagtact?ccatcccagg?tgtttagaag 300

aactggctag?tattgaggtc?cctgattcaa?ccaacaaatt?tcggaagatc 350

gagaagaaga?tccaaattca?caacacaagg?tatggagaac?tgtttacaag 400

gctgtgcacg?catgtagaaa?agaaattgtt?ggggtcgtcc?tggtctagca 450

atgtcccacg?atcagaggaa?ttcaacagca?tccgtacaga?tccggcattc 500

tggtttcact?caaaatggtc?cagagctaag?tttgcatggc?tccatataaa 550

acaggtccaa?aggcacctga?ttgtagcagc?aagaacaagg?tccgcagtca 600

acaaattagt?gacgctgacc?cataagatag?gccaagtctt?tgttactcct 650

gagcttgtcg?ttgtgacaca?tacagatgag?aacaagttca?catgcctcac 700

ccaggaactt?gtgttgatgt?atgcggatat?gatggagggc?agagatatgg 750

tcaacataat?atcatccacg?gcagcacatc?tcaagagctt?atcagagaaa 800

attgatgaca?ttctgcggtt?agtagatgct?ctggcaaaag?atttgggcaa 850

tcaagtctac?gatgttgtag?cactaatgga?gggattcgca?tacggcgccg 900

ttcagctgct?ggagccgtca?ggtacatttg?caggggattt?cttcgcattc 950

aacctgcagg?agctcaaaga?tactctaatc?gagctccttc?ccaaggatat 1000

agcagagtcc?gtgactcacg?caatcgccac?cgtattctct?ggcttagaac 1050

agaatcaagc?agctgagatg?ttgtgcctgc?tgcgtctgtg?gggtcaccca 1100

ctgcttgagt?cccgtgttgc?agcaaaagca?gtcaggagcc?agatgtgcgc 1150

accgaagatg?gtagacttcg?atatgatcct?ccaggtatta?tctttcttta 1200

agggaacaat?catcaatgga?tacagaaaga?agaatgcagg?tgtgtggcca 1250

cgtgtcaaga?tgggtacgat?atacgggaag?gtcattgggc?agctacacgc 1300

agattcagca?gagatttcac?atgatgtcat?gttgagagag?tacaagagtt 1350

tatctgcact?tgaattcgag?ccatgtatag?aatatgaccc?cgtcaccaat 1400

ctaagcatgt?ttctaaaaga?caaggcaatc?gcacacccaa?aagataactg 1450

gctcgcctcg?tttaggcgaa?accttctctc?tgaggaccag?aagaaacatg 1500

ttaaagaggc?aacctcgact?aaccgcctct?tgatagagtt?cttagagtca 1550

aatgattttg?atccatataa?ggagatggaa?tatctgacga?cccttgagta 1600

cctaagagat?gacaacgtgg?cagtatcata?ctcactcaaa?gaaaaggagg 1650

tgaaagttaa?tgggcggatt?ttcgctaagt?taacaaagaa?actaaggaac 1700

tgtcaggtaa?tggcagaagg?gattctagcc?gaccagattg?cacctttttt 1750

ccaggggaat?ggggtcattc?aggatagcat?atctttgact?aagagtatgc 1800

tagcgatgag?tcaactgtcc?ttcaacagca?ataagaaacg?tatcaccgac 1850

tgcaaggaaa?gagtatcctc?aacccgcaat?cacgatccga?agagcaagaa 1900

tcgtcggaga?gttgccacct?ttattacaac?tgacctgcaa?aagtattgtc 1950

ttaactggag?atatcagaca?gtcaagctgt?ttgctcatgc?catcaatcag 2000

ctgatgggcc?tacctcactt?ctttgagtgg?attcatctta?gactcatgga 2050

tactacgatg?tttgtaggag?acccttacaa?tcctccaagt?gacccgaccg 2100

actgtgatct?atcaagagtc?ccaaatgatg?acatatatat?tgtcagtgct 2150

agagggggca?ttgagggatt?gtgccagaag?ctatggacaa?tgatctcaat 2200

tgctgcaatc?caacttgctg?cagcaagatc?acattgtcgt?gttgcctgta 2250

tggtacaagg?tgacaatcaa?gtaatagctg?taacgagaga?ggtaagatca 2300

gatgattccc?cggagatggt?gttaacacaa?ttgcaccaag?ccagtgataa 2350

tttcttcaag?gaattgattc?atgtcaatca?tttgattggc?cataatttaa 2400

aagatcgaga?aaccatcagg?tcagacacat?tcttcatata?cagcaaacga 2450

atattcaaag?atggagcaat?tctcagtcag?gtcctcaaga?actcatctaa 2500

attagtgcta?atatcaggcg?accttagtga?gaacactgta?atgtcttgtg 2550

ccaacattgc?atccactata?gcacggctgt?gcgagaacgg?gcttcctaag 2600

gatttctgtt?actatttaaa?ctacctaatg?agttgtgtgc?agacatactt 2650

tgattctgag?ttttccatca?ctaacaactc?gcaacccgat?tccaaccaat 2700

cgtggattga?ggacatctct?ttcgtgcatt?catatgtcct?gacccctgcc 2750

cagctggggg?gactgagtaa?ccttcaatac?tcaaggctct?acacaaggaa 2800

cattggtgac?ccggggacta?ctgcttttgc?agaggtcaag?cggttagagg 2850

cagtggggtt?actgagtcct?agcattatga?ctaatatctt?aactaggcca 2900

cctggaaatg?gagattgggc?cagtctgtgc?aacgatccat?attcctttaa 2950

ttttgagact?gtcgcgagcc?caaatattgt?acttaagaaa?catacacaga 3000

aagtcctatt?tgaaacttgc?tcaaatcccc?tattatccgg?agtacataca 3050

