CN102989011A - Medicine composition for treating liver caner and application thereof - Google Patents

Abstract

The invention discloses a medicine composition for treating liver caner and application thereof. The medicine composition is a medicine composition containing arsenic trioxide and recombinant adenovirus containing PML (promyelocytic leukemia protein) gene for jointly treating liver cancer, and belongs to the field of biological medicines. According to the medicine composition, the therapy idea of arsenic trioxide and PML gene recombinant adenovirus for jointly treating liver cancer is put forward for the first time; the effect of in vitro and in vivo treating liver cancer by jointly applying arsenic trioxide and PML gene recombinant adenovirus is observed and the action mechanism and characteristics are disclosed through the exertion of molecular biology and cellular biological technology; and the medicine composition provides a theoretical basis and a new method for treating liver cancer.

Description

A kind of pharmaceutical composition and application thereof that is used for the treatment of hepatocarcinoma

Technical field

The present invention relates to a kind of pharmaceutical composition and application thereof that is used for the treatment of hepatocarcinoma, particularly a kind of pharmaceutical composition and application thereof that contains arsenic trioxide and the therapeutic alliance hepatocarcinoma of the recombinant adenovirus that contains the PML gene.The invention belongs to biomedicine field.

Background technology

Primary hepatocarcinoma is one of modal malignant tumor of China, statistics shows, the whole world has 38.6 ten thousand people to die from hepatocarcinoma every year, and wherein 45% in China, and on the rise, become China's second malignant neoplasm cause of death, as seen China is Liver Cancer country, and annual new patient is more than 100,000, and mortality rate is high, life cycle is short, the serious threat people ' s health.In recent years, along with to the molecular mechanism of tumor invasion and the research of Growth of Cells Regulation Mechanism deeply with development, confirm that apoptosis is that organism is a kind of and regulates the major way of the relative homeostasis of cell colony with the cell mitogen opposite way, study and think the indeterminate growth of tumor to have lost spontaneous apoptosis relevant with it.

The develop rapidly of molecular cloning and gene recombination technology makes the gene therapy of tumor obtain huge progress, for new approach has been opened up in the treatment of tumor.Promyelocytic leukemia albumen (PML) belongs to a class nucleus protein family.Studies show that PML albumen has participated in multiple apoptosis pathway.The cell that wherein infects single strand RNA virus causes PML to redistribute in endochylema, and causes cell resistance serum to reject the apoptosis effect of inducing.The survival of cell after antisense PML oligonucleotide promotes serum to reject, prompting PML participates in apoptosis process directly.Use adenovirus pml: restructuring thing (ad-pml) transfection breast cancer cell line mcf-7, Human Bladder Transitional Cell Carcinoma cell line confirm PML albumen high expressed effectively inhibition tumor cell growth in vitro and become the tumor ability, this treats other entity tumors for application pml method of gene introduction a kind of new approaches is provided.

But since tumor be complicated multifactor, multi-step, relate to the process that the polygenes event occurs, usually can not reach satisfied therapeutic effect for the therapeutic transgene of single link.Therefore, there is researcher to propose the traditional anticancer strategy of gene therapy and other such as chemotherapy, immunization therapy etc. are combined, strengthens or collaborative antitumaous effect in the hope of obtaining.

Arsenic trioxide (As ₂O ₃) as the Chinese medicine poison, in recent years, domestic and international application As ₂O ₃Treatment is take acute promyelocytic leukemia as main malignant hematologic disease and solid tumor, and evident in efficacy, the effect of especially anti-hepatocarcinoma and carcinoma of gallbladder is subject to the extensive concern of domestic and international tumor circle.Research worker is found strong to the hepatoma carcinoma cell selectivity, and mechanism is unique, can make the apoptosis of hepatoma carcinoma cell.This points out us As ₂O ₃May become a kind of new Hepatoma therapy and the medicine of assisting in treating liver cancer.But people know arsenic itself and have very strong toxicity, suppress various mitochondria enzyme activities by being combined with cellular enzymes albumen sulfydryl, affect oxidative phosphorylation process, the Repiration of infringement cell, and untoward reaction mainly is slight bone marrow depression and liver function infringement.

