CN103031324B - Monocistron gene expression kit and preparation method thereof - Google Patents

Abstract

The invention discloses a monocistron gene expression kit and a preparation method thereof. The monocistron gene expression kit comprises an independent gene transfer body MAR-CAG-FAT1-polyA-MAR, wherein the MAR is a bovine nuclear matrix attachment region, the CAG is a promoter, the FAT1 is an n-3 desaturase gene, and the polyA is a terminator region. The monocistron independent gene transfer does not have any backbone vector sequence or selective marker, avoids potential hazard to genetically modified animals or human beings, and is an independent gene transfer body with genetical modification safety.

Description

Monocistronic gene is expressed test kit and preparation method thereof

Technical field

The invention belongs to the genetic engineering technique in biological technical field, be specifically related to a kind of monocistronic gene and express test kit and preparation method thereof.

Background technology

The expression vector that the high efficient expression of foreign gene must rely in transgenic animal.Affect exogenous gene high-efficient expressed factor a lot, as promotor, methylate, this body structure of gene, insertion point, regulating and controlling sequence (enhanser, insulator, nuclear matrix land) etc.

CAG promotor is artificial constructed combination promotor, by cytomegalovirus (thecytomegalovirus, CMV) early stage enhanser (early enhancer element) and avian beta-actin (chicken beta-act in) promotor form, CAG promotor is nonspecific constitutive promoter, for driving gene at the high level expression of Mammals carrier.Initial carrier pCAG-IRES2-AcGFP1 for this institute, the CMV in pCMV-IRES2-AcGFP1 is transplanted and replaced to the CAG promotor of Shi Zhe research department on pCAGEN carrier, obtains with the SV40polyA that on pCAGEN carrier, Rabbit globin po lyA transplants and replaces in pCMV-IRES2-AcGFP1 simultaneously.

Nuclear matrix land (MARs) be in eukaryote chromatin with the section of DNA sequence of nuclear matrix or nuclear skeleton specific combination.MARs participates in the multiple core biological processes such as DNA replication dna regulation and control and transcriptional control.

The MARs sequence size that we obtain from cow genome group clone is 1203bp; AT content is 62.31%, through bioinformatic analysis, finds that this sequence also contains the typical DNA sequence (aatatt) of untwisting. a potential T-box (taatcaa) and a potential TATA-box (tataat) sequential structure.

Research shows, the function of MARs sequence comprises boundary factor (boundarye lement) effect, chromatin regulating effect, the component of the initial son of DNA replication dna, chromosome structure anabolic action, the regulating and controlling effect of MARs to transgene expression, in view of the relation between MARs and genetic expression, especially it can strengthen significantly transgene expression, overcomes position effect, eliminate transgene silencing, and it has been used as a kind of cis-regulating element and has been applied in transgenic technology.

Expression casette present Research, utilize the expression casette (only comprising promotor, coding region and terminator) of removing plasmid vector backbone sequences as transgenosis body, also referred to as cleaning DNA, transform (clean DNA transformat ion), mainly by via Particle Bombardment Transformation plant, application has succeeded in paddy rice, cotton, wheat, grape conversion, utilize pollen tube pathway also successfully to utilize in muskmelon, and rarely found structure and application in transgenic animal especially Mammals.

In this research in order to improve transfection and integration and the expression efficiency of expression casette in Mammals, the nuclear matrix land (MARs) that has respectively added an ox at the upstream and downstream of expression casette, structure is prepared into MAR-CAG-FAT1-polyA-MAR monocistronic gene expression cassette, as transgenosis body, for transgenic animal, there is not yet report.It is transgenosis body clean, safety, for Study on Transgenic Animal provides new thinking and approach.

Summary of the invention

The object of the present invention is to provide plasmid-free carrier backbone sequences, without the composing type monocistronic gene expression cassette of any selective marker, tool security, i.e. MAR-CAG-FAT1-polyA-MAR, separate gene shifts body.

Technical scheme of the present invention is summarized as follows:

The bicistronic plasmid carrier p MAR-CAG-FSTN-IRES-AcGFP1-po lyA-MAR of take is initial plasmid carrier, through using EcoR I and Not I double digestion, by FSTN, IRES, AcGFP1 cuts away, choose remainder, introduce EcoR I and two restriction enzyme sites of Hind III with upstream, the intermediate sequence T that Not I restriction enzyme site is introduced in downstream connects, in the middle of being built into, plasmid vector pMAR-CAG-T-PolyA-MA is to prepare the maternal carrier of monocistronic gene expression cassette, utilize EcoR/IHindI I I and Not I to replace T sequence with arbitrary goal gene, obtain monocistronic gene expression cassette, as replaced Hind III--T-Not with double digestion with Hind III--FAT1--Not I, obtain pMAR-CAG-FAT1-polyA-MAR plasmid vector, with Sac1 and AflII double digestion, be separated to MAR-CAG-FAT1-polyA-MAR expression casette, separate gene shifts body.