gaggataatg?aagcagaaga?gaaggcattg?gctgaattct?tgctcaatca 3100

agaagtaatt?cacccacgcg?tcgcgcatgc?tatcatggaa?gcaagctctg 3150

taggtaggag?aaagcaaatt?caggggcttg?ttgacacaac?aaacaccgtg 3200

attaagattg?cgctgactag?gaggccactc?ggcatcaaga?ggctgatgcg 3250

gatagtcaat?tactcgagca?tgcatgcaat?gctatttaga?gatgatgttt 3300

tctcgtccaa?cagatccaac?caccccttag?tctcttctaa?tatgtgttcg 3350

ctgacgctgg?cagattatgc?gcggaacaga?agctggtcac?ctttaacagg 3400

aggtagaaaa?atactgggtg?tatctaatcc?tgataccata?gaacttgtag 3450

agggtgagat?cctcagtgtc?agcggagggt?gcacaaaatg?tgacagcgga 3500

gatgaacagt?ttacctggtt?ccatcttcca?agcaatatag?agctgaccga 3550

tgacaccagc?aagaatcctc?cgatgagagt?gccatatctc?ggatcaaaga 3600

ctcaagagag?gagggccgcc?tcgcttgcga?aaatagccca?tatgtcacca 3650

catgtgaagg?cggcactaag?ggcatcatct?gtgttaatct?gggcttatgg 3700

ggacaacgaa?gtaaattgga?ctgctgctct?taagattgca?aagtctcggt 3750

gcaacataag?ttcagagtat?cttcgactat?tgtcacccct?gccaacagcc 3800

gggaatctcc?aacatagatt?ggatgatggc?ataacccaga?tgacgtttac 3850

ccctgcatct?ctctacagag?tatcacctta?cattcacata?tccaatgatt 3900

ctcaaaggct?atttactgaa?gaaggagtca?aggaggggaa?tgtggtttat 3950

cagcaaatta?tgctcttggg?tttatctcta?attgagtcac?tcttcccaat 4000

gacaacaacc?aagacatatg?atgaaatcac?attgcacctc?cacagtaaat 4050

ttagctgctg?tatcagggaa?gcacctgttg?cagttccttt?cgagctactc 4100

gggttggcac?cagaactaag?ggcggttact?tcgaataagt?ttatgtacga 4150

tcctagccct?gtatcggagg?gagactttgc?gagacttgat?ctagccatct 4200

ttaagagtta?tgagctgaat?ttagagtcat?atcccacaat?agagctaatg 4250

aacattcttt?caatatctag?tgggaagttg?attggccagt?ctgtggtttc 4300

ctatgatgaa?gatacctcta?taaagaatga?cgctataata?gtgtatgaca 4350

acacacgaaa?ttggatcagc?gaagctcaga?attcagatgt?ggtccgccta 4400

ttcgagtatg?cggcacttga?agtgctcctc?gactgctctt?atcaactcta 4450

ctatctgagg?gtaagaggcc?taaacaatat?cgtcctatat?atgagtgatt 4500

tatacaagaa?tatgccagga?attttactct?cgaatattgc?ggctacgata 4550

tctcacccca?tcatccattc?aaggttgaat?gcagtaggtc?tagtcaacca 4600

tgacgggtca?caccaacttg?cagacacaga?tttcattgaa?atgtctgcaa 4650

aactgctagt?ctcttgcact?cgacgcgtgg?tctcaggttt?atatgcaggg 4700

aataggtatg?acctgctgtt?cccatctgtc?ttagatgata?acctgagtga 4750

gaagatgctt?cagttgatat?ctcggttatg?ctgtctgtac?acggtgctct 4800

ttgctacaac?aagagaaatc?ccgaaaataa?gaggcttatc?tgcagaagag 4850

aaatgctcgg?tacttactga?atacttactg?tcagatgctg?tgaaaccatt 4900

acttaggtcc?gagcaagtga?gctctatcat?gtctcccaac?ataattacat 4950

tcccagccaa?tctatattac?atgtctagga?agagccttaa?tttggtcagg 5000

gaaagagagg?atagggatac?tatcttggca?ttgttgttcc?ctcaagaacc 5050

attgctcgag?tttccttcag?tacaagatat?tggtgctcga?gtgaaagatc 5100

catttacccg?acaacctgcg?gcgttcttac?aagagttaga?tttgagtgcc 5150

ccagcaaggt?atgacgcgtt?tacacttagt?caggttcact?ctgaacacac 5200

attgccgaac?ccagaggaag?actatttagt?acgatacttg?ttcagaggaa 5250

tagggactgc?gtcctcctct?tggtataagg?catctcatct?tctttctgta 5300

cccgaggtca?gatgtgcaag?gcatggaaac?tccttatact?tggcagaagg 5350

aagtggagcc?attatgagtc?ttcttgaatt?gcatgtaccg?catgaaacta 5400

tctattacaa?tacgcttttt?tctaatgaga?tgaacccccc?acagcgacat 5450

ttcggaccga?ccccaacaca?gtttctaaat?tcggtcgttt?ataggaatct 5500

acaggcggaa?gtaccatgca?aggatggatt?tgttcaggag?ttccacccat 5550

tatggagaga?gaatacagaa?gagagtgacc?tgacctcaga?taaagcggtg 5600

ggatatatca?catctgcagt?gccttacagg?tctgtatcat?tattgcactg 5650

tgacattgaa?attcctccag?gatccaatca?aagcttacta?gatcaactgg 5700

ctaccaattt?atccctgatt?gccatgcact?ctgtaagaga?gggcggggtc 5750

gttatcatca?aagtactgta?tgcaatgggg?tactacttcc?atctactcat 5800