In view of the biological characteristics of malignant tumor, and the imperfection of gene therapy research, arsenic trioxide (As used based on domestic scholars ₂O ₃) in the achievement in research of leukemia treating and mechanism of action thereof.And, use separately As ₂O ₃Or the Ad-pml curative effect is limited, and undue increased dosage amount is often unhelpful and may increase toxicity to improving curative effect.Therefore two kinds of Therapeutic Method are organically combined, carry out many target treatments to improving curative effect, disperseing toxicity significant.

This research application molecular biology and cytobiology technology, observe use in conjunction arsenic trioxide and PML gene recombinant adenovirus in effect external and interior therapeutic hepatocarcinoma, inquire into its mechanism of action and characteristics, provide theoretical foundation in the hope of chemistry and gene therapeutic alliance for hepatocarcinoma.

Summary of the invention

Arsenic trioxide is clinical broad-spectrum anti-cancer drug commonly used, but has certain toxic and side effects, increases dosage and often can increase curative effect, but may increase toxic and side effects; The value of pml gene therapy tumor has been subject to extensive concern, but curative effect is limited, and the present invention is with the two therapeutic alliance hepatocarcinoma, and hope can be by many target treatments to improve curative effect, to reduce toxicity.

The technological means of the present invention's employing is in order to achieve the above object:

The present invention uses molecular biology and cytobiology technology, observe use in conjunction arsenic trioxide and PML gene recombinant adenovirus in effect external and interior therapeutic hepatocarcinoma, inquire into its mechanism of action and characteristics, provide theoretical foundation in the hope of chemistry and gene therapeutic alliance for hepatocarcinoma.The present invention's Ad-pml gene of by experiment 1, successfully having recombinated; Express experiment by transfection HeLa cell, prove that using adenoviral does carrier, not only can increase transfection efficiency, and can be in cell great expression.2, PML recombinant adenovirus (Ad-pml) obviously suppresses the growth of tumor cell of liver in external, body, and this provides theory and experiment basis for the Ad-pml gene therapy, the foundation that provides for the PML gene therapy of hepatocarcinoma.3, As ₂O ₃With the Ad-pml use in conjunction collaborative anti-hepatoma carcinoma cell effect is arranged, its mechanism is relevant with the expression that strengthens hepatoma cell apoptosis and control apoptosis-related genes.

Therefore, the present invention proposes a kind of pharmaceutical composition that is used for the treatment of hepatocarcinoma, it is characterized in that its effective ingredient is arsenic trioxide and the recombinant adenovirus that contains the PML gene.

In the present invention, preferred, the concentration of the arsenic trioxide that contains in the described pharmaceutical composition is 5 μ mol/L, and the MOI of the recombinant adenovirus that contains is 20.

In the present invention, preferred, described recombinant adenovirus prepares in accordance with the following methods:

(1) structure of recombinant vector PSG-PML

Use respectively EcoR I and Bgl II double digestion PSG-CMV and PSG5-PML plasmid, reclaim respectively cmy vector fragment and target DNA fragment, two fragments behind the purification are connected, transform competent escherichia coli cell, screening obtains positive recombiant plasmid PSG-PML;

(2) structure of recombinant adenovirus

Recombinant vector PSG-PML and the plasmid pPE3 that contains 5 type adenovirus right arms are passed through Lipofectamine2000 cotransfection to 293 cell; Virus plaque occurs in 9-14 days behind the cotransfection, through three virus plaque purification, obtain recombinant adenovirus Ad-pml.

Further, the invention allows for the application of described pharmaceutical composition in preparation Hepatoma therapy medicine.

The invention has the beneficial effects as follows compared to prior art:

1, the Ad-pml gene of successfully having recombinated; Express experiment by transfection HeLa cell, prove that using adenoviral does carrier, not only can increase transfection efficiency, and can be in cell great expression.

2, PML recombinant adenovirus (Ad-pml) obviously suppresses the growth of tumor cell of liver in external, body, and this provides theory and experiment basis for the Ad-pml gene therapy, the foundation that provides for the PML gene therapy of hepatocarcinoma.