Monocistronic gene of the present invention expresses test kit without trunk carrier sequence and any selective marker, avoided the potential hazard that they bring transgenic animal and the mankind, is the transgenosis body of tool transgenosis safe.

Accompanying drawing explanation:

Fig. 1: the structural representation of initial plasmid carrier p MAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR;

Fig. 2: middle plasmid vector pMAR-CAG-T-PolyA-MAR structural representation;

Fig. 3: monocistronic gene expression cassette plasmid vector pMAR-CAG-FAT1-polyA structural representation.

Embodiment

The structure of 1.MAR-CAG-FAT1-polyA-MAR expression casette

Utilize the plasmid vector pMAR-CAG-FSTN-IRES-AcGFP1-polyA-MAR shown in Fig. 1 there is no trunk carrier sequence, there is no resistant gene, there is no fluorescently-labeled safety barrier as initial vector construction, first with EcoR I and Not I, plasmid vector is carried out to double digestion, FSTN, IRES, AcGFP1 are cut away, insert again one section of intermediate sequence T, by this sequence, introduce new suitable restriction enzyme site, then insert FAT1 sequence by new restriction enzyme site.

2. the acquisition of intermediate sequence T

By PCR, react from PMD19T-simple vector and obtain the sequence that contains HindIII restriction enzyme site, facilitate the insertion of foreign gene FAT1.

The design of primers of PCR:

Upstream primer is introduced EcoR I and two restriction enzyme sites of HindIII, and downstream primer is introduced Not I restriction enzyme site, and PCR primer is as follows:

TPE3 positive-sense strand:

5′AATCGgaattcAATCGaagcttTATCCGCCTCCATCCAGTCT 3′

TPE4 antisense strand

5′AATCGgcggccgcTTCCGTGTCGCCCTTATTCC 3′

PCR reaction conditions:

(1)95℃ 5min

(2)95℃ 30s

(3)60℃ 30s

(4)72℃ 50s

(5)72℃ 7min

(2)-(4) repeat 35 circulations

By this reaction, can obtain this centre T sequence, segment size is 657bp.

Order-checking

The method reclaiming by glue reclaims this fragment, is connected to PMD19T-simplevector upper, transforms and be coated with flat board, chooses bacterium and shakes bacterium, whether positive detects institute's bacterium colony of choosing by bacterium liquid PCR, finally positive bacteria liquid is sent to order-checking, stays a part to protect bacterium.

3. T segment is inserted into enzyme and cuts the middle plasmid vector of acquisition in carrier

After sequencing result is returned, compare with former sequence, select the correct bacterium liquid of sequencing result to carry out upgrading grain, institute's upgrading grain is carried out to EcoR I and Not I double digestion, the fragment obtaining is inserted into initial enzyme by EcoR I and two restriction enzyme sites of Not I and cuts in carrier, and carries out enzyme and cut evaluation and PCR evaluation, to guarantee that foreign gene correctly inserts, the intermediate carrier plasmid pMAR-CAG-T-polyA-MAR obtaining, its structural representation as shown in Figure 2.

4. obtain FAT1 sequence

Mammals self can not be synthesized omega-3 polyunsaturated fatty acids, so conventionally in under-supply state, its nutritional needs must acquisition from ingest.Omega-3 polyunsaturated fatty acids delta 8 desaturase genes fat-1 is the key enzyme of the serial unsaturated fatty acids in synthetic ω-3.Research shows, fat-1 gene impels the serial unsaturated fatty acids in ω-6 to change the serial unsaturated fatty acids in corresponding ω-3 into.Wish to produce the breeding transgenic livestock of the serial polyunsaturated fatty acid in high expression level ω-3.

For convenience of in object segment insertion vector, upstream primer 5 ' end is introduced a HindIII restriction enzyme site, and downstream primer is introduced a Not I restriction enzyme site, before add respectively 5 protection bases, as follows:

FAF3 positive-sense strand:

5′AATCGaagctt CTGGTTATTGTGCTGTCTCAT 3′

FAR4 antisense strand:

5′AATCGgcggccgcCTCATCACTTGGCCTTGG 3′

Use above-mentioned primer from carrying out PCR reaction containing the cDNA storehouse of FAT1 gene order, reaction conditions is as follows:

(1)95℃ 5min

(2)95℃ 30s

(3)58℃ 30s

(4)72℃ 1min20s

(5)72℃ 7min

(2)-(4) repeat 35 circulations

By this reaction, can obtain the total length segment of FAT1 sequence, segment size is 1182bp.

The method reclaiming by glue reclaims this fragment, is connected on PMD19T-simple vector, transforms and be coated with flat board, selects bacterial strain amplification, whether positive detects institute's bacterium colony of choosing by bacterium liquid PCR, finally positive strain is checked order, and stays a part of bacterium that protects.