gaatttgttc?gctccatgtt?ccacgaaagg?atatattctc?tctaatggct 5850

atgcatgtag?aggggatatg?gagtgttact?tgatatttgt?catgggctat 5900

ctaggcgggc?ctacatttgt?gcacgaggtg?gtgaggatgg?caaaaactct 5950

agtacggcgg?cacggtacac?ttctgtctaa?atcagatgaa?attacactga 6000

ctaggttatt?tacctcacag?cagcatcgtg?taacagacat?cctatccagc 6050

cctttaccga?gactaatgaa?gttcttgaga?gagaatattg?atgctgcgct 6100

gattgaagcc?gggggacagc?ctgtccgtcc?attctgtgca?gagagtttag 6150

tgagcacact?aaaagatatg?actcagatga?cccagatcat?cgccagccac 6200

attgacacgg?tcattcgatc?tgtgatctac?atggaagctg?agggtgatct 6250

tgccgacaca?gtgttcttat?ttacccctta?caatctctct?acagacggta 6300

aaaagaggac?atcacttaaa?cagtgcacaa?gacagatcct?agaggtcaca 6350

atactgggtc?tcagggccaa?agatctcaat?aaagtaggtg?atgtaatcgg 6400

cctagtgctc?agaggtatga?tttctctgga?ggacctaatc?ccactgagaa 6450

catacttgaa?gcgtagtacc?tgcccgaagt?atttgaaggc?tgtcctaggt 6500

attactaaac?tcaaagaaat?gttcacagac?acctctttat?tatacttgac 6550

tcgtgctcaa?caaaaattct?acatgaaaac?tataggcaat?gcagtcaagg 6600

gatattacag?taacggtaac?tcttaaaggc?aatcacatat?taatatgctt 6650

tccttctagc?caattgtatc?cttgttgacc?tgattatacc?atattagaaa 6700

aaa 6703

<210>4

<211>490

<212>PRT

<400>4

Met?Ser?Ser?Val?Phe?Asp?Glu?Tyr?Glu?Gln?Leu?Leu?Ala?Ala?Gln

1 5 10 15

Thr?Arg?Pro?Asn?Gly?Ala?His?Gly?Gly?Gly?Glu?Lys?Gly?Ser?Thr

20 25 30

Leu?Lys?Val?Glu?Val?Pro?Val?Phe?Thr?Leu?Asn?Ser?Asp?Asp?Pro

35 40 45

Glu?Asp?Arg?Trp?Asn?Phe?Ala?Val?Phe?Cys?Leu?Arg?Ile?Ala?Val

50 55 60

Ser?Glu?Asp?Ala?Asn?Lys?Pro?Leu?Arg?Gln?Gly?Ala?Leu?Ile?Ser

65 70 75

Leu?Leu?Cys?Ser?His?Ser?Gln?Val?Met?Arg?Asn?His?Val?Ala?Leu

80 85 90

Ala?Gly?Lys?Gln?Asn?Glu?Ala?Thr?Leu?Ala?Val?Leu?Glu?Ile?Asp

95 100 105

Gly?Phe?Thr?Asn?Ser?Val?Pro?Gln?Phe?Asn?Asn?Arg?Ser?Gly?Val

110 115 120

Ser?Glu?Glu?Arg?Ala?Gln?Arg?Phe?Leu?Met?Ile?Ala?Gly?Ser?Leu

125 130 135

Pro?Arg?Ala?Cys?Ser?Asn?Gly?Thr?Pro?Phe?Val?Thr?Ala?Gly?Val

140 145 150

Glu?Asp?Asp?Ala?Pro?Glu?Asp?Ile?Thr?Asp?Thr?Leu?Glu?Arg?Ile

155 160 165

Leu?Ser?Ile?Gln?Ala?Gln?Val?Trp?Val?Thr?Val?Ala?Lys?Ala?Met

170 175 180

Thr?Ala?Tyr?Glu?Thr?Ala?Asp?Glu?Ser?Glu?Thr?Arg?Arg?Ile?Asn

185 190 195

Lys?Tyr?Met?Gln?Gln?Gly?Arg?Val?Gln?Lys?Lys?Tyr?Ile?Leu?His

200 205 210

Pro?Val?Cys?Arg?Ser?Ala?Ile?Gln?Leu?Thr?Ile?Arg?His?Ser?Leu

215 220 225

Ala?Val?Arg?Ile?Phe?Leu?Val?Ser?Glu?Leu?Lys?Arg?Gly?Arg?Asn

230 235 240

Thr?Ala?Gly?Gly?Ser?Ser?Thr?Tyr?Tyr?Asn?Leu?Val?Gly?Asp?Val

245 250 255

Asp?Ser?Tyr?Ile?Arg?Asn?Thr?Gly?Leu?Thr?Ala?Phe?Phe?Leu?Thr

260 265 270

Leu?Lys?Tyr?Gly?Ile?Asn?Thr?Lys?Thr?Ser?Ala?Leu?Ala?Leu?Ser

275 280 285

Ser?Leu?Thr?Gly?Asp?Ile?Gln?Lys?Met?Lys?Gln?Leu?Met?Arg?Leu

290 295 300

Tyr?Arg?Ile?Lys?Gly?Glu?Asn?Ala?Pro?Tyr?Met?Thr?Leu?Leu?Gly

305 310 315

Asp?Ser?Asp?Gln?Met?Ser?Phe?Ala?Pro?Ala?Glu?Tyr?Ala?Gln?Leu

320 325 330

Tyr?Ser?Phe?Ala?Met?Gly?Met?Ala?Ser?Val?Leu?Asp?Lys?Gly?Thr

335 340 345

Gly?Lys?Tyr?Gln?Phe?Ala?Arg?Asp?Phe?Met?Ser?Thr?Ser?Phe?Trp

350 355 360

Arg?Leu?Gly?Val?Glu?Tyr?Ala?Gln?Ala?Gln?Gly?Ser?Ser?Ile?Asn

365 370 375

Glu?Asp?Met?Ala?Ala?Glu?Leu?Lys?Leu?Thr?Pro?Ala?Ala?Arg?Arg

380 385 390

Gly?Leu?Ala?Ala?Ala?Ala?Gln?Arg?Val?Ser?Glu?Glu?Thr?Gly?Ser

395 400 405

Met?Asp?Ile?Pro?Thr?Gln?Gln?Ala?Gly?Val?Leu?Thr?Gly?Leu?Ser

410 415 420

Asp?Gly?Gly?Pro?Arg?Ala?Pro?Gln?Gly?Gly?Ser?Asn?Arg?Pro?Gln

425 430 435

Gly?Gln?Pro?Asp?Ala?Gly?Asp?Gly?Glu?Thr?Gln?Phe?Leu?Asp?Leu