3, As ₂O ₃With the Ad-pml use in conjunction collaborative anti-hepatoma carcinoma cell effect is arranged, its mechanism is relevant with the expression that strengthens hepatoma cell apoptosis and control apoptosis-related genes.

Description of drawings

Fig. 1 is the experiment flow figure of the structure of PML gene recombinant adenovirus vector;

Fig. 2 reclaims the product electrophoresis result behind PSG-CMV and the PSG5-PML double digestion;

Fig. 2 A 1:1Kb DNA Ladder; The 2:PSG-CMV enzyme action reclaims product 5085bp;

Fig. 2 B 1:PSG5-PML enzyme action reclaims product 2100bp; 2: λ DNA/EcoR I+HindIII;

Fig. 3 is the enzyme action qualification result of recombiant plasmid PSG-PML;

1～6: the positive restructuring PSG-PML plasmid of screening.7：1Kb?DNA?Ladder

Fig. 4 is the PCR qualification result of recombinant virus PSG-PML;

1: negative control 2: positive control (PSG5-PML) 3:1Kb DNA Ladder 4: recombinant virus (PSG-PML)

Fig. 5 is PCR product sequencing result (part);

Fig. 6 is the result (24h) that immunofluorescence method detects PML gene expression

Fig. 7 is use in conjunction As ₂O ₃The experiment flow figure of, interior therapeutic hepatocarcinoma external with Ad-pml;

Fig. 8 is that flow cytometer detects the apoptosis result;

Fig. 9 uses the method for sxemiquantitative RT-PCR to Ad-pml, As ₂O ₃Reach the two synergy cell after 48 hours, each organizes relative expression's Strength Changes measurement result of cell p53 and Bcl-2 mRNA;

Fig. 9 A is p53 mrna expression result (470bp); 1:Ad-pml and As ₂O ₃Use in conjunction, the p53 mrna expression is the strongest; 2: use separately Ad-pml; 3: use separately As ₂O ₃4: the hepatoma carcinoma cell contrast, the p53 mrna expression is the most weak, and each swimming lane is top to be internal reference β-actin;

Fig. 9 B is Bcl-2 mrna expression result (760bp); 1: the hepatoma carcinoma cell contrast, the Bcl-2 mrna expression is the strongest; 2: use separately As ₂O ₃3: use separately Ad-pml 4:Ad-pml and As ₂O ₃Use in conjunction, the Bcl-2 mrna expression is the most weak, and each swimming lane is top to be internal reference β-actin;

The specific embodiment:

Also the present invention will be further described in conjunction with the embodiments below by experiment, it should be understood that these embodiment only are used for the purpose of illustration, never limit protection scope of the present invention.

Embodiment 1 expresses the structure of the recombinant adenoviral vector (Ad-pml) of PML gene

(1) plasmid and cell

PSG-CMV, PSG5-PML plasmid are available from east, Shanghai liver and gall hospital; Contain the plasmid pPE3 of 5 type adenovirus right arms available from Microbix Biosystems company; 293 cells are available from Canadian Microbix Biosystems company.

(2) main agents

Restriction endonuclease XbaI, BamHI, EcoRI, Hind III, ScaI and Taq enzyme, dna ligase SolutionI are all available from TakaRa company.

Hyclone, calf serum, DMEM, LipofectAmine2000 test kit are available from GIBCO BRL company.

Glue recovery test kit, PCR product reclaim test kit, plasmid DNA prepares test kit, viral DNA extraction test kit available from QIAGEN company.

Two of PML monoclonal antibody and green fluorescence labelling resists all available from Invitrogen company.

(3) primer is synthetic

Adopt the PCRPLAN program in the PCGENE software, each parameter be set:

The suitableeest Tm=66, Tm allowed band 50-80; Primer length 15-25bp, complementary maximum is that 3,3 ' end G-C is added to 1 in the G-C content 40-60%, primer, other site homology maximum of primer and template is 60%.Through computing, obtain better primer sequence.And synthetic by Ji Kang genome company.