5. FAT1 sequence is inserted in carrier

After sequencing result is returned, compare with former sequence, select the correct bacterium liquid of sequencing result to carry out upgrading grain, institute's upgrading grain is carried out to HindIII and Not I double digestion, the fragment obtaining is inserted in intermediate carrier by HindIII and two restriction enzyme sites of Not I, and carries out enzyme and cut evaluation and PCR evaluation, to guarantee that foreign gene correctly inserts, obtain monocistron plasmid vector pMAR-CAG-FAT1-polyA-MAR, its structural representation as shown in Figure 3.

6. obtain MAR-CAG-FAT1-po lyA-MAR genetic expression test kit

After pMAR-CAG-FAT1-po lyA-MAR plamid vector construction, with Sac I, Af1II double digestion, can obtain MAR-CAG-FAT1-polyA-MAR expression casette, its total order is classified SEQ NO.1 as.Transgenic cell is integrated and the evaluation of expressing

One, the acquisition of transgenic cell

Method by liposome transfection obtains transgenic cell, and concrete steps are as follows:

1, the preparation of DNA: expression casette MARCAGFAT1polyAMAR is cut and reclaimed to enzyme

2, the preparation of cell: the transfection mesenchymal stem cells MSCs that thaws the day before yesterday, cell after resuspended is taped against by proper density 6 aerial (density in each hole is 70%-80%) of 24 orifice plates, every hole adds 500 microlitre cell culture fluids (composition is DMEM+10%FBS) cell is cultivated.

3, transfection:

(1) preparation of transfection reagent

Every hole need add 200 microlitre transfection reagents, and its composition is 200 microlitre opti-MEM+2 microlitre LTX+0.67 microlitre plus+500 nanogram DNA.

Process for preparation is as follows: to opti-MEM, add appropriate DNA, thoroughly mix; Add wherein more appropriate plus to mix gently, standing 5 minutes of room temperature; Finally add wherein appropriate LTX, thoroughly mix rear room temperature standing 30 minutes.

(2) treat the processing of transfectional cell

In the transfection reagent process of standing 30 minutes, can treat the cell of transfection processes, treating processes is as follows: original cell culture fluid in hole is siphoned away, with the DPBS of 500 microlitres, wash twice, then wash one time with the opti-MEM of 500 microlitres, the FBS in original nutrient solution is thoroughly removed.

(3) transfection

Until transfection reagent after standing 30 minutes, with pipettor pressure-vaccum, mix for 7-8 time, opt i-MEM in hole is removed, drawing 200 microlitre transfection reagents dropwise joins in hole lentamente, culture plate is rocked several times front and back gently, guarantee that transfection reagent uniform fold, at cell surface, puts into incubator and cultivate.

(4) change liquid

After transfection 4-6 hour, the transfection reagent in each hole is removed, added the DMEM+10FBS of 500 microlitres, continue to cultivate.

Two, exogenous origin gene integrator detects

Cell after transfection continued to cultivate after three days, foreign gene stable integration now, and the cell in three holes of digestion carries out the extraction of genomic dna, take it as masterplate, detects the integration of foreign gene by the method for PCR.Upstream primer is at FAT1 5 ' end, and downstream primer is at MAR sequence 3 ' end, PCR product 3000bp.

The result of PCR is carried out to gel electrophoresis, and electrophoresis result shows, three corresponding swimming lanes of sample all have object band near 3000bp, illustrates that in the transgenic cell in these three holes, foreign gene is normally integrated at DNA level.

Three, exogenous gene expression detects

After transfection the 4th day, carries out total RNA extraction to remaining the cell in three holes, immediately total RNA is carried out to reverse transcription, and whether the cDNA of take after reversing, as masterplate carries out RT-PCR, expresses at rna level thereby detect foreign gene.The primer is the total length amplimer of foreign gene FAT1, so PCR product length is 1258bp.

The result of RT-PCR is carried out to gel electrophoresis, and electrophoresis result shows, three corresponding swimming lanes of sample all have object band near 1258bp, illustrates in the transgenic cell in these three holes that foreign gene is at rna level normal expression.

Above-mentioned experimental result shows, the constructed MAR-CAG-FAT1-polyA-MAR separate gene of the present invention shifts body and can effectively carry out transfection, integrates and express, and without any plasmid vector backbone sequences and any selectivity resistant gene and marker gene, be that novel gene shifts body safely and effectively.

When what understand, be; specific embodiments of the invention are only the objects for exemplary illustration; it limits protection scope of the present invention never in any form; those skilled in the art can be improved according to the above description or be converted, and all these improvement and conversion all should belong to the protection domain of claims of the present invention.

Claims (1)

1. monocistronic gene is expressed test kit, and it contains separate gene and shifts body MAR-CAG-FAT1-po1yA-MAR, and wherein MAR is ox nuclear matrix land; CAG is promotor; FAT1 is n-3 delta 8 desaturase genes; Po1yA is terminator; Described separate gene shifts body without trunk carrier sequence and any selective marker; The gene order that described separate gene shifts body is SEQ NO.:1.

Images