440 445 450

Met?Arg?Ala?Val?Ala?Asn?Ser?Met?Arg?Glu?Ala?Pro?Asn?Ser?Ala

455 460 465

Gln?Ser?Thr?Thr?Gln?Pro?Glu?Pro?Pro?Ser?Thr?Pro?Gly?Pro?Ser

470 475 480

Gln?Gly?Asn?Asp?Thr?Asp?Trp?Gly?Tyr?ter

485 490

<210>5

<211>396

<212>PRT

<400>5

Met?Ala?Thr?Phe?Thr?Asp?Ala?Glu?Ile?Asp?Asp?Ile?Phe?Glu?Thr

1 5 10 15

Ser?Gly?Thr?Val?Ile?Asp?Ser?Ile?Ile?Thr?Ala?Gln?Gly?Lys?Ser

20 25 30

Ala?Glu?Thr?Val?Gly?Arg?Ser?Ala?Ile?Pro?Gln?Gly?Lys?Thr?Lys

35 40 45

Ala?Leu?Ser?Ala?Ala?Trp?Glu?Lys?His?Gly?Ser?Ile?Gln?Pro?Pro

50 55 60

Ala?Ser?Gln?Asp?Thr?Leu?Asp?Gln?Gln?Asp?Arg?Ser?Asp?Lys?Gln

65 70 75

Pro?Ser?Thr?Pro?Glu?Gln?Ala?Thr?Pro?His?Asn?Ser?Pro?Pro?Ala

80 85 90

Thr?Ser?Thr?Asp?Gln?Pro?Pro?Thr?Gln?Ala?Ala?Gly?Glu?Ala?Gly

95 100 105

Asp?Thr?Gln?Leu?Lys?Thr?Gly?Ala?Ser?Asn?Ser?Leu?Leu?Ser?Met

110 115 120

Leu?Asp?Lys?Leu?Ser?Asn?Lys?Ser?Ser?Asn?Ala?Lys?Lys?Gly?Pro

125 130 135

Trp?Ala?Ser?Pro?Gln?Glu?Gly?His?His?Gln?Pro?Pro?Ala?Gln?Gln

140 145 150

Gln?Gly?Ser?Gln?Pro?Ser?Arg?Gly?Asn?Asn?Gln?Glu?Arg?Pro?Gln

155 160 165

Asn?Gln?Ala?Lys?Ala?Ala?Pro?Gly?Asp?Arg?Gly?Thr?Asp?Ala?Asn

170 175 180

Thr?Ala?Tyr?Pro?Gly?Gln?Trp?Lys?Glu?Ser?Gln?Leu?Ser?Ala?Gly

185 190 195

Val?Thr?Pro?His?Ala?Leu?Arg?Ser?Gly?Gln?Ser?Gln?Asp?Asn?Thr

200 205 210

Pro?Ala?Pro?Val?Asp?His?Val?Gln?Leu?Pro?Val?Asp?Phe?Val?Gln

215 220 225

Ala?Met?Met?Ser?Met?Met?Glu?Ala?Leu?Ser?Gln?Arg?Val?Ser?Lys

230 235 240

Val?Asp?Tyr?Gln?Leu?Asp?Leu?Val?Leu?Lys?Gln?Thr?Ser?Ser?Ile

245 250 255

Pro?Met?Met?Arg?Ser?Glu?Ile?Gln?Gln?Leu?LVs?Thr?Ser?Val?Ala

260 265 270

Val?Met?Glu?Ala?Asn?Leu?Gly?Met?Met?Lys?Ile?Leu?Asp?Pro?Gly

275 280 285

Cys?Ala?Asn?Val?Ser?Ser?Leu?Ser?Asp?Leu?Arg?Ala?Val?Ala?Arg

290 295 300

Ser?His?Pro?Val?Leu?Ile?Ser?Gly?Pro?Gly?Asp?Pro?Ser?Pro?Tyr

305 310 315

Val?Thr?Gln?Gly?Gly?Glu?Met?Thr?Leu?Asn?Lys?Leu?Ser?Gln?Pro

320 325 330

Val?Leu?His?Pro?Ser?Glu?Leu?Ile?Lys?Pro?Ala?Thr?Ala?Ser?Gly

335 340 345

Pro?Asp?Met?Gly?Val?Glu?Lys?Asp?Thr?Val?Arg?Ala?Leu?Ile?Thr

350 355 360

Ser?Arg?Pro?Met?His?Pro?Ser?Ser?Ser?Ala?Lys?Leu?Leu?Ser?Lys

365 370 375

Leu?Asp?Ala?Ala?Gly?Ser?Ile?Glu?Glu?Ile?Arg?Lys?Ile?Lys?Arg

380 385 390

Leu?Ala?Leu?Asn?Gly?ter

395?396

<210>6

<211>2205

<212>PRT

<400>6

Met?Ala?Ser?Ser?Gly?Pro?Glu?Arg?Ala?Glu?His?Gln?Ile?Ile?Leu

1 5 10 15

Pro?Glu?Ser?His?Leu?Ser?Ser?Pro?Leu?Val?Lys?His?Lys?Leu?Leu

20 25 30

Tyr?Tyr?Trp?Lys?Leu?Thr?Gly?Leu?Pro?Leu?Pro?Asp?Glu?Cys?Asp

35 40 45

Phe?Asp?His?Leu?Ile?Ile?Ser?Arg?Gln?Trp?Lys?Lys?Ile?Leu?Glu

50 55 60

Ser?Ala?Thr?Pro?Asp?Thr?Glu?Arg?Met?Ile?Lys?Leu?Gly?Arg?Ala

65 70 75

Val?His?Gln?Thr?Leu?Asn?His?Ser?Ser?Arg?Ile?Thr?Gly?Val?Leu

80 85 90

His?Pro?Arg?Cys?Leu?Glu?Glu?Leu?Ala?Ser?Ile?Glu?Val?Pro?Asp

95 100 105

Ser?Thr?Asn?Lys?Phe?Arg?Lys?Ile?Glu?Lys?Lys?Ile?Gln?Ile?His

110 115 120

Asn?Thr?Arg?Tyr?Gly?Glu?Leu?Phe?Thr?Arg?Leu?Cys?Thr?His?Val

125 130 135

Glu?Lys?Lys?Leu?Leu?Gly?Ser?Ser?Trp?Ser?Ser?Asn?Val?Pro?Arg

140 145 150

Ser?Glu?Glu?Phe?Asn?Ser?Ile?Arg?Thr?Asp?Pro?Ala?Phe?Trp?Phe

155 160 165

His?Ser?Lys?Trp?Ser?Arg?Ala?Lys?Phe?Ala?Trp?Leu?His?Ile?Lys

170 175 180

Gln?Val?Gln?Arg?His?Leu?Ile?Val?Ala?Ala?Arg?Thr?Arg?Ser?Ala

185 190 195

Val?Asn?Lys?Leu?Val?Thr?Leu?Thr?His?Lys?Ile?Gly?Gln?Val?Phe

200 205 210

Val?Thr?Pro?Glu?Leu?Val?Val?Val?Thr?His?Thr?Asp?Glu?Asn?Lys

215 220 225

Phe?Thr?Cys?Leu?Thr?Gln?Glu?Leu?Val?Leu?Met?Tyr?Ala?Asp?Met