The primer that this experiment is adopted is as follows:

1, the forward primer of PML gene: 5 ' GAG ACT AAA TTA GAA AGG GGT GG 3 '

2, the downstream primer of PML gene: 5 ' TTC GGA GGA GGA GTT CCA GTT TC 3 '

(4) experimental technique

Experiment flow figure as shown in Figure 1.

1, PSG-PML Vector construction

(1) enzyme action of PSG-CMV and PSG5-PML plasmid

The enzyme action system:

Enzyme action condition: 37 ℃ of water-bath 4h.

Use 0.8% agarose gel electrophoresis, with the gel-purified test kit recovery purification enzyme action product (pressing the test kit description operation) of QIAGEN company.Reclaim the dna fragmentation (PSG) of PSG-CMV 5085bp size and the dna fragmentation (PML) of recovery PSG5-PML 2100bp size.

(2) clone of connection product behind the purification

1) the purpose fragment is connected connection with carrier

Linked system:

Condition of contact: 16 ℃ of 30min

Connect and adopt TaKaRa DNA ligase test kit

2) preparation DH5 α competence antibacterial: CaCL ₂Method

3) the conversion DH5 α competence antibacterial of connection product;

4) screening of positive colony: picking list bacterium colony is inoculated in 3ml LB/AMP ⁺In the fluid medium, 37 ℃ of incubated overnight, thick upgrading grain, electrophoresis identifies whether inserted the external source fragment by the plasmid size.

5) evaluation of positive colony: enzyme action identifies whether the external source fragment of insertion is our genes of interest.

2, restructuring and evaluation

(1) plasmid PSG-PML and the plasmid pPE3 that contains 5 type adenovirus right arms are passed through Lipofectamine2000 cotransfection to 293 cell (pressing the test kit description operation).

(2) virus plaque occurred in 9-14 days behind the cotransfection, through three virus plaque purification, obtain recombinant adenovirus Ad-pml, use QIAamp DNA Blood Mini Kit and extract adenovirus DNA, use PCR and identify.

Primer sequence is as follows:

PML upstream region of gene primer (pml-up): 5 ' GAG ACT AAA TTA GAA AGG GGT GG 3 '

PML gene downstream primer (pml-down): 5 ' TTC GGA GGA GGA GTT CCA GTT TC 3 '

The PCR reaction system:

The PCR reaction condition: 96 ℃ of denaturations 3 minutes, 96 ℃ of degeneration 30 seconds, 58 ℃ of renaturation 40 seconds, 72 ℃ were extended 80 seconds, carried out altogether 32 circulations, 68 ℃ 10 minutes.

(3) amplification of virus and virus titer are measured

1) get the virus preservation liquid that 0.5 μ l increases first, join in 293 cells, mixing was cultivated 72 hours in 37 ℃ of 5%CO2 incubators.

2) collecting cell, centrifugal 5 minutes sedimentation cells of 600 * g are preserved the solution re-suspended cell with virus,-20 ℃ to 37 ℃ freeze thawing 3 times, removed cell debris in centrifugal 20 minutes, collect the supernatant repeated amplification to the needs virus quantity, the 50% TCID's method of then using is measured virus titer.

(4) expression identification of PML gene: be that 10 Ad-pml infects the HeLa cell with the MOI value, after cultivating 12h, 24h, 36h, adopt the method for immunofluorescence respectively, the expression of research PML gene.

(5) experimental result

1, PSG-PML Vector construction result

(1) reclaims the product electrophoresis result behind PSG-CMV and the PSG5-PML double digestion

Respectively as shown in Figure 2.

(2) the enzyme action qualification result of recombiant plasmid PSG-PML

The result as shown in Figure 3.

2, the PCR qualification result of recombinant virus Ad-pml

Use PML upstream and downstream primer recombinant virus is carried out the PCR qualification result, as shown in Figure 4.The PCR product send in Shanghai life worker order-checking company and checks order, and sequencing result is correct, and the order-checking partial results as shown in Figure 5.

3, the expression of PML gene

Adopt the result of immunofluorescence method detection PML gene expression as shown in Figure 6.

Embodiment 2 use in conjunction As ₂O ₃The experimentation of, interior therapeutic hepatocarcinoma external with Ad-pml

One, cell strain and animal

Hepatoma cell strain HepG2 is purchased from Shanghai cell research institute, cultivates in the RPMI1640 culture fluid, adds 10% hyclone, the 100U/ml penicillin, and 100 μ g/ml streptomycins, 5%CO2 cultivates in 37 ℃ of incubators.

Nude mice is purchased from the 3rd Affiliated Hospital of Harbin Medical University.

Two, main agents

The RPMI1640 culture fluid is purchased from Gibco company; Hyclone is purchased from clear company of the four seasons; Arsenic trioxide (As ₂O ₃) be purchased from and breathe out the First Academy of medical university.

Three, experimental technique

Experiment flow as shown in Figure 7.

(1) Ad-pml and As ₂O ₃Use in conjunction is to the lethal effect of tumor cell

Be 1 * 10 with concentration ⁴Individual/porocyte is inoculated respectively hepatoma cell strain HepG2 to 96 orifice plates, cultivates after 24 hours, adds respectively the As of variable concentrations ₂O ₃Ad-pml and each 100 μ l of the mixed liquor of the two with different MOI values respectively establish 3 multiple holes, and control wells adds 100 μ l culture fluid, places 37 ℃, 5% CO ₂After cultivating 48h in the incubator, add MTT30 μ l/ hole, continue to cultivate 4h, abandon supernatant, add the DMSO of 150 μ l, vibration is measured each hole in the absorbance A value of wavelength 570nm with full-automatic microplate reader, detects cell viability.

(2) Ad-pml and As ₂O ₃Impact on apoptosis of tumor cells

According to the preliminary experiment result, use separately As ₂O ₃To HepG2 cytosis, As ₂O ₃During concentration≤5 μ mol/L, the HepG2 cytoactive is had no significant effect, so determine subsequent experimental As ₂O ₃Use concentration and be decided to be 5 μ mol/L.

Be 2 * 10 with concentration ⁵Individual/porocyte is inoculated respectively hepatoma cell strain HepG2 to 6 orifice plates, cultivates after 24 hours, uses Ad-pml(MOI=20) and As ₂O ₃(concentration is 5 μ mol/L) combined effect hepatoma carcinoma cell is established Ad-pml group and As simultaneously ₂O ₃Group and normal cell matched group continue to be cultivated harvesting after 24 hours, digests centrifugally, use the PBS rinsing, get the PI lucifuge that 100 μ l cells add 200 μ l and dye 15 minutes, with the apoptosis degree of flow cytometer detection different disposal group.

(3) RT-PCR detects Ad-pml and As ₂O ₃Impact on tumor cell p53 and Bcl-2

Behind the infection cell 48 hours as stated above, extract test kit with QIAGEN RNA and extract cell RNA, design respectively the primer (primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd) of p53 and Bcl-2.Primer sequence: p53 up:GCTGCTCAGATAGCGATGGTC, p53 down:CTTCGAGATGTTCCGAGAGCTGA; Bcl-2up:CCTTTGTGGAACTGTACGGCC, Bcl-2 down:GGGCTGTGATATTAACAGAGGGA.Adopt respectively Invitrogen two-step method RT-PCR test kit reverse transcription and increase p53 and Bcl-2 gene.Reaction system is as follows: 10 * PCR Buffer MinusMg, 5 μ l; 50mmol/L MgCl ₂; 10mmol/L dNTP Mix 1 μ l; 10umol/L sense primer 1 μ l10 μ mol/L antisense primer 1 μ l; Taq enzyme 0.4 μ l; CDNA template 2 μ l; DEPC-treated water38.1 μ l.PCR condition is 94 ℃ of Henan degeneration 2min; 94 ℃ of degeneration 30S, 52 ℃ of annealing 30s, 72 ℃ are extended 45S, 25 circulations.PCR product 1.2% agarose gel electrophoresis detects electrophoresis result with gel automatic analysis and imaging system.Simultaneously, each group all uses β-actin as internal reference.