230 235 240

Met?Glu?Gly?Arg?Asp?Met?Val?Asn?Ile?Ile?Ser?Ser?Thr?Ala?Ala

245 250 255

His?Leu?Lys?Ser?Leu?Ser?Glu?Lys?Ile?Asp?Asp?Ile?Leu?Arg?Leu

260 265 270

Val?Asp?Ala?Leu?Ala?Lys?Asp?Leu?Gly?Asn?Gln?Val?Tyr?Asp?Val

275 280 285

Val?Ala?Leu?Met?Glu?Gly?Phe?Ala?Tyr?Gly?Ala?Val?Gln?Leu?Leu

290 295 300

Glu?Pro?Ser?Gly?Thr?Phe?Ala?Gly?Asp?Phe?phe?Ala?Phe?Asn?Leu

305 310 315

Gln?Glu?Leu?Lys?Asp?Thr?Leu?Ile?Glu?Leu?Leu?Pro?Lys?Asp?Ile

320 325 330

Ala?Glu?Ser?Val?Thr?His?Ala?Ile?Ala?Thr?Val?Phe?Ser?Gly?Leu

335 340 345

Glu?Gln?Asn?Gln?Ala?Ala?Glu?Met?Leu?Cys?Leu?Leu?Arg?Leu?Trp

350 355 360

Gly?His?Pro?Leu?Leu?Glu?Ser?Arg?Val?Ala?Ala?Lys?Ala?Val?Arg

365 370 375

Ser?Gln?Met?Cys?Ala?Pro?Lys?Met?Val?Asp?Phe?Asp?Met?Ile?Leu

380 385 390

Gln?Val?Leu?Ser?Phe?Phe?Lys?Gly?Thr?Ile?Ile?Asn?Gly?Tyr?Arg

395 400 405

Lys?Lys?Asn?Ala?Gly?Val?Trp?Pro?Arg?Val?Lys?Met?Gly?Thr?Ile

410 415 420

Tyr?Gly?Lys?Val?Ile?Gly?Gln?Leu?His?Ala?Asp?Ser?Ala?Glu?Ile

425 430 435

Ser?His?Asp?Val?Met?Leu?Arg?Glu?Tyr?Lys?Ser?Leu?Ser?Ala?Leu

440 445 450

Glu?Phe?Glu?pro?Cys?Ile?Glu?Tyr?Asp?Pro?Val?Thr?Asn?Leu?Ser

455 460 465

Met?Phe?Leu?Lys?Asp?Lys?Ala?Ile?Ala?His?Pro?Lys?Asp?Asn?Trp

470 475 480

Leu?Ala?Ser?Phe?Arg?Arg?Asn?Leu?Leu?Ser?Glu?Asp?Gln?Lys?Lys

485 490 495

His?Val?Lys?Glu?Ala?Thr?Ser?Thr?Asn?Arg?Leu?Leu?Ile?Glu?Phe

500 505 510

Leu?Glu?Ser?Asn?Asp?Phe?Asp?Pro?Tyr?Lys?Glu?Met?Glu?Tyr?Leu

515 520 525

Thr?Thr?Leu?Glu?Tyr?Leu?Arg?Asp?Asp?Asn?Val?Ala?Val?Ser?Tyr

530 535 540

Ser?Leu?Lys?Glu?Lys?Glu?Val?Lys?Val?Asn?Gly?Arg?Ile?Phe?Ala

545 550 555

Lys?Leu?Thr?Lys?Lys?Leu?Arg?Asn?Cys?Gln?Val?Met?Ala?Glu?Gly

560 565 570

Ile?Leu?Ala?Asp?Gln?Ile?Ala?Pro?Phe?Phe?Gln?Gly?Asn?Gly?Val

575 580 585

Ile?Gln?Asp?Ser?Ile?Ser?Leu?Thr?Lys?Ser?Met?Leu?Ala?Met?Ser

590 595 600

Gln?Leu?Ser?Phe?Asn?Ser?Asn?Lys?Lys?Arg?Ile?Thr?Asp?Cys?Lys

605 610 615

Glu?Arg?Val?Ser?Ser?Thr?Arg?Asn?His?Asp?Pro?Lys?Ser?Lys?Asn

620 625 630

Arg?Arg?Arg?Val?Ala?Thr?Phe?Ile?Thr?Thr?Asp?Leu?Gln?Lys?Tyr

635 640 645

Cys?Leu?Asn?Trp?Arg?Tyr?Gln?Thr?Val?Lys?Leu?Phe?Ala?His?Ala

650 655 660

Ile?Asn?Gln?Leu?Met?Gly?Leu?Pro?His?Phe?Phe?Glu?Trp?Ile?His

665 670 675

Leu?Arg?Leu?Met?Asp?Thr?Thr?Met?Phe?Val?Gly?Asp?Pro?Tyr?Asn

680 685 690

Pro?Pro?Ser?Asp?Pro?Thr?Asp?Cys?Asp?Leu?Ser?Arg?Val?Pro?Asn

695 700 705

Asp?Asp?Ile?Tyr?Ile?Val?Ser?Ala?Arg?Gly?Gly?Ile?Glu?Gly?Leu

710 715 720

Cys?Gln?Lys?Leu?Trp?Thr?Met?Ile?Ser?Ile?Ala?Ala?Ile?Gln?Leu

725 730 735

Ala?Ala?Ala?Arg?Ser?His?Cys?Arg?Val?Ala?Cys?Met?Val?Gln?Gly

740 745 750

Asp?Asn?Gln?Val?Ile?Ala?Val?Thr?Arg?Glu?Val?Arg?Ser?Asp?Asp

755 760 765

Ser?Pro?Glu?Met?Val?Leu?Thr?Gln?Leu?His?Gln?Ala?Ser?Asp?Asn

770 775 780

Phe?Phe?Lys?Glu?Leu?Ile?His?Val?Asn?His?Leu?Ile?Gly?His?Asn

785 790 795

Leu?Lys?Asp?Arg?Glu?Thr?Ile?Arg?Ser?Asp?Thr?Phe?Phe?Ile?Tyr

800 805 810

Ser?Lys?Arg?Ile?Phe?Lys?Asp?Gly?Ala?Ile?Leu?Ser?Gln?Val?Leu

815 820 825

Lys?Asn?Ser?Ser?Lys?Leu?Val?Leu?Ile?Ser?Gly?Asp?Leu?Ser?Glu

830 835 840

Asn?Thr?Val?Met?Ser?Cys?Ala?Asn?Ile?Ala?Ser?Thr?Ile?Ala?Arg

845 850 855

Leu?Cys?Glu?Asn?Gly?Leu?Pro?Lys?Asp?Phe?Cys?Tyr?Tyr?Leu?Asn

860 865 870

Tyr?Leu?Met?Ser?Cys?Val?Gln?Thr?Tyr?Phe?Asp?Ser?Glu?Phe?Ser

875 880 885

Ile?Thr?Asn?Asn?Ser?Gln?Pro?Asp?Ser?Asn?Gln?Ser?Trp?Ile?Glu

890 895 900

Asp?Ile?Ser?Phe?Val?His?Ser?Tyr?Val?Leu?Thr?Pro?Ala?Gln?Leu

905 910 915

Gly?Gly?Leu?Ser?Asn?Leu?Gln?Tyr?Ser?Arg?Leu?Tyr?Thr?Arg?Asn

920 925 930

Ile?Gly?Asp?Pro?Gly?Thr?Thr?Ala?Phe?Ala?Glu?Val?Lys?Arg?Leu

935 940 945

Glu?Ala?Val?Gly?Leu?Leu?Ser?Pro?Ser?Ile?Met?Thr?Asn?Ile?Leu

950 955 960

Thr?Arg?Pro?Pro?Gly?Asn?Gly?Asp?Trp?Ala?Ser?Leu?Cys?Asn?Asp

965 970 975

Pro?Tyr?Ser?Phe?Asn?Phe?Glu?Thr?Val?Ala?Ser?Pro?Asn?Ile?Val

980 985 990

Leu?Lys?Lys?His?Thr?Gln?Lys?Val?Leu?Phe?Glu?Thr?Cys?Ser?Asn

995 1000 1005

Pro?Leu?Leu?Ser?Gly?Val?His?Thr?Glu?Asp?Asn?Glu?Ala?Glu?Glu

1010 1015 1020

Lys?Ala?Leu?Ala?Glu?Phe?Leu?Leu?Asn?Gln?Glu?Val?Ile?His?Pro

1025 1030 1035

Arg?Val?Ala?His?Ala?Ile?Met?Glu?Ala?Ser?Ser?Val?Gly?Arg?Arg

1040 1045 1050

Lys?Gln?Ile?Gln?Gly?Leu?Val?Asp?Thr?Thr?Asn?Thr?Val?Ile?Lys

1055 1060 1065

Ile?Ala?Leu?Thr?Arg?Arg?Pro?Leu?Gly?Ile?Lys?Arg?Leu?Met?Arg

1070 1075 1080

Ile?Val?Asn?Tyr?Ser?Ser?Met?His?Ala?Met?Leu?Phe?Arg?Asp?Asp

1085 1090 1095

Val?Phe?Ser?Ser?Asn?Arg?Ser?Asn?His?Pro?Leu?Val?Ser?Ser?Asn

1100 1105 1110

Met?Cys?Ser?Leu?Thr?Leu?Ala?Asp?Tyr?Ala?Arg?Asn?Arg?Ser?Trp

1115 1120 1125

Ser?Pro?Leu?Thr?Gly?Gly?Arg?Lys?Ile?Leu?Gly?Val?Ser?Asn?Pro

1130 1135 1140

Asp?Thr?Ile?Glu?Leu?Val?Glu?Gly?Glu?Ile?Leu?Ser?Val?Ser?Gly

1145 1150 1155

Gly?Cys?Thr?Lys?Cys?Asp?Ser?Gly?Asp?Glu?Gln?Phe?Thr?Trp?Phe

1160 1165 1170

His?Leu?Pro?Ser?Asn?Ile?Glu?Leu?Thr?Asp?Asp?Thr?Ser?Lys?Asn

1175 1180 1185

Pro?Pro?Met?Arg?Val?Pro?Tyr?Leu?Gly?Ser?Lys?Thr?Gln?Glu?Arg

1190 1195 1200

Arg?Ala?Ala?Ser?Leu?Ala?Lys?Ile?Ala?His?Met?Ser?Pro?His?Val

1205 1210 1215

Lys?Ala?Ala?Leu?Arg?Ala?Ser?Ser?Val?Leu?Ile?Trp?Ala?Tyr?Gly

1220 1225 1230

Asp?Asn?Glu?Val?Asn?Trp?Thr?Ala?Ala?Leu?Lys?Ile?Ala?Lys?Ser

1235 1240 1245

Arg?Cys?Asn?Ile?Ser?Ser?Glu?Tyr?Leu?Arg?Leu?Leu?Ser?pro?Leu

1250 1255 1260

Pro?Thr?Ala?Gly?Asn?Leu?Gln?His?Arg?Leu?Asp?Asp?Gly?Ile?Thr

1265 1270 1275

Gln?Met?Thr?Phe?Thr?Pro?Ala?Ser?Leu?Tyr?Arg?Val?Ser?Pro?Tyr

1280 1285 1290

Ile?His?Ile?Ser?Asn?Asp?Ser?Gln?Arg?Leu?Phe?Thr?Glu?Glu?Gly

1295 1300 1305

Val?Lys?Glu?Gly?Asn?Val?Val?Tyr?Gln?Gln?Ile?Met?Leu?Leu?Gly

1310 1315 1320

Leu?Ser?Leu?Ile?Glu?Ser?Leu?Phe?Pro?Met?Thr?Thr?Thr?Lys?Thr

1325 1330 1335

Tyr?Asp?Glu?Ile?Thr?Leu?His?Leu?His?Ser?Lys?Phe?Ser?Cys?Cys

1340 1345 1350

Ile?Arg?Glu?Ala?Pro?Val?Ala?Val?Pro?Phe?Glu?Leu?Leu?Gly?Leu

1355 1360 1365

Ala?Pro?Glu?Leu?Arg?Ala?Val?Thr?Ser?Asn?Lys?Phe?Met?Tyr?Asp

1370 1375 1380

Pro?Ser?Pro?Val?Ser?Glu?Gly?Asp?Phe?Ala?Arg?Leu?Asp?Leu?Ala

1385 1390 1395

Ile?Phe?Lys?Ser?Tyr?Glu?Leu?Asn?Leu?Glu?Ser?Tyr?Pro?Thr?Ile

1400 1405 1410

Glu?Leu?Met?Asn?Ile?Leu?Ser?Ile?Ser?Ser?Gly?Lys?Leu?Ile?Gly

1415 1420 1425

Gln?Ser?Val?Val?Ser?Tyr?Asp?Glu?Asp?Thr?Ser?Ile?Lys?Asn?Asp

1430 1435 1440

Ala?Ile?Ile?Val?Tyr?Asp?Asn?Thr?Arg?Asn?Trp?Ile?Ser?Glu?Ala

1445 1450 1455

Gln?Asn?Ser?Asp?Val?Val?Arg?Leu?Phe?Glu?Tyr?Ala?Ala?Leu?Glu

1460 1465 1470

Val?Leu?Leu?Asp?Cys?Ser?Tyr?Gln?Leu?Tyr?Tyr?Leu?Arg?Val?Arg

1475 1480 1485

Gly?Leu?Asn?Asn?Ile?Val?Leu?Tyr?Met?Ser?Asp?Leu?Tyr?Lys?Asn

1490 1495 1500

Met?Pro?Gly?Ile?Leu?Leu?Ser?Asn?Ile?Ala?Ala?Thr?Ile?Ser?His

1505 1510 1515

Pro?Ile?Ile?His?Ser?Arg?Leu?Asn?Ala?Val?Gly?Leu?Val?Asn?His

1520 1525 1530

Asp?Gly?Ser?His?Gln?Leu?Ala?Asp?Thr?Asp?Phe?Ile?Glu?Met?Ser

1535 1540 1545

Ala?Lys?Leu?Leu?Val?Ser?Cys?Thr?Arg?Arg?Val?Val?Ser?Gly?Leu

1550 1555 1560

Tyr?Ala?Gly?Asn?Arg?Tyr?Asp?Leu?Leu?Phe?Pro?Ser?Val?Leu?Asp

1565 1570 1575

Asp?Asn?Leu?Ser?Glu?Lys?Met?Leu?Gln?Leu?Ile?Ser?Arg?Leu?Cys

1580 1585 1590

Cys?Lau?Tyr?Thr?Val?Leu?Phe?Ala?Thr?Thr?Arg?Glu?Ile?Pro?Lys

1595 1600 1605

Ile?Arg?Gly?Leu?Ser?Ala?Glu?Glu?Lys?Cys?Ser?Val?Leu?Thr?Glu

1610 1615 1620

Tyr?Leu?Leu?Ser?Asp?Ala?Val?Lys?Pro?Leu?Leu?Arg?Ser?Glu?Gln

1625 1630 1635

Val?Ser?Ser?Ile?Met?Ser?Pro?Asn?Ile?Ile?Thr?Phe?Pro?Ala?Asn

1640 1655 1650

Leu?Tyr?Tyr?Met?Ser?Arg?Lys?Ser?Leu?Asn?Leu?Val?Arg?Glu?Arg

1655 1660 1665

Glu?Asp?Arg?Asp?Thr?Ile?Leu?Ala?Leu?Leu?Phe?Pro?Gln?Glu?Pro

1670 1675 1680

Leu?Leu?Glu?Phe?Pro?Ser?Val?Gln?Asp?Ile?Gly?Ala?Arg?Val?Lys

1685 1690 1695

Asp?Pro?Phe?Thr?Arg?Gln?Pro?Ala?Ala?Phe?Leu?Gln?Glu?Leu?Asp

1700 1705 1710

Leu?Ser?Ala?Pro?Ala?Arg?Tyr?Asp?Ala?Phe?Thr?Leu?Ser?Gln?Val

1715 1720 1725

His?Ser?Glu?His?Thr?Leu?Pro?Asn?Pro?Glu?Glu?Asp?Tyr?Leu?Val

1730 1735 1740

Arg?Tyr?Leu?Phe?Arg?Gly?Ile?Gly?Thr?Ala?Ser?Ser?Ser?Trp?Tyr

1745 1750 1755

Lys?Ala?Ser?His?Leu?Leu?Ser?Val?Pro?Glu?Val?Arg?Cys?Ala?Arg

1760 1765 1770

His?Gly?Asn?Ser?Leu?Tyr?Leu?Ala?Glu?Gly?Ser?Gly?Ala?Ile?Met

1775 1780 1785

Ser?Leu?Leu?Glu?Leu?His?Val?Pro?His?Glu?Thr?Ile?Tyr?Tyr?Asn

1790 1795 1800

Thr?Leu?Phe?Ser?Asn?Glu?Met?Asn?Pro?Pro?Gln?Arg?His?Phe?Gly

1805 1810 1815

Pro?Thr?Pro?Thr?Gln?Phe?Leu?Asn?Ser?Val?Val?Tyr?Arg?Asn?Leu

1820 1825 1830

Gln?Ala?Glu?Val?Pro?Cys?Lys?Asp?Gly?Phe?Val?Gln?Glu?Phe?His

1835 1840 1845

Pro?Leu?Trp?Arg?Glu?Asn?Thr?Glu?Glu?Ser?Asp?Leu?Thr?Ser?Asp

1850 1855 1860

Lys?Ala?Val?Gly?Tyr?Ile?Thr?Ser?Ala?Val?Pro?Tyr?Arg?Ser?Val

1865 1870 1875

Ser?Leu?Leu?His?Cys?Asp?Ile?Glu?Ile?Pro?Pro?Gly?Ser?Asn?Gln

1880 1885 1890

Ser?Leu?Leu?Asp?Gln?Leu?Ala?Thr?Asn?Leu?Ser?Leu?Ile?Ala?Met

1895 1900 1905

His?Ser?Val?Arg?Glu?Gly?Gly?Val?Val?Ile?Ile?Lys?Val?Leu?Tyr

1910 1915 1920

Ala?Met?Gly?Tyr?Tyr?Phe?His?Leu?Leu?Met?Asn?Leu?Phe?Ala?Pro

1925 1930 1935

Cys?Ser?Thr?Lys?Gly?Tyr?Ile?Leu?Ser?Asn?Gly?Tyr?Ala?Cys?Arg

1940 1945 1950

Gly?Asp?Met?Glu?Cys?Tyr?Leu?Ile?Phe?Val?Met?Gly?Tyr?Leu?Gly

1955 1960 1965

Gly?Pro?Thr?Phe?Val?His?Glu?Val?Val?Arg?Met?Ala?Lys?Thr?Leu

1970 1975 1980

Val?Arg?Arg?His?Gly?Thr?Leu?Leu?Ser?Lys?Ser?Asp?Glu?Ile?Thr

1985 1990 1995

Leu?Thr?Arg?Leu?Phe?Thr?Ser?Gln?Gln?His?Arg?Val?Thr?Asp?Ile

2000 2005 2010

Leu?Ser?Ser?Pro?Leu?Pro?Arg?Leu?Met?Lys?phe?Leu?Arg?Glu?Asn

2015 2020 2025

Ile?Asp?Ala?Ala?Leu?Ile?Glu?Ala?Gly?Gly?Gln?Pro?Val?Arg?Pro

2030 2035 2040

Phe?Cys?Ala?Glu?Ser?Leu?Val?Ser?Thr?Leu?Lys?Asp?Met?Thr?Gln

2045 2050 2055

Met?Thr?Gln?Ile?Ile?Ala?Ser?His?Ile?Asp?Thr?Val?Ile?Arg?Ser

2060 2065 2070

Val?Ile?Tyr?Met?Glu?Ala?Glu?Gly?Asp?Leu?Ala?Asp?Thr?Val?Phe

2075 2080 2085

Leu?Phe?Thr?Pro?Tyr?Asn?Leu?Ser?Thr?Asp?Gly?Lys?Lys?Arg?Thr

2090 2095 2100

Ser?Leu?Lys?Gln?Cys?Thr?Arg?Gln?Ile?Leu?Glu?Val?Thr?Ile?Leu

2105 2110 2115

Gly?Leu?Arg?Ala?Lys?Asp?Leu?Asn?Lys?Val?Gly?Asp?Val?Ile?Gly

2120 2125 2130

Leu?Val?Leu?Arg?Gly?Met?Ile?Ser?Leu?Glu?Asp?Leu?Ile?Pro?Leu

2135 2140 2145

Arg?Thr?Tyr?Leu?Lys?Arg?Ser?Thr?Cys?Pro?Lys?Tyr?Leu?Lys?Ala

2150 2155 2160

Val?Leu?Gly?Ile?Thr?Lys?Leu?Lys?Glu?Met?Phe?Thr?Asp?Thr?Ser

2165 2170 2175

Leu?Leu?Tyr?Leu?Thr?Arg?Ala?Gln?Gln?Lys?Phe?Tyr?Met?Lys?Thr

2180 2185 2190

Ile?Gly?Asn?Ala?Val?Lys?Gly?Tyr?Tyr?Ser?Asn?Gly?Asn?Ser?ter

2195 2200 2205

<210>7

<211>121

<212>DNA

＜213〉newcastle disease virus Italien strain (Newcastle disease virus)

<220>

<221>3′UTP

<222>(1)..(121)

＜223〉newcastle disease virus Italien strain genome 3 ' non-coding region

<400>7

accaaacaga?gattctgtga?ggtacgataa?aaggcgaagg?agcaatcgaa 50

gtcgtacggg?tagaaggtgt?gaatctcgag?tgcgaggccg?aagctcaaac 100

tcgagagagc?cttctgctga?c 121

<210>8

<211>191

<212>DNA

＜213〉newcastle disease virus Italien strain (Newcastle disease virus)

<220>

<221>5′UTP

<222>(1)..(191)

＜223〉newcastle disease virus Italien strain genome 5 ' non-coding region

<400>8

aggcaatcac?atattaatat?gctttccttc?tagccaattg?tatccttgtt 50

gacctgatta?taccatatta?gaaaaaagtt?gaatcccgac?cctttaagac 100

tcgtattcgg?attcaaataa?ttatcttaaa?acagaagtgc?gcatagttgt 150

tcttgattat?aatcctgtca?ttcaccaaat?ctttgtttgg?t 191

Claims

1. newcastle disease virus Italien strain auxiliary expression pUC pUC, comprise NP gene based on the newcastle disease virus Italien strain of pcDNA3.1 (+) plasmid construction, the eukaryon expression plasmid pcDNA-NP of P gene and L gene, pcDNA-P and pcDNA-L, wherein NP gene expression plasmid pcDNA-NP comprises the sequence of SEQ No 1, its expression product comprises the aminoacid sequence of SEQ No 4, P gene expression plasmid pcDNA-P comprises the sequence of SEQ No 2, its expression product comprises the aminoacid sequence of SEQ No 5, L gene expression plasmid pcDNA-L comprises the sequence of SEQ No 3, its expression product comprises the aminoacid sequence of SEQ No 6, and above-mentioned plasmid is expressed newcastle disease virus Italien strain NP albumen respectively in eukaryotic cell, P albumen and L albumen.

2. newcastle disease virus Italien strain auxiliary expression pUC pUC, the NP gene that comprises newcastle disease virus Italien strain, P gene and L expression of gene plasmid T7-NP, T7-P and T7-L, only there is the t7 rna polymerase promotor in described plasmid, and insert the NP of internal ribosome entry site (IRES) sequence and newcastle disease virus Italien strain successively in the downstream, P and L albumen coded sequence, wherein NP gene expression plasmid T7-NP comprises the sequence of SEQ No 1, its expression product comprises the aminoacid sequence of SEQ No 4, P gene expression plasmid T7-P comprises the sequence of SEQ No2, its expression product comprises the aminoacid sequence of SEQ No 5, L gene expression plasmid T7-L comprises the sequence of SEQ No3, its expression product comprises the aminoacid sequence of SEQ No 6, and above-mentioned plasmid is expressed newcastle disease virus Italien strain NP albumen respectively in the eukaryotic cell that contains the T7 RNA polymerase, P albumen and L albumen.

3. detect the micro genome of newcastle disease virus Italien strain auxiliary expression pUC pUC as claimed in claim 1, it is characterized in that: between t7 rna polymerase promoter sequence and hepatitis D virus autocatalysis ribozyme (HDVribozyme) sequence, oppositely insert newcastle disease virus Italien strain genome 3 ' non-coding region cDNA sequence, label protein encoding sequence and newcastle disease virus Italien strain genome 5 ' non-coding region cDNA sequence, wherein Avian pneumo-encephalitis virus Italen pnca gene group 3 ' non-coding region cDNA sequence comprises the sequence of SEQ No 7, newcastle disease virus Italien strain genome 5 ' non-coding region cDNA sequence comprises the sequence of SEQ No 8, described micro genome is transcribed by the t7 rna polymerase guiding gene, there is newcastle disease virus Italien strain NP albumen at the same time in transcription product, when P albumen and L albumen, in eukaryotic cell, express its label protein that carries.

4. detect the micro genome of newcastle disease virus Italien strain auxiliary expression pUC pUC as claimed in claim 2, it is characterized in that: between t7 rna polymerase promoter sequence and hepatitis D virus autocatalysis ribozyme (HDVribozyme) sequence, oppositely insert newcastle disease virus Italien strain genome 3 ' non-coding region cDNA sequence, label protein encoding sequence and newcastle disease virus Italien strain genome 5 ' non-coding region cDNA sequence, wherein newcastle disease virus Italien strain genome 3 ' non-coding region cDNA sequence comprises the sequence of SEQ No 7, newcastle disease virus Italien strain genome 5 ' non-coding region cDNA sequence comprises the sequence of SEQ No 8, described micro genome is transcribed by T7 RNA polymerase guiding gene, there is newcastle disease virus Italien strain NP albumen at the same time in transcription product, when P albumen and L albumen, in eukaryotic cell, express its label protein that carries.

5. newcastle disease virus Italien strain auxiliary expression pUC pUC as claimed in claim 1 is as external preparation recombinant virus or as the application for preparing viral micro genome.

6. newcastle disease virus Italien strain auxiliary expression pUC pUC as claimed in claim 2 is as external preparation recombinant virus or as the application for preparing viral micro genome.

7. the micro genome of detection newcastle disease virus Italien strain auxiliary expression pUC pUC as claimed in claim 3 is as external preparation recombinant virus or as the application in preparation newcastle disease virus Italien strain NP albumen, P albumen and L albumen or the Function Identification.

8. the micro genome of detection newcastle disease virus Italien strain auxiliary expression pUC pUC as claimed in claim 4 is as external preparation recombinant virus or as the application in preparation newcastle disease virus Italien strain NP albumen, P albumen and L albumen or the Function Identification.