(4) Ad-pml and As ₂O ₃Impact on hepatoma carcinoma cell tumorigenesis ability

Use untreated HepG ₂It is 1 * 10 that cell is made concentration ⁷The cell suspension of/ml, with the As of 5 μ mol/L ₂O ₃With MOI be that 20 Ad-pml reaches separately the HepG that use in conjunction was processed ₂Cell is got each 0.1ml(1 of above-mentioned cell suspension * 10 ⁶Cell) is expelled to respectively under right front, left front, right back, the left back ribbed hide of every nude mice in 6 ages in week, injects altogether 6 nude mices.Observe the size of tumor growth situation and measurement tumor after 6 weeks.Gross tumor volume calculates by ellipsoid volume computing formula (V=0.532 * length * wide * height), and the result carries out statistical analysis with variance analysis and q check.

(5) Ad-pml and As ₂O ₃Impact on the hepatoma carcinoma cell tumor growth

With 6 the week age nude mice be divided at random 4 groups, 5 every group.After the HepG2 cell grows up to fine and close monolayer digestion and make cell suspension, concentration is 1 * 10 ⁹ML ^-1, get above-mentioned cell suspension 0.1ML(1 * 10 ⁸Individual cell), be expelled to respectively under right front, left front, right back, the left back ribbed hide of every nude mice injection speed 0.03mLmin ^-1, in order to avoid Cell sap is excessive.When seeing behind the tumor growth 10 days, with PBS, the As of 5 μ mol/L of 0.1ml ₂O ₃, MOI is that 20 Ad-pml and MOI are 20 Ad-pml+5 μ mol/L As ₂O ₃Multi-point injection is carried out at the center that reaches around right front, right back, left front, the left back tumor of nude mice respectively.Every duplicate injection in 7 ~ 10 days once, inject continuously 3 times, use the prostate B ultrasonic behind the 1W and measure gross tumor volume, then put to death nude mice, take out tumor tissues, formalin is fixed, routine paraffin wax section, HE dyeing, the pathological change of om observation tumor tissues.Date processing and analytical method are as previously mentioned.

Four, result

(1) Ad-pml and As ₂O ₃Impact on the hepatoma carcinoma cell growth in vitro

Two factor Factorial Design analysis results show that alone Ad-pml processes hepatoma carcinoma cell, and its inhibitory action increases (P＜0.05) with the increase of Ad-pml MOI value, uses separately As ₂O ₃In concentration during less than 5 μ mol/L, find no obvious tumor inhibition effect (P〉0.05); As ₂O ₃Have the synergistic antitumor effect with the Ad-pml use in conjunction, exist reciprocal action (P＜0.05) between the two.

(2) flow cytometer detects the apoptosis result

Flow cytometry analysis obtains the cell rectangular histogram that is comprised of 4 quadrants.The UL quadrant represents the cell of the mechanical injuries that occur in the cell harvesting process; The UR quadrant represents non-viable apoptotic cell and non-viable non-apoptotic cell; The LL quadrant represents normal cell; The LR quadrant represents viable apoptotic cell.With normal cell group, As ₂O ₃Compare (result is respectively shown in A, B, C among Fig. 8) with Ad-pml difference independent role hepatoma carcinoma cell, with Ad-pml and As ₂O ₃The combined effect hepatoma carcinoma cell is (result is shown in D among Fig. 8) after 24 hours, and early stage apoptosis rate obviously increases.

(3) RT-PCR result

Use the method for sxemiquantitative RT-PCR to Ad-pml, As ₂O ₃And the two synergy cell is after 48 hours, and each relative expression's Strength Changes result who organizes the p53 of cell and Bcl-2 mRNA as shown in Figure 9.RT-PCR result shows that therapeutic alliance group p53 expresses the highest, and the Bcl-2 expression is minimum, and on the contrary, it is minimum that hepatoma carcinoma cell matched group p53 expresses, and the Bcl-2 expression is the highest.

(4) Ad-pml and As ₂O ₃The result that affects on hepatoma carcinoma cell tumorigenesis ability

The hepatoma carcinoma cell that application different disposal factor is processed forms tumor in nude mouse result shows: Ad-pml and Ad-pml and As ₂O ₃The hepatoma carcinoma cell that use in conjunction was processed does not all form obvious lump in the 6W after injection, and As ₂O ₃The cell of processing all forms obvious lump after reaching the injection cell that does not add processing, and the volume that the former volume is slightly less than the latter (is respectively 0.083 ± 0.005cm ³With 0.097 ± 0.031cm ³), but there was no significant difference (P〉0.05) statistically.

(5) Ad-pml and As ₂O ₃The result that affects on the hepatoma carcinoma cell tumor growth

Use respectively PBS, As ₂O ₃, Ad-pml, Ad-pml+As ₂O ₃Tumor tissues is carried out using the prostate B ultrasonic and measuring the volume of respectively organizing tumor after multiple spot repeatedly treats, and statistical result shows: the As that uses separately 5 μ mol/L ₂O ₃Fail obviously to dwindle gross tumor volume (P〉0.05), use separately MOI and be 20 Ad-pml and can obviously make gross tumor volume dwindle (P＜0.05), but compare with the two use in conjunction, the latter makes tumor volume dwindle more obvious (P＜0.05).

The pathological observation result shows: growth of tumour cell is very vigorous in the PBS matched group, and the tumor cell ratio is very high in the tissue; As ₂O ₃Treatment group, still take tumor cell as main, but ratio slightly descends in the tumor soma; Equal visible large stretch of tumor tissue necrosis in PML treatment group and the therapeutic alliance group, fibrosis, calcification etc., but therapeutic alliance group degree of necrosis is heavier, and calcification is more obvious.

Five, conclusion

1, experiment showed, the present invention's Ad-pml gene of successfully having recombinated; Express experiment by transfection HeLa cell, prove that using adenoviral does carrier, not only can increase transfection efficiency, and can be in cell great expression.

2, PML recombinant adenovirus (Ad-pml) obviously suppresses the growth of tumor cell of liver in external, body, and this provides theory and experiment basis for the Ad-pml gene therapy, the foundation that provides for the PML gene therapy of hepatocarcinoma.

3, As ₂O ₃With the Ad-pml use in conjunction collaborative anti-hepatoma carcinoma cell effect is arranged, its mechanism is relevant with the expression that strengthens hepatoma cell apoptosis and control apoptosis-related genes.

The above only is the preferred embodiments of the present invention, only is illustrative for the purpose of the present invention, and nonrestrictive; Those of ordinary skills understand, and can carry out many changes to it in the spirit and scope that claim of the present invention limits, revise, even the equivalence change, but all will fall within the scope of protection of the present invention.

Claims (4)

1. a pharmaceutical composition that is used for the treatment of hepatocarcinoma is characterized in that its effective ingredient is arsenic trioxide and the recombinant adenovirus that contains the PML gene.

2. pharmaceutical composition as claimed in claim 1 is characterized in that the concentration of the arsenic trioxide that contains in the described pharmaceutical composition is 5 μ mol/L, and the MOI of the recombinant adenovirus that contains is 20.

3. pharmaceutical composition as claimed in claim 1 or 2 is characterized in that described recombinant adenovirus prepares in accordance with the following methods:

(1) structure of recombinant vector PSG-PML

Use respectively EcoR I and Bgl II double digestion PSG-CMV and PSG5-PML plasmid, reclaim respectively cmy vector fragment and target DNA fragment, two fragments behind the purification are connected, transform competent escherichia coli cell, screening obtains positive recombiant plasmid PSG-PML;

(2) structure of recombinant adenovirus

Recombinant vector PSG-PML and the plasmid pPE3 that contains 5 type adenovirus right arms are passed through Lipofectamine2000 cotransfection to 293 cell; Virus plaque occurs in 9-14 days behind the cotransfection, through three virus plaque purification, obtain recombinant adenovirus Ad-pml.

4. the application of each described pharmaceutical composition of claim 1-3 in preparation Hepatoma therapy medicine.

